Ecological risk assessment of commonly used antibiotics in aquatic ecosystems along the coast of China.

The consistent input of antibiotics into aquatic environments may pose risks to various creatures and ecosystems. However, risk assessment of pharmaceuticals and personal care products (PPCPs) in aquatic environments is frequently limited by the lack of toxicity data. To investigate the risk of commonly used antibiotics to various aquatic creatures, we focused on the distribution patterns and temporal dynamics of antibiotics in the coastal estuary area of China and performed a comprehensive ecological risk assessment for four antibiotics: erythromycin (ERY), tetracycline (TCN), norfloxacin (NOR) and sulfamethoxazole (SMX). An interspecies correlation estimation (ICE)-species sensitivity distribution (SSD) combined model was applied to predict the toxicity data of untested aquatic species, and an accurate ecological risk assessment procedure was developed to evaluate the risk level of PPCPs. The results of risk quotient assessments and probabilistic risk assessments (PRAs) suggested that four objective antibiotics in the Chinese coastal estuary area were at a low risk level. These antibiotics posed a high risk in antibiotic-related global hot spots, with probabilistic risk values for ERY, NOR, SMX, and TCN of 81.33 %, 27.08 %, 21.13 %, and 15.44 %, respectively. We applied an extrapolation method to overcome the lack of toxicity data in ecological risk assessment, enhanced the ecological reality of water quality criteria derivation and reduced the uncertainty of risk assessment for antibiotics.

Legacy and alternative per-and polyfluoroalkyl substances (PFASs) in the Bohai Bay Rim: Occurrence, partitioning behavior, risk assessment, and emission scenario analysis.

The use of alternative per- and polyfluoroalkyl substances (PFASs) has been practiced because of the restrictions on legacy PFASs. However, knowledge gaps exist on the ecological risks of alternatives and relationships between restrictions and emissions. This study systematically analyzed the occurrence characteristics, water-sediment partitioning behaviors, ecological risks, and emissions of legacy and alternative PFASs in the Bohai Bay Rim (BBR). The mean concentration of total PFASs was 46.105 ng/L in surface water and 6.125 ng/g dry weight (dw) in sediments. As an alternative for perfluorooctanoic acid (PFOA), hexafluoropropylene oxide dimer acid (GenX) had a concentration second only to PFOA in surface water. In sediments, perfluorobutyric acid (PFBA) and GenX were the two predominant contaminants. In the water-sediment partitioning system, GenX, 9-chlorohexadecafluoro-3-oxanone-1-sulfonic acid (F-53B), and 11-chloroeicosafluoro-3-oxaundecane-1-sulfonic acid (8:2 Cl-PFESA) tended to be enriched towards sediments. The species sensitivity distribution (SSD) models revealed the low ecological risks of PFASs and their alternatives in the BBR. Moreover, predicted no-effected concentrations (PNECs) indicated that short-chain alternatives like PFBA and perfluorobutane sulfonate (PFBS) were safer for aquatic ecosystems, while caution should be exercised when using GenX and F-53B. Due to the incremental replacement of PFOA by GenX, cumulative emissions of 1317.96 kg PFOA and 667.22 kg GenX were estimated during 2004-2022, in which PFOA emissions were reduced by 59.2 % due to restrictions implemented since 2016. If more stringent restrictions are implemented from 2023 to 2030, PFOA emissions will further decrease by 85.0 %, but GenX emissions will increase by an additional 21.3 %. Simultaneously, GenX concentrations in surface water are forecasted to surge by 2.02 to 2.45 times in 2023. This study deepens the understanding of PFAS alternatives and assists authorities in developing policies to administer PFAS alternatives.

Study on the mechanism of vitamin E alleviating non-alcoholic fatty liver function based on non-targeted metabolomics analysis in rats.

