Diversification and Functional Evolution of HOX Proteins.

Gene duplication and divergence is a major contributor to the generation of morphological diversity and the emergence of novel features in vertebrates during evolution. The availability of sequenced genomes has facilitated our understanding of the evolution of genes and regulatory elements. However, progress in understanding conservation and divergence in the function of proteins has been slow and mainly assessed by comparing protein sequences in combination with in vitro analyses. These approaches help to classify proteins into different families and sub-families, such as distinct types of transcription factors, but how protein function varies within a gene family is less well understood. Some studies have explored the functional evolution of closely related proteins and important insights have begun to emerge. In this review, we will provide a general overview of gene duplication and functional divergence and then focus on the functional evolution of HOX proteins to illustrate evolutionary changes underlying diversification and their role in animal evolution.

Evaluation of transgenic chickpea harboring codon-modified Vip3Aa against gram pod borer (Helicoverpa armigera H.).

The gram pod borer is a major pest of chickpea, accounting for average annual yield losses to the tune of 40-50%. VIP3Aa, a class of insecticidal protein with different receptor binding site in the insect's midgut compared to Bt-crystal protein, offers an alternative protection strategy against Lepidopteran insects. Here, we report evaluation of genetically engineered chickpea lines harboring codon modified Vip3Aa (cmVip3Aa) against the Lepidopteran insect pest, gram pod borer. The synthetic codon modified, cmVip3Aa gene of 2,370 bp was sub-cloned in modified plant expression vector and used for direct transformation of embryonic axis explants of chickpea (cv. DCP 92-3), with transformation efficiency of 4.30%. Presence and transmission of transgene across two generations were confirmed by PCR and Southern blot analyses in the five selected transgenic chickpea lines. Real Time PCR analyses indicated variable levels of cmVip3Aa expression in the transgenic chickpea lines (average Cq values 15.01±0.86 to 19.32±0.10), which were absent in the non-transgenic counterpart. Detached leaf insect bioassay indicate larval mortality (up to 39.75%), reduced larval feeding (up to 82.91%) and reduced larval weight gain (up to 68.23%), compared to control lines. Evaluation of gene offers a platform to identify efficacious insecticidal gene that can be used for insect resistance management in chickpea.

Genome-wide analysis of cis-regulatory changes underlying metabolic adaptation of cavefish.

Cis-regulatory changes are key drivers of adaptative evolution. However, their contribution to the metabolic adaptation of organisms is not well understood. Here, we used a unique vertebrate model, Astyanax mexicanus-different morphotypes of which survive in nutrient-rich surface and nutrient-deprived cave waters-to uncover gene regulatory networks underlying metabolic adaptation. We performed genome-wide epigenetic profiling in the liver tissues of Astyanax and found that many of the identified cis-regulatory elements (CREs) have genetically diverged and have differential chromatin features between surface and cave morphotypes, while retaining remarkably similar regulatory signatures between independently derived cave populations. One such CRE in the hpdb gene harbors a genomic deletion in cavefish that abolishes IRF2 repressor binding and derepresses enhancer activity in reporter assays. Selection of this mutation in multiple independent cave populations supports its importance in cave adaptation, and provides novel molecular insights into the evolutionary trade-off between loss of pigmentation and adaptation to food-deprived caves.

Genome-Wide Analysis of Late Embryogenesis Abundant Protein Gene Family in Vigna Species and Expression of VrLEA Encoding Genes in Vigna glabrescens Reveal Its Role in Heat Tolerance.

