Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 2.098
Filter
1.
Clin Imaging ; 113: 110231, 2024 Jul 01.
Article in English | MEDLINE | ID: mdl-38964173

ABSTRACT

PURPOSE: Qualitative findings in Crohn's disease (CD) can be challenging to reliably report and quantify. We evaluated machine learning methodologies to both standardize the detection of common qualitative findings of ileal CD and determine finding spatial localization on CT enterography (CTE). MATERIALS AND METHODS: Subjects with ileal CD and a CTE from a single center retrospective study between 2016 and 2021 were included. 165 CTEs were reviewed by two fellowship-trained abdominal radiologists for the presence and spatial distribution of five qualitative CD findings: mural enhancement, mural stratification, stenosis, wall thickening, and mesenteric fat stranding. A Random Forest (RF) ensemble model using automatically extracted specialist-directed bowel features and an unbiased convolutional neural network (CNN) were developed to predict the presence of qualitative findings. Model performance was assessed using area under the curve (AUC), sensitivity, specificity, accuracy, and kappa agreement statistics. RESULTS: In 165 subjects with 29,895 individual qualitative finding assessments, agreement between radiologists for localization was good to very good (κ = 0.66 to 0.73), except for mesenteric fat stranding (κ = 0.47). RF prediction models had excellent performance, with an overall AUC, sensitivity, specificity of 0.91, 0.81 and 0.85, respectively. RF model and radiologist agreement for localization of CD findings approximated agreement between radiologists (κ = 0.67 to 0.76). Unbiased CNN models without benefit of disease knowledge had very similar performance to RF models which used specialist-defined imaging features. CONCLUSION: Machine learning techniques for CTE image analysis can identify the presence, location, and distribution of qualitative CD findings with similar performance to experienced radiologists.

2.
Plant Cell Rep ; 43(6): 162, 2024 Jun 05.
Article in English | MEDLINE | ID: mdl-38837057

ABSTRACT

KEY MESSAGE: A robust agroinfiltration-mediated transient gene expression method for soybean leaves was developed. Plant genotype, developmental stage and leaf age, surfactant, and Agrobacterium culture conditions are important for successful agroinfiltration. Agroinfiltration of Nicotiana benthamiana has emerged as a workhorse transient assay for plant biotechnology and synthetic biology to test the performance of gene constructs in dicot leaves. While effective, it is nonetheless often desirable to assay transgene constructs directly in crop species. To that end, we innovated a substantially robust agroinfiltration method for Glycine max (soybean), the most widely grown dicot crop plant in the world. Several factors were found to be relevant to successful soybean leaf agroinfiltration, including genotype, surfactant, developmental stage, and Agrobacterium strain and culture medium. Our optimized protocol involved a multi-step Agrobacterium culturing process with appropriate expression vectors, Silwet L-77 as the surfactant, selection of fully expanded leaves in the VC or V1 stage of growth, and 5 min of vacuum at - 85 kPa followed by a dark incubation period before plants were returned to normal growth conditions. Using this method, young soybean leaves of two lines-V17-0799DT, and TN16-5004-were high expressors for GUS, two co-expressed fluorescent protein genes, and the RUBY reporter product, betalain. This work not only represents a new research tool for soybean biotechnology, but also indicates critical parameters for guiding agroinfiltration optimization for other crop species. We speculate that leaf developmental stage might be the most critical factor for successful agroinfiltration.


Subject(s)
Agrobacterium , Glycine max , Plant Leaves , Plants, Genetically Modified , Glycine max/genetics , Glycine max/microbiology , Glycine max/growth & development , Plant Leaves/genetics , Plant Leaves/metabolism , Agrobacterium/genetics , Gene Expression Regulation, Plant , Nicotiana/genetics , Genetic Vectors/genetics
4.
Acad Radiol ; 2024 May 02.
Article in English | MEDLINE | ID: mdl-38702212

ABSTRACT

RATIONALE AND OBJECTIVES: We present a machine learning and computer vision approach for a localized, automated, and standardized scoring of Crohn's disease (CD) severity in the small bowel, overcoming the current limitations of manual measurements CT enterography (CTE) imaging and qualitative assessments, while also considering the complex anatomy and distribution of the disease. MATERIALS AND METHODS: Two radiologists introduced a severity score and evaluated disease severity at 7.5 mm intervals along the curved planar reconstruction of the distal and terminal ileum using 236 CTE scans. A hybrid model, combining deep-learning, 3-D CNN, and Random Forest model, was developed to classify disease severity at each mini-segment. Precision, sensitivity, weighted Cohen's score, and accuracy were evaluated on a 20% hold-out test set. RESULTS: The hybrid model achieved precision and sensitivity ranging from 42.4% to 84.1% for various severity categories (normal, mild, moderate, and severe) on the test set. The model's Cohen's score (κ = 0.83) and accuracy (70.7%) were comparable to the inter-observer agreement between experienced radiologists (κ = 0.87, accuracy = 76.3%). The model accurately predicted disease length, correlated with radiologist-reported disease length (r = 0.83), and accurately identified the portion of total ileum containing moderate-to-severe disease with an accuracy of 91.51%. CONCLUSION: The proposed automated hybrid model offers a standardized, reproducible, and quantitative local assessment of small bowel CD severity and demonstrates its value in CD severity assessment.