Non-alcoholic fatty liver disease (NAFLD) is a hepatic manifestation of metabolic syndrome. Vitamin E (VE) has antioxidant properties and can mediate lipid metabolism. Non-targeted metabolomics technology was employed to uncover comprehensively the metabolome of VE in NAFLD rats. NAFLD model was created with a high-fat and high-cholesterol diet (HFD) in rats. NAFLD rats in the VE group were given 75 mg/(kg day) VE. The metabolites in the serum of rats were identified via UPLC and Q-TOF/MS analysis. KEGG was applied for the pathway enrichment. VE improved the liver function, lipid metabolism, and oxidative stress in NAFLD rats induced by HFD. Based on the metabolite profile data, 132 differential metabolites were identified between VE group and the HFD group, mainly including pyridoxamine, betaine, and bretylium. According to the KEGG results, biosynthesis of cofactors was a key metabolic pathway of VE in NAFLD rats. VE can alleviate NAFLD induced by HFD, and the underlying mechanism is associated with the biosynthesis of cofactors, mainly including pyridoxine and betaine.

An arrayed CRISPR knockout screen identifies genetic regulators of GLUT1 expression.

Glucose, a primary fuel source under homeostatic conditions, is transported into cells by membrane transporters such as glucose transporter 1 (GLUT1). Due to its essential role in maintaining energy homeostasis, dysregulation of GLUT1 expression and function can adversely affect many physiological processes in the body. This has implications in a wide range of disorders such as Alzheimer's disease (AD) and several types of cancers. However, the regulatory pathways that govern GLUT1 expression, which may be altered in these diseases, are poorly characterized. To gain insight into GLUT1 regulation, we performed an arrayed CRISPR knockout screen using Caco-2 cells as a model cell line. Using an automated high content immunostaining approach to quantify GLUT1 expression, we identified more than 300 genes whose removal led to GLUT1 downregulation. Many of these genes were enriched along signaling pathways associated with G-protein coupled receptors, particularly the rhodopsin-like family. Secondary hit validation confirmed that removal of select genes, or modulation of the activity of a corresponding protein, yielded changes in GLUT1 expression. Overall, this work provides a resource and framework for understanding GLUT1 regulation in health and disease.

Topsoil selenium (Se) under Se-rich farming in China: Current status, cropping impacts and ecological risk assessment.

Selenium (Se), as an essential microelement, can be supplied through Se-biofortified food from Se-rich soils and associated farming practices for human health, while it can also cause eco-risks if overapplied. In this study, a multi-scale spatiotemporal meta-analysis was conducted to guide sustainable Se-rich farming in China by combining a long-term survey with a reviewed database. The weighted mean concentration, spatial distribution of soil Se, nationwide topsoil Se variation from cropping impacts and its bioavailability-based ecological risks were assessed and quantified. The results showed that the weighted mean content (0.3 mg kg-1) of China was slightly higher than that of previous nationwide topsoil Se surveys, as more Se-rich areas were found in recent high-density sampling surveys. Cropping has overall reduced Se content by 9.5% from farmland across China and deprived more with the increase in farming rotation driven by geo-climatic conditions. Long-term cropping removed Se from Se-rich areas but accumulated it in Se-deficient areas. Additionally, the bioavailable Se content of topsoil in China ranged from 0 to 332 µg kg-1, and the bioavailability-based eco-risks indicated that high eco-risks only existed in overfertilized and extremely high-Se soils, such as in Enshi, Ziyang and some coalfield areas. This work provides evidence for the development of sustainable Se-rich farming with proper utilization of soil Se resources, simultaneously protecting the soil eco-environment.

A prospective ecological risk assessment method based on exposure and ecological scenarios (ERA-EES) to determine soil ecological risks around metal mining areas.

Soil heavy metal (HM) contamination around metal mining areas (MMAs) is a global concern that requires a cost-effective ecological risk assessment (ERA) method for preventive management. Traditional ERAs, comparing environmental HM concentrations with benchmarks, are labor- and cost-intensive in field investigations and chemical analyses, which challenge the management demands of numerous MMAs. In this study, a prospective ecological risk assessment method based on exposure and ecological scenario (ERA-EES) was developed to predict the eco-risk levels (low/medium/high) around MMAs prior to field sampling. Five exposure scenario indicators related to soil HM exposure and three ecological scenario indicators reflecting the soil bioreceptor response were selected and combined with the analytic hierarchy process and fuzzy comprehensive evaluation methods for ERA-EES development. Case application and performance evaluation with 67 MMAs in China demonstrated that the ERA-EES method had an overall effective and conservative performance when referring to potential ecological risk index (PERI) levels, with an accuracy of 0.87, kappa coefficient of 0.7, and low or medium eco-risk levels in PERI classified to high levels in ERA-EES. Overall, the selected scenario indicators could efficiently reflect the risk levels of soil HM pollution from mining activities. Besides, more regulatory efforts should be paid to the MMAs of nonferrous metals, underground and long-term mining and those located in southern China. This work provided a convenient and cost-effective prospective ERA method under the trend of ERA being tiered and refined, facilitating the risk management of various MMAs.