Late embryogenesis abundant (LEA) proteins are identified in many crops for their response and role in adaptation to various abiotic stresses, such as drought, salinity, and temperature. The LEA genes have been studied systematically in several crops but not in Vigna crops. In this study, we reported the first comprehensive analysis of the LEA gene family in three legume species, namely, mung bean (Vigna radiata), adzuki bean (Vigna angularis), and cowpea (Vigna unguiculata), and the cross-species expression of VrLEA genes in a wild tetraploid species, Vigna glabrescens. A total of 201 LEA genes from three Vigna crops were identified harboring the LEA conserved motif. Among these 55, 64, and 82 LEA genes were identified in mung bean, adzuki bean, and cowpea genomes, respectively. These LEA genes were grouped into eight different classes. Our analysis revealed that the cowpea genome comprised all eight classes of LEA genes, whereas the LEA-6 class was absent in the mung bean genome. Similarly, LEA-5 and LEA-6 were absent in the adzuki bean genome. The analysis of LEA genes provides an insight into their structural and functional diversity in the Vigna genome. The genes, such as VrLEA-2, VrLEA-40, VrLEA-47, and VrLEA-55, were significantly upregulated in the heat-tolerant genotype under stress conditions indicating the basis of heat tolerance. The successful amplification and expression of VrLEA genes in V. glabrescens indicated the utility of the developed markers in mung bean improvement. The results of this study increase our understanding of LEA genes and provide robust candidate genes for future functional investigations and a basis for improving heat stress tolerance in Vigna crops.

Occurrence, molecular characterization and antimicrobial-resistance pattern of Staphylococcus species isolates from buck semen.

Staphylococcus aureus is one of the most prevalent pathogens, and a causative agent of a variety of infections in humans and animals. Most studies concentrated on characterization of staphylococcus isolates and its antimicrobial resistance from various illness of veterinary importance, but there is no specific study that is available on isolates from reproductive tract of small ruminants and especially its semen. Hence, in the current study, a total of 48 semen samples were collected from healthy bucks of different breeds to investigate the occurrence of S. aureus. Antimicrobial resistance and virulence of the Staphylococcus isolates were determined to assess the adverse effects of them on buck fertility. The bacterial isolates were tentatively confirmed as Staphylococcus spp. based on the Gram's staining, growth on Mannitol salt agar and catalase test. Overall, 75% (n = 36) of the samples were positive for Staphylococcus spp. from the total 48 buck semen ejaculates from different breeds and among them 23 (63.89%) were coagulase-negative (CoNS) and 13 (36.11%) were coagulase-positive Staphylococcus (CoPS) strains. The species identified by molecular characterization are S. aureus, S. chromogenes, S. haemolyticus, S. sciuri, S. simulans, and S. epidermidis from buck semen. Further, these isolates exhibited varying degrees of multidrug resistance genotypically as well as phenotypically. The presence of antibiotic resistance and virulence genes may pose a potential threat to reproductive health of animals, the animal handlers and livestock keepers, while simultaneously highlighting the need for vigilant monitoring of these isolates at the time of semen cryopreservation.

Morphometric and microsatellite-based comparative genetic diversity analysis in Bubalus bubalis from North India.

To understand the similarities and dissimilarities of a breed structure among different buffalo breeds of North India, it is essential to capture their morphometric variation, genetic diversity, and effective population size. In the present study, diversity among three important breeds, namely, Murrah, Nili-Ravi and Gojri were studied using a parallel approach of morphometric characterization and molecular diversity. Morphology was characterized using 13 biometric traits, and molecular diversity through a panel of 22 microsatellite DNA markers recommended by FAO, Advisory Group on Animal Genetic Diversity, for diversity studies in buffaloes. Canonical discriminate analysis of biometric traits revealed different clusters suggesting distinct genetic entities among the three studied populations. Analysis of molecular variance revealed 81.8% of genetic variance was found within breeds, while 18.2% of the genetic variation was found between breeds. Effective population sizes estimated based on linkage disequilibrium were 142, 75 and 556 in Gojri, Nili-Ravi and Murrah populations, respectively, indicated the presence of sufficient genetic variation and absence of intense selection among three breeds. The Bayesian approach of STRUCTURE analysis (at K = 3) assigned all populations into three clusters with a degree of genetic admixture in the Murrah and Nili-Ravi buffalo populations. Admixture analysis reveals introgression among Murrah and Nili-Ravi breeds while identified the Gojri as unique buffalo germplasm, indicating that there might be a common origin of Murrah and Nili-Ravi buffaloes. The study provides important insights on buffalo breeds of North India that could be utilized in designing an effective breeding strategy, with an appropriate choice of breeds for upgrading local non-descript buffaloes along with conservation of unique germplasm.