5.
Eur J Pediatr ; 2024 May 09.
Article in English | MEDLINE | ID: mdl-38722334

ABSTRACT

The aim of this research was to describe the epidemiology, presentation and healthcare use in primary care for foot and ankle problems in children and young people (CYP) across England. We undertook a population-based cohort study using data from the Clinical Practice Research Datalink Aurum database, a database of anonymised electronic health records from general practices across England. Data was accessed for all CYP aged 0-18 years presenting to their general practitioner between January 2015 and December 2021 with a foot and/or ankle problem. Consultation rates were calculated and used to estimate numbers of consultations in an average practice. Hierarchical Poisson regression estimated relative rates of consultations across sociodemographic groups and logistic regression evaluated factors associated with repeat consultations. A total of 416,137 patients had 687,753 foot and ankle events, of which the majority were categorised as "musculoskeletal" (34%) and "unspecified pain" (21%). Rates peaked at 601 consultations per 10,000 patient-years among males aged 10-14 years in 2018. An average practice might observe 132 (95% CI 110 to 155) consultations annually. Odds for repeat consultations were higher among those with pre-existing diagnoses including juvenile arthritis (OR 1.73, 95% CI 1.48 to 2.03).    Conclusions: Consultations for foot and ankle problems were high among CYP, particularly males aged 10 to 14 years. These data can inform service provision to ensure CYP access appropriate health professionals for accurate diagnosis and treatment. What is Known: • Foot and ankle problems can have considerable impact on health-related quality of life in children and young people (CYP). • There is limited data describing the nature and frequency of foot and ankle problems in CYP. What is New: • Foot and ankle consultations were higher in English general practice among CYP aged 10 to 14 years compared to other age groups, and higher among males compared to females. • The high proportion of unspecified diagnoses and repeat consultations suggests there is need for greater integration between general practice and allied health professionals in community-based healthcare settings.

6.
Comput Med Imaging Graph ; 115: 102388, 2024 Jul.
Article in English | MEDLINE | ID: mdl-38692200

ABSTRACT

Rib cross-sectional shapes (characterized by the outer contour and cortical bone thickness) affect the rib mechanical response under impact loading, thereby influence the rib injury pattern and risk. A statistical description of the rib shapes or their correlations to anthropometrics is a prerequisite to the development of numerical human body models representing target demographics. Variational autoencoders (VAE) as anatomical shape generators remain to be explored in terms of utilizing the latent vectors to control or interpret the representativeness of the generated results. In this paper, we propose a pipeline for developing a multi-rib cross-sectional shape generative model from CT images, which consists of the achievement of rib cross-sectional shape data from CT images using an anatomical indexing system and regular grids, and a unified framework to fit shape distributions and associate shapes to anthropometrics for different rib categories. Specifically, we collected CT images including 3193 ribs, surface regular grid is generated for each rib based on anatomical coordinates, the rib cross-sectional shapes are characterized by nodal coordinates and cortical bone thickness. The tensor structure of shape data based on regular grids enable the implementation of CNNs in the conditional variational autoencoder (CVAE). The CVAE is trained against an auxiliary classifier to decouple the low-dimensional representations of the inter- and intra- variations and fit each intra-variation by a Gaussian distribution simultaneously. Random tree regressors are further leveraged to associate each continuous intra-class space with the corresponding anthropometrics of the subjects, i.e., age, height and weight. As a result, with the rib class labels and the latent vectors sampled from Gaussian distributions or predicted from anthropometrics as the inputs, the decoder can generate valid rib cross-sectional shapes of given class labels (male/female, 2nd to 11th ribs) for arbitrary populational percentiles or specific age, height and weight, which paves the road for future biomedical and biomechanical studies considering the diversity of rib shapes across the population.


Subject(s)
Anthropometry , Deep Learning , Ribs , Tomography, X-Ray Computed , Humans , Ribs/diagnostic imaging , Ribs/anatomy & histology , Anthropometry/methods , Male , Female , Adult , Middle Aged , Aged , Adolescent
7.
Dig Dis Sci ; 2024 Apr 23.
Article in English | MEDLINE | ID: mdl-38653948