Ciprofloxacin enhances cadmium toxicity to earthworm Eisenia fetida by altering the gut microorganism composition.

The concurrent existence of cadmium (Cd) and ciprofloxacin (CIP) in agricultural soils is very common, but presents a challenge to soil organisms. As more attention has been paid to the effect of toxic metals on the migration of antibiotic resistance genes, the critical role of the gut microbiota in CIP-modifying Cd toxicity in earthworms remains unclear. In this study, Eisenia fetida was exposed to Cd and CIP alone or in combination at environmentally relevant concentrations. Cd and CIP accumulation in earthworm increased as their respective spiked concentrations increased. In fact, Cd accumulation increased by 39.7% when 1 mg/kg CIP was added; however, the addition of Cd did not affect CIP uptake. Compared with exposure to Cd alone, a greater ingestion of Cd following combined exposure to Cd and 1 mg/kg CIP resulted in greater oxidative stress and energy metabolism disturbances in earthworms. The reactive oxygen species (ROS) contents and apoptosis rate of coelomocytes were more sensitive to Cd than these biochemical indicators. In fact, 1 mg/kg Cd induced the derivation of ROS. Similarly, the toxicity of Cd (5 mg/kg) to coelomocytes was promoted by CIP (1 mg/kg), ROS content in coelomocytes and the apoptosis rate increased by 29.2% and 113.1%, respectively, due to increased Cd accumulation. Further investigation of the gut microorganisms revealed that the decreased abundance of Streptomyces strains (known as Cd accumulation taxa) could be a critical factor for enhanced Cd accumulation and greater Cd toxicity to earthworms following exposure to both Cd and CIP; this was because this microorganism group was eliminated by the simultaneous ingestion of CIP. This study stressed the role of gut microorganisms in altering the toxicity of Cd and CIP combined contamination in soil organisms. More attention should be paid to the ecological risks of such combined contamination in soils.

Metabolic variation and oxidative stress response of blue mussels (Mytilus sp.) perturbed by norfloxacin exposure.

Antibiotics are currently widely applied in agricultural cultivation, animal husbandry, and medical treatment, but the effects and ecological risks of antibiotics need to be further investigated. Norfloxacin is one of the most widely applied fluoroquinolone antibiotics and is commonly detected in aquatic ecosystems. In this study, the activities of catalase (CAT) and glutathione S-transferase (GST) in blue mussels (Mytilus sp.) exposed to norfloxacin (from 25 to 200 mg/L) for 2 d of acute exposure and 7 d of subacute exposure were measured. 1H nuclear magnetic resonance (1H-NMR)-based metabolomics was applied to identify the metabolites and to investigate the physiological metabolism of blue mussels (Mytilus sp.) under different concentrations of norfloxacin. The activity of the CAT enzyme was induced in acute exposure, while the activity of GST was inhibited in subacute exposure when the concentration of norfloxacin reached 200 mg/L. Orthogonal partial least squares discriminant analysis (OPLS-DA) revealed that the increased concentrations of norfloxacin might cause greater metabolic differences between the treatment and control groups and cause greater metabolic variation within the same treatment group. The contents of taurine in the 150 mg/L acute exposure group were 5.17 times higher than those in the control group. The pathway analysis indicated that exposure to high concentrations of norfloxacin disturbed different pathways involved in energy metabolism, amino acid metabolism, neuroregulation, and the regulation of osmotic pressure. These results may provide a molecular and metabolic view of the effects of norfloxacin and the regulatory mechanism of blue mussels when exposed to extremely high doses of antibiotics.

A cysteine-rich secretory protein involves in phytohormone melatonin mediated plant resistance to CGMMV.

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.