Construction of a high-density genetic map and QTL analysis for yield, yield components and agronomic traits in chickpea (Cicer arietinum L.).

Unravelling the genetic architecture underlying yield components and agronomic traits is important for enhancing crop productivity. Here, a recombinant inbred line (RIL) population, developed from ICC 4958 and DCP 92-3 cross, was used for constructing linkage map and QTL mapping analysis. The RIL population was genotyped using a high-throughput Axiom®CicerSNP array, which enabled the development of a high-density genetic map consisting of 3,818 SNP markers and spanning a distance of 1064.14 cM. Analysis of phenotyping data for yield, yield components and agronomic traits measured across three years together with genetic mapping data led to the identification of 10 major-effect QTLs and six minor-effect QTLs explaining up to 59.70% phenotypic variance. The major-effect QTLs identified for 100-seed weight, and plant height possessed key genes, such as C3HC4 RING finger protein, pentatricopeptide repeat (PPR) protein, sugar transporter, leucine zipper protein and NADH dehydrogenase, amongst others. The gene ontology studies highlighted the role of these genes in regulating seed weight and plant height in crop plants. The identified genomic regions for yield, yield components, and agronomic traits, and the closely linked markers will help advance genetics research and breeding programs in chickpea.

Comprehensive RNAseq analysis for identification of genes expressed under heat stress in lentil.

Lentils are highly sensitive to abrupt increases in temperature during the mid to late reproductive stages, leading to severe biomass and seed yield reduction. Therefore, we carried out an RNAseq analysis between IG4258 (heat tolerant) and IG3973 (heat sensitive) lentil genotypes at the reproductive stage under both normal and heat stress conditions in the field. It resulted in 209,549 assembled transcripts and among these 161,809 transcripts had coding regions, of which 94,437 transcripts were annotated. The differential gene expression analysis showed upregulation of 678 transcripts and downregulation of 680 transcripts between the tolerant and sensitive genotypes at the early reproductive stage. While 76 transcripts were upregulated and 47 transcripts were downregulated at the late reproductive stage under heat stress conditions. The validation of 12 up-or downregulated transcripts through RT-PCR corresponded well with the expression analysis data of RNAseq, with a correlation of R2  = 0.89. Among these transcripts, the DN364_c1_g1_i9 and DN2218_c0_g1_i5 transcripts encoded enzymes involved in the tryptophan pathway, indicating that tryptophan biosynthesis plays a role under heat stress in lentil. Moreover, KEGG pathways enrichment analysis identified transcripts associated with genes encoding proteins/regulating factors related to different metabolic pathways including signal transduction, fatty acid biosynthesis, rRNA processing, ribosome biogenesis, gibberellin (GA) biosynthesis, and riboflavin biosynthesis. This analysis also identified 6852 genic-SSRs leading to the development of 4968 SSR primers that are potential genomic resources for molecular mapping of heat-tolerant genes in lentil.

Effect of elevated carbon-dioxide on plant growth, physiology, yield and seed quality of chickpea (Cicer arietinum L.) in Indo-Gangetic plains.

In the present scenario of climate change with constantly increasing CO2 concentration, there is a risk of altered crop performance in terms of growth, yield, grain nutritional value and seed quality. Therefore, an experiment was conducted in open top chamber (OTCs) during 2017-18 and 2018-19 to assess the effect of elevated atmospheric carbondioxide (e[CO2]) (600 ppm) on chickpea (cv. JG 14) crop growth, biomass accumulation, physiological function, seed yield and its quality in terms of germination and vigour. The e[CO2] treatment increased the plant height, leaf and stem biomass over ambient CO2 (a[CO2]) treatment. The e[CO2] increased seed yield by 11-18% which was attributed to an increase in the number of pods (6-10%) and seeds plant-1 (8-9%) over a[CO2]. However, e[CO2] reduced the seed protein (7%), total phenol (13%) and thiobarbituric acid reactive substances (12%) and increased the starch (21%) and water uptake rate as compared to seeds harvested from a[CO2] environment. Exposing chickpea plant to e[CO2] treatment had no impact on germination and vigour of the harvested seeds. Also, the physical attributes, total soluble sugar and antioxidant enzymes activities of harvested seeds were comparable in a[CO2] and e[CO2] treatment. Hence, the experimental findings depict that e[CO2] upto 600 ppm could add to the growth and productivity of chickpea in a sub-tropical climate with an implication on its nutritional quality of the produce.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Genome-Wide Binding Analyses of HOXB1 Revealed a Novel DNA Binding Motif Associated with Gene Repression.

Knowledge of the diverse DNA binding specificities of transcription factors is important for understanding their specific regulatory functions in animal development and evolution. We have examined the genome-wide binding properties of the mouse HOXB1 protein in embryonic stem cells differentiated into neural fates. Unexpectedly, only a small number of HOXB1 bound regions (7%) correlate with binding of the known HOX cofactors PBX and MEIS. In contrast, 22% of the HOXB1 binding peaks display co-occupancy with the transcriptional repressor REST. Analyses revealed that co-binding of HOXB1 with PBX correlates with active histone marks and high levels of expression, while co-occupancy with REST correlates with repressive histone marks and repression of the target genes. Analysis of HOXB1 bound regions uncovered enrichment of a novel 15 base pair HOXB1 binding motif HB1RE (HOXB1 response element). In vitro template binding assays showed that HOXB1, PBX1, and MEIS can bind to this motif. In vivo, this motif is sufficient for direct expression of a reporter gene and over-expression of HOXB1 selectively represses this activity. Our analyses suggest that HOXB1 has evolved an association with REST in gene regulation and the novel HB1RE motif contributes to HOXB1 function in part through a repressive role in gene expression.

Transgenic chickpea (Cicer arietinum L.) harbouring AtDREB1a are physiologically better adapted to water deficit.

BACKGROUND: Chickpea (Cicer arietinum L.) is the second most widely grown pulse and drought (limiting water) is one of the major constraints leading to about 40-50% yield losses annually. Dehydration responsive element binding proteins (DREBs) are important plant transcription factors that regulate the expression of many stress-inducible genes and play a critical role in improving the abiotic stress tolerance. Transgenic chickpea lines harbouring transcription factor, Dehydration Responsive Element-Binding protein 1A from Arabidopsis thaliana (AtDREB1a gene) driven by stress inducible promoter rd29a were developed, with the intent of enhancing drought tolerance in chickpea. Performance of the progenies of one transgenic event and control were assessed based on key physiological traits imparting drought tolerance such as plant water relation characteristics, chlorophyll retention, photosynthesis, membrane stability and water use efficiency under water stressed conditions. RESULTS: Four transgenic chickpea lines harbouring stress inducible AtDREB1a were generated with transformation efficiency of 0.1%. The integration, transmission and regulated expression were confirmed by Polymerase Chain Reaction (PCR), Southern Blot hybridization and Reverse Transcriptase polymerase chain reaction (RT-PCR), respectively. Transgenic chickpea lines exhibited higher relative water content, longer chlorophyll retention capacity and higher osmotic adjustment under severe drought stress (stress level 4), as compared to control. The enhanced drought tolerance in transgenic chickpea lines were also manifested by undeterred photosynthesis involving enhanced quantum yield of PSII, electron transport rate at saturated irradiance levels and maintaining higher relative water content in leaves under relatively severe soil water deficit. Further, lower values of carbon isotope discrimination in some transgenic chickpea lines indicated higher water use efficiency. Transgenic chickpea lines exhibiting better OA resulted in higher seed yield, with progressive increase in water stress, as compared to control. CONCLUSIONS: Based on precise phenotyping, involving non-invasive chlorophyll fluorescence imaging, carbon isotope discrimination, osmotic adjustment, higher chlorophyll retention and membrane stability index, it can be concluded that AtDREB1a transgenic chickpea lines were better adapted to water deficit by modifying important physiological traits. The selected transgenic chickpea event would be a valuable resource that can be used in pre-breeding or directly in varietal development programs for enhanced drought tolerance under parched conditions.