Ring Repeating Unit: An Upgraded Structure Representation of Linear Condensation Polymers for Property Prediction.

Unique structure representation of polymers plays a crucial role in developing models for polymer property prediction and polymer design by data-centric approaches. Currently, monomer and repeating unit (RU) approximations are widely used to represent polymer structures for generating feature descriptors in the modeling of quantitative structure-property relationships (QSPR). However, such conventional structure representations may not uniquely approximate heterochain polymers due to the diversity of monomer combinations and the potential multi-RUs. In this study, the so-called ring repeating unit (RRU) method that can uniquely represent polymers with a broad range of structure diversity is proposed for the first time. As a proof of concept, an RRU-based QSPR model was developed to predict the associated glass transition temperature (Tg) of polyimides (PIs) with deterministic values. Comprehensive model validations including external, internal, and Y-random validations were performed. Also, an RU-based QSPR model developed based on the same large database of 1321 PIs provides nonunique prediction results, which further prove the necessity of RRU-based structure representation. Promising results obtained by the application of the RRU-based model confirm that the as-developed RRU method provides an effective representation that accurately captures the sequence of repeat units and thus realizes reliable polymer property prediction by data-driven approaches.

Distribution of legacy and novel per- and polyfluoroalkyl substances in surface and groundwater affected by irrigation in an arid region.

Frequent exchange of surface water and groundwater occurs in arid/semi-arid areas due to high evaporation and intensive irrigation activities, affecting the migration and transformation of per- and polyfluoroalkyl substances (PFASs) and threatening drinking water safety. This study analyzed legacy PFASs and potential precursors in surface water, groundwater, soil, and aquifer solid samples collected from a typical arid area, the Hetao Irrigation District of Northern China, to explore PFASs distribution and transformation between surface and ground. Total PFASs (ΣPFASs) in surface water was 29-232 ng/L, higher than 2-77 ng/L in groundwater. ΣPFASs in soil were 0.29-0.59 ng/g, higher than 0.09-0.27 in the aquifer solids. Regarding horizontal distribution, the concentration of PFASs in groundwater increased in downtowns and the areas recharged with lake water. In terms of vertical distribution, ΣPFASs decreased with the increase of depth, and more PFASs adsorbed on clay particles in the aquifer. The total oxidable precursor analysis showed that 8:2 FT and 4:2 FT were the dominant precursors of PFASs, resulting in an increment of 0.1-4 ng/L PFASs. Hydrogen and oxygen stable isotope compositions suggest similar sources between surface water and groundwater in the study area, while principal component analysis and Bayesian inference also indicate that surface water is an important source of groundwater PFASs. The annual infiltration PFASs to groundwater from Ulansuhai was estimated by the water balance approach to be 9.39 kg. Results highlight the influence of agricultural irrigation activities and lake infiltration on groundwater PFASs in the arid region.

Interaction between cucumber green mottle mosaic virus MP and CP promotes virus systemic infection.

The movement protein (MP) and coat protein (CP) of tobamoviruses play critical roles in viral cell-to-cell and long-distance movement, respectively. Cucumber green mottle mosaic virus (CGMMV) is a member of the genus Tobamovirus. The functions of CGMMV MP and CP during viral infection remain largely unclear. Here, we show that CGMMV MP can interact with CP in vivo, and the amino acids at positions 79-128 in MP are vital for the MP-CP interaction. To confirm this finding, we mutated five conserved residues within the residue 79-128 region and six other conserved residues flanking this region, followed by in vivo interaction assays. The results showed that the conserved threonine residue at the position 107 in MP (MPT107 ) is important for the MP-CP interaction. Substitution of T107 with alanine (MPT107A ) delayed CGMMV systemic infection in Nicotiana benthamiana plants, but increased CGMMV local accumulation. Substitutions of another 10 conserved residues, not responsible for the MP-CP interaction, with alanine inhibited or abolished CGMMV systemic infection, suggesting that these 10 conserved residues are possibly required for the MP movement function through a CP-independent manner. Moreover, two movement function-associated point mutants (MPF17A and MPD97A ) failed to cause systemic infection in plants without impacting on the MP-CP interaction. Furthermore, we have found that co-expression of CGMMV MP and CP increased CP accumulation independent of the interaction. MP and CP interaction inhibits the salicylic acid-associated defence response at an early infection stage. Taken together, we propose that the suppression of host antiviral defence through the MP-CP interaction facilitates virus systemic infection.