HSPB5 (αB-crystallin) confers protection against paraquat-induced oxidative stress at the organismal level in a tissue-dependent manner.

Oxidative stress is one of the major and continuous stresses, an organism encounters during its lifetime. Tissues such as the brain, liver and muscles are more prone to damage by oxidative stress due to their metabolic activity, differences in physiological and adaptive processes. One of the defence mechanisms against continuous oxidative stress is a set of small heat shock proteins. αB-Crystallin/HSPB5, a small heat shock protein, gets upregulated under stress and acts as a molecular chaperone. In addition to acting as a molecular chaperone, HSPB5 is shown to have a role in other cytoprotective functions such as inhibition of apoptosis, prevention of oxidative stress and stabilisation of cytoskeletal system. Such protection in vivo, at the organism level, particularly in a tissue-dependent manner, has not been investigated. We have expressed HSPB5 in fat body (liver), neurons and specifically in dopaminergic and motor neurons in Drosophila and investigated its protective effect against paraquat-induced oxidative stress. We observed that expression of HSPB5 in neurons and fat body confers protection against paraquat-induced oxidative stress. Expression in dopaminergic neurons showed a higher protective effect. Our results clearly establish the protective ability of HSPB5 in vivo; the extent of protection, however, varies depending on the tissue in which it is expressed. Interestingly, neuronal expression of HSPB5 resulted in an improvement in negative geotropic behaviour, whereas specific expression in muscle tissue did not show such a beneficial effect.

A six-amino-acid motif is a major determinant in functional evolution of HOX1 proteins.

Gene duplication and divergence is a major driver in the emergence of evolutionary novelties. How variations in amino acid sequences lead to loss of ancestral activity and functional diversification of proteins is poorly understood. We used cross-species functional analysis of Drosophila Labial and its mouse HOX1 orthologs (HOXA1, HOXB1, and HOXD1) as a paradigm to address this issue. Mouse HOX1 proteins display low (30%) sequence similarity with Drosophila Labial. However, substituting endogenous Labial with the mouse proteins revealed that HOXA1 has retained essential ancestral functions of Labial, while HOXB1 and HOXD1 have diverged. Genome-wide analysis demonstrated similar DNA-binding patterns of HOXA1 and Labial in mouse cells, while HOXB1 binds to distinct targets. Compared with HOXB1, HOXA1 shows an enrichment in co-occupancy with PBX proteins on target sites and exists in the same complex with PBX on chromatin. Functional analysis of HOXA1-HOXB1 chimeric proteins uncovered a novel six-amino-acid C-terminal motif (CTM) flanking the homeodomain that serves as a major determinant of ancestral activity. In vitro DNA-binding experiments and structural prediction show that CTM provides an important domain for interaction of HOXA1 proteins with PBX. Our findings show that small changes outside of highly conserved DNA-binding regions can lead to profound changes in protein function.

Mitigation potential of selenium nanoparticles and riboflavin against arsenic and elevated temperature stress in Pangasianodon hypophthalmus.

Climate change impact has disturbed the rainfall pattern worsening the problems of water availability in the aquatic ecosystem of India and other parts of the world. Arsenic pollution, mainly through excessive use of groundwater and other anthropogenic activities, is aggravating in many parts of the world, particularly in South Asia. We evaluated the efficacy of selenium nanoparticles (Se-NPs) and riboflavin (RF) to ameliorate the adverse impacts of elevated temperature and arsenic pollution on growth, anti-oxidative status and immuno-modulation in Pangasianodon hypophthalmus. Se-NPs were synthesized using fish gill employing green synthesis method. Four diets i.e., Se-NPs (0 mg kg-1) + RF (0 mg kg-1); Se-NPs (0.5 mg kg-1) + RF (5 mg kg-1); Se-NPs (0.5 mg kg-1) + RF (10 mg kg-1); and Se-NPs (0.5 mg kg-1) + RF (15 mg kg-1) were given in triplicate in a completely randomized block design. The fish were treated in arsenic (1/10th of LC50, 2.68 mg L-1) and high temperature (34 °C). Supplementation of the Se-NPs and RF in the diets significantly (p < 0.01) enhanced growth performance (weight gain, feed efficiency ratio, protein efficiency ratio, and specific growth rate), anti-oxidative status and immunity of the fish. Nitroblue tetrazolium (NBT), total immunoglobulin, myeloperoxidase and globulin enhanced (p < 0.01) with supplementation (Se-NPs + RF) whereas, albumin and albumin globulin (A:G) ratio (p < 0.01) reduced. Stress biomarkers such as lipid peroxidation in the liver, gill and kidney, blood glucose, heat shock protein 70 in gill and liver as well as serum cortisol reduced (p < 0.01) with supplementation of Se-NPs and RF, whereas, acetylcholine esterase and vitamin C level in both brain and muscle significantly enhanced (p < 0.01) in compared to control and stressors group (As + T) fed with control diet. The fish were treated with pathogenic bacteria after 90 days of experimental trial to observe cumulative mortality and relative survival for a week. The arsenic concentration in experimental water and bioaccumulation in fish tissues was also determined, which indicated that supplementation of Se-NPs and RF significantly reduced (p < 0.01) bioaccumulation. The study concluded that a combination of Se-NPs and RF has the potential to mitigate the stresses of high temperature and As pollution in P. hypophthalmus.

Molecular detection of important abortion-causing microorganisms in preputial swab of breeding bucks using PCR-based assays.

Infectious diseases and aetiological agents related to female reproductive systems were extensively covered compared to its male counterpart. There needs a proper study to bridge this gap, where microflora and infectious agents of both male and female reproductive are mutually intelligible. With this study, we aimed to evaluate the microbial contamination of the preputial cavity and also screened for abortion-causing agents which are zoonotic as well. In goats, such types of abortions are caused by Brucella melitensis, Chlamydophila, Campylobacter and Coxiella etc. One of the major sources of contamination of semen is the preputial cavity, which is exposed to the external environment leading to spread of infection into the female via semen straws or by natural service. In the current study, good quality bucks (n = 32, Barbari = 12, Jamunapari = 10, Jakhrana = 10) which were routinely used for semen collection were screened for their preputial swabs, for the presence of the above pathogens. For detection of Brucella melitensis, OMP31 based TaqMan® probe real-time PCR assay was used, and for Chlamydia, 16srRNA gene based SYBR® green real-time PCR assay was employed for detection of Chlamydophila abortus. While for Campylobacter spp. and Coxiella burnetii, 16srRNA gene based conventional PCR and Trans-PCR were used, respectively. In the current study, of the screened preputial swabs, none of them showed positive for Brucella and Coxiella, but of the screened 32 samples 17 showed positive for Chlamydia (53.13%) and two (6.25%) showed positive for Campylobacter spp. The current study emphasizes on the farms and laboratories which were regularly involved in screening of brucellosis also often overlook the other potential non-brucella pathogens, causing abortions eventually incurring severe economic losses to the goat keepers.

Genetic Dissection and Identification of Candidate Genes for Salinity Tolerance Using Axiom®CicerSNP Array in Chickpea.