Source-specific ecological risks and critical source identification of PPCPs in surface water: Comparing urban and rural areas.

To control the concentrations of pharmaceutical and personal care products (PPCPs) in the surface water of urban and rural areas, it is important to explore the spatial variation in source-specific ecological risks and identify critical sources. Here, we focused on 22 PPCPs found in the effluent from wastewater treatment plants and surface water in Tianjin, and source-specific risk was quantitatively apportioned combining positive matrix factorization with ecological risk assessment. Results showed that rural areas exhibited a more severe contamination level than urban areas. Medical wastewater (30.1 %) accounted for the highest proportion, while domestic sewage posed the greatest threat to aquatic ecosystems. The incidence of potential risks (RQ > 0.01) caused by domestic sewage in urban areas (88.9 %) was higher than that in rural areas (75.9 %). However, PPCP risks caused by farmland drainage, aquaculture, and livestock discharge were mainly distributed in rural areas. The critical source identified in the entire region was domestic sewage (weight, 0.36), and its weight (0.51) in urban areas was greater than that in rural areas (0.32). The impact of aquaculture (weight, 0.16) in rural areas was noteworthy. These findings may contribute to developing environmental management strategies in key areas to help alleviate PPCP contamination worldwide.

Nuclear receptor ligand screening in an iPSC-derived in vitro blood-brain barrier model identifies new contributors to leptin transport.

BACKGROUND: The hormone leptin exerts its function in the brain to reduce food intake and increase energy expenditure to prevent obesity. However, most obese subjects reflect the resistance to leptin even with elevated serum leptin. Considering that leptin must cross the blood-brain barrier (BBB) in several regions to enter the brain parenchyma, altered leptin transport through the BBB might play an important role in leptin resistance and other biological conditions. Here, we report the use of a human induced pluripotent stem cell (iPSC)-derived BBB model to explore mechanisms that influence leptin transport. METHODS: iPSCs were differentiated into brain microvascular endothelial cell (BMEC)-like cells using standard methods. BMEC-like cells were cultured in Transwell filters, treated with ligands from a nuclear receptor agonist library, and assayed for leptin transport using an enzyme-linked immune sorbent assay. RNA sequencing was further used to identify differentially regulated genes and pathways. The role of a select hit in leptin transport was tested with the competitive substrate assay and after gene knockdown using CRISPR techniques. RESULTS: Following a screen of 73 compounds, 17ß-estradiol was identified as a compound that could significantly increase leptin transport. RNA sequencing revealed many differentially expressed transmembrane transporters after 17ß-estradiol treatment. Of these, cationic amino acid transporter-1 (CAT-1, encoded by SLC7A1) was selected for follow-up analyses due to its high and selective expression in BMECs in vivo. Treatment of BMEC-like cells with CAT-1 substrates, as well as knockdown of CAT-1 expression via CRISPR-mediated epigenome editing, yielded significant increases in leptin transport. CONCLUSIONS: A major female sex hormone, as well as an amino acid transporter, were revealed as regulators of leptin BBB transport in the iPSC-derived BBB model. Outcomes from this work provide insights into regulation of hormone transport across the BBB.

[Screening and Control Measures for New Priority Pollutants in Surface Water of Tianjin].

Emerging pollutants are frequently detected in surface water, threatening the regional aquatic ecosystem and human health. Due to their complex types and large differences in risk and toxicity, research based on the comprehensive assessment of the pollution characteristics to determine the new priority pollutants remains incomplete. This study established a multi-criterion scoring method targeting 41 emerging pollutants with the goal of protecting aquatic organisms and human health, using five key indicators including environmental exposure level, persistence, bioaccumulation, ecological risk, and health risk of pollutants. The emerging pollutants were screened and identified in the surface water of Tianjin. The priority levels of different congeners were divided, and the ecological and health risks of pollutants in the priority control list were evaluated. The results showed that 41 emerging pollutants were generally detected in the study area. The average concentration of sulfonamide antibiotics (SAs) and other drugs (Others) were the largest, with 200.04 ng·L-1 and 176.30 ng·L-1, respectively, followed by perfluorinated compounds (PFASs, 57.98 ng·L-1). In terms of pollutant categories, high-priority emerging pollutants were dominated by PFASs, accounting for 50%. Medium-priority emerging pollutants were still dominated by PFASs (26.32%), but the proportion was lower. Low-priority emerging pollutants were dominated by SAs, accounting for 31.25%. Perfluorooctane sulfonic acid (PFOS), perfluorooctanoic acid (PFOA), carbamazepine (CBZ), caffeine (CAF), perfluorohexyl sulfonic acid (PFHxA), and clarithromycin (CLA) were defined as a priority control list. Compared with other pollutants, PFOS and PFOA had higher scores in persistence, bioaccumulation, and health risk, whereas CBZ and CAF had higher scores in ecological risk. The average risk quotient (RQ) of CAF was 4.8, which indicated a relatively high ecological risk. Health risk indicated that the potential risk caused by PFOA (average hazard quotient was 0.018) cannot be ignored. For the priority control list, because of the high removal rate of CAF in sewage treatment plants, the construction of a pipe network and riverside belt with high vegetation coverage should be strengthened to reduce the impact of untreated sewage discharge and rainfall runoff. Pollutants with low removal rates in sewage treatment plants should be treated with combined technologies to improve the removal efficiency. In addition, industry substitution work should be accelerated to reduce emissions of PFOS, PFOA, and PFHxA.

Identification and characterization of a new geminivirus from soybean plants and determination of V2 as a pathogenicity factor and silencing suppressor.

BACKGROUND: Soybean is one of the four major crops in China. The occurrence of viruses in soybean causes significant economic losses. RESULTS: In this study, the soybean leaves from stay-green plants showing crinkle were collected for metatranscriptomic sequencing. A novel geminivirus, tentatively named soybean geminivirus A (SGVA), was identified in soybean stay-green plants. Sequence analysis of the full-length SGVA genome revealed a genome of 2762 nucleotides that contain six open reading frames. Phylogenetic analyses revealed that SGVA was located adjacent to the clade of begomoviruses in both the full genome-based and C1-based phylogenetic tree, while in the CP-based phylogenetic tree, SGVA was located adjacent to the clade of becurtoviruses. SGVA was proposed as a new recombinant geminivirus. Agroinfectious clone of SGVA was constructed. Typical systemic symptoms of curly leaves were observed at 11 dpi in Nicotiana benthamiana plants and severe dwarfism was observed after 3 weeks post inoculation. Expression of the SGVA encoded V2 and C1 proteins through a potato virus X (PVX) vector caused severe symptoms in N. benthamiana. The V2 protein inhibited local RNA silencing in co-infiltration assays in GFP transgenic 16C N. benthamiana plants. Further study revealed mild symptoms in N. benthamiana plants inoculated with SGVA-ZZ V2-STOP and SGVA-ZZ V2-3738AA mutants. Both the relative viral DNA and CP protein accumulation levels significantly decreased when compared with SGVA-inoculated plants. CONCLUSIONS: This work identified a new geminivirus in soybean stay-green plants and determined V2 as a pathogenicity factor and silencing suppressor.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Effects of urbanization on the distribution of polycyclic aromatic hydrocarbons in China's estuarine rivers.

Estuarine rivers are the primary medium for transporting pollutants from human activities to the ocean. Polycyclic aromatic hydrocarbons (PAHs) have substantial toxicity and pose a significant risk to ecosystem and human health. However, the influences of urbanization on their distribution, particularly in China where urbanization is occurring rapidly, remain unclear. This study took three coastal economic circles of China as research areas, and investigated PAHs (16 species) in the estuarine river water. 95.9% of the sampling sites demonstrated moderate PAHs pollution and moderate ecological risk. Coal and petroleum combustion was the primary source of PAHs, but the source composition varied among the regions. Air pollution caused by energy emissions, particularly carbon emissions, has a critical and differential effect on PAHs distribution and deposition. With the increasing use of clean energy, PAHs emissions have been gradually reduced, which provides an effective option for PAHs reduction in a rapidly urbanizing coastal region.