Globally, chickpea production is severely affected by salinity stress. Understanding the genetic basis for salinity tolerance is important to develop salinity tolerant chickpeas. A recombinant inbred line (RIL) population developed using parental lines ICCV 10 (salt-tolerant) and DCP 92-3 (salt-sensitive) was screened under field conditions to collect information on agronomy, yield components, and stress tolerance indices. Genotyping data generated using Axiom®CicerSNP array was used to construct a linkage map comprising 1856 SNP markers spanning a distance of 1106.3 cM across eight chickpea chromosomes. Extensive analysis of the phenotyping and genotyping data identified 28 quantitative trait loci (QTLs) explaining up to 28.40% of the phenotypic variance in the population. We identified QTL clusters on CaLG03 and CaLG06, each harboring major QTLs for yield and yield component traits under salinity stress. The main-effect QTLs identified in these two clusters were associated with key genes such as calcium-dependent protein kinases, histidine kinases, cation proton antiporter, and WRKY and MYB transcription factors, which are known to impart salinity stress tolerance in crop plants. Molecular markers/genes associated with these major QTLs, after validation, will be useful to undertake marker-assisted breeding for developing better varieties with salinity tolerance.

Symbiotic nitrogen fixation and endophytic bacterial community structure in Bt-transgenic chickpea (Cicer arietinum L).

Symbiotic nitrogen fixation (SNF) of transgenic grain legumes might be influenced either by the site of transgene integration into the host genome or due to constitutive expression of transgenes and antibiotic-resistant marker genes. The present investigation confirmed proper nodulation of five tested Bt-chickpea events (IPCa2, IPCa4, IPCT3, IPCT10, and IPCT13) by native Mesorhizobium under field environment. Quantitative variations for nodulation traits among Bt-chickpea were determined and IPCT3 was found superior for nodule number and nodule biomass. Diversity, as well as richness indices, confirmed the changes in bacterial community structure of root and root-nodules from Bt-chickpea events IPCa2 and IPCT10. Especially, Gram-positive bacteria belonging to Firmicutes and Actinobacteria were selectively eliminated from root colonization of IPCa2. Richness indices (CHAO1 and ACE) of the root-associated bacterial community of IPCa2 was 13-14 times lesser than that of parent cv DCP92-3. Root nodule associated bacterial community of IPCT10 was unique with high diversity and richness, similar to the roots of non-Bt and Bt-chickpea. It indicated that the root nodules of IPCT10 might have lost their peculiar characteristics and recorded poor colonization of Mesorhizobium with a low relative abundance of 0.27. The impact of Bt-transgene on bacterial community structure and nodulation traits should be analyzed across the years and locations to understand and stabilize symbiotic efficiency for ecosystem sustainability.

Root-specific expression of chickpea cytokinin oxidase/dehydrogenase 6 leads to enhanced root growth, drought tolerance and yield without compromising nodulation.

Cytokinin group of phytohormones regulate root elongation and branching during post-embryonic development. Cytokinin-degrading enzymes cytokinin oxidases/dehydrogenases (CKXs) have been deployed to investigate biological activities of cytokinin and to engineer root growth. We expressed chickpea cytokinin oxidase 6 (CaCKX6) under the control of a chickpea root-specific promoter of CaWRKY31 in Arabidopsis thaliana and chickpea having determinate and indeterminate growth patterns, respectively, to study the effect of cytokinin depletion on root growth and drought tolerance. Root-specific expression of CaCKX6 led to a significant increase in lateral root number and root biomass in Arabidopsis and chickpea without any penalty to vegetative and reproductive growth of shoot. Transgenic chickpea lines showed increased CKX activity in root. Soil-grown advanced chickpea transgenic lines exhibited higher root-to-shoot biomass ratio and enhanced long-term drought tolerance. These chickpea lines were not compromised in root nodulation and nitrogen fixation. The seed yield in some lines was up to 25% higher with no penalty in protein content. Transgenic chickpea seeds possessed higher levels of zinc, iron, potassium and copper. Our results demonstrated the potential of cytokinin level manipulation in increasing lateral root number and root biomass for agronomic trait improvement in an edible legume crop with indeterminate growth habit.