ABSTRACT

INTRODUCTION: Abdominal aortic calcifications (AAC) are incidentally found on medical imaging and useful cardiovascular burden approximations. The Morphomic Aortic Calcification Score (MAC) leverages automated deep learning methods to quantify and score AACs. While associations of AAC and non-alcoholic fatty liver disease (NAFLD) have been described, relationships of AAC with other liver diseases and clinical outcome are sparse. This study's purpose was to evaluate AAC and liver-related death in a cohort of Veterans with chronic liver disease (CLD). METHODS: We utilized the VISN 10 CLD cohort, a regional cohort of Veterans with the three forms of CLD: NAFLD, hepatitis C (HCV), alcohol-associated (ETOH), seen between 2008 and 2014, with abdominal CT scans (n = 3604). Associations between MAC and cirrhosis development, liver decompensation, liver-related death, and overall death were evaluated with Cox proportional hazard models. RESULTS: The full cohort demonstrated strong associations of MAC and cirrhosis after adjustment: HR 2.13 (95% CI 1.63, 2.78), decompensation HR 2.19 (95% CI 1.60, 3.02), liver-related death HR 2.13 (95% CI 1.46, 3.11), and overall death HR 1.47 (95% CI 1.27, 1.71). These associations seemed to be driven by the non-NAFLD groups for decompensation and liver-related death [HR 2.80 (95% CI 1.52, 5.17; HR 2.34 (95% CI 1.14, 4.83), respectively]. DISCUSSION: MAC was strongly and independently associated with cirrhosis, liver decompensation, liver-related death, and overall death. Surprisingly, stratification results demonstrated comparable or stronger associations among those with non-NAFLD etiology. These findings suggest abdominal aortic calcification may predict liver disease severity and clinical outcomes in patients with CLD.

8.
J Burn Care Res ; 2024 Apr 22.
Article in English | MEDLINE | ID: mdl-38646897

ABSTRACT

Electrical burn injuries can be catastrophic, threatening severe disability or mortality. We present a patient who suffered from electrical shock, requiring bilateral above knee amputations, right trans-radial amputation, renal replacement therapy, and veno-arterial extracorporeal life support (VA ECLS) therapy. While there exist reports of cases that have demonstrated the potential use of ECLS in burn patients with cardiogenic shock or acute respiratory distress syndrome (ARDS), this is a unique case of VA ECLS use for an electrical injury patient who developed mixed distributive-obstructive shock secondary to pulmonary embolism and sepsis. Given the wide variety of morbidities that can result from electrical burns, VA ECLS is a promising tool for those who require cardiopulmonary support refractory to traditional measures.

9.
Am J Gastroenterol ; 2024 May 21.
Article in English | MEDLINE | ID: mdl-38661148

ABSTRACT

INTRODUCTION: Assessing the cumulative degree of bowel injury in ileal Crohn's disease (CD) is difficult. We aimed to develop machine learning (ML) methodologies for automated estimation of cumulative ileal injury on computed tomography-enterography (CTE) to help predict future bowel surgery. METHODS: Adults with ileal CD using biologic therapy at a tertiary care center underwent ML analysis of CTE scans. Two fellowship-trained radiologists graded bowel injury severity at granular spatial increments along the ileum (1 cm), called mini-segments. ML segmentation methods were trained on radiologist grading with predicted severity and then spatially mapped to the ileum. Cumulative injury was calculated as the sum (S-CIDSS) and mean of severity grades along the ileum. Multivariate models of future small bowel resection were compared with cumulative ileum injury metrics and traditional bowel measures, adjusting for laboratory values, medications, and prior surgery at the time of CTE. RESULTS: In 229 CTE scans, 8,424 mini-segments underwent analysis. Agreement between ML and radiologists injury grading was strong (κ = 0.80, 95% confidence interval 0.79-0.81) and similar to inter-radiologist agreement (κ = 0.87, 95% confidence interval 0.85-0.88). S-CIDSS (46.6 vs 30.4, P = 0.0007) and mean cumulative injury grade scores (1.80 vs 1.42, P < 0.0001) were greater in CD biologic users that went to future surgery. Models using cumulative spatial metrics (area under the curve = 0.76) outperformed models using conventional bowel measures, laboratory values, and medical history (area under the curve = 0.62) for predicting future surgery in biologic users. DISCUSSION: Automated cumulative ileal injury scores show promise for improving prediction of outcomes in small bowel CD. Beyond replicating expert judgment, spatial enterography analysis can augment the personalization of bowel assessment in CD.

10.
Anaesthesia ; 79(7): 694-705, 2024 Jul.
Article in English | MEDLINE | ID: mdl-38629288

ABSTRACT

Gender inequity remains an issue in anaesthesia despite increasing numbers of women training and achieving fellowship in the speciality. Women are under-represented in all areas of anaesthetic research, academia and leadership. The Gender Equity Subcommittee of the Australian and New Zealand College of Anaesthetists recently conducted a survey asking "Does gender still matter in the pursuit of a career in anaesthesia in 2022?". The survey was distributed to a randomly selected sample of 1225 anaesthetic consultants and completed by 470 respondents (38% response rate) with 793 free-text comments provided. Three overarching themes were identified: gender effects on the career and family interface; women do not fit the mould; and gender equity changes the status quo. Women respondents described a need to make a choice between career and family, which was not described by men, as well as stigmatisation of part-time work, a lack of access to challenging work and negative impacts of parental leave. Women respondents also described a sense of marginalisation within anaesthesia due to a 'boys' club' mentality, a lack of professional respect and insufficient structural supports for women in leadership. This was compounded for women from ethnically and culturally diverse backgrounds. A need for specific strategies to support anaesthetic careers for women was described as well as normalisation of flexibility in workplaces, combined with a broadening of our definition of success to allow people of all genders to experience fulfilment both at home and at work. This study is the first published qualitative data on factors affecting gender equity for anaesthetists in Australia and Aotearoa New Zealand. It highlights the need for further exploration, as well providing a foundation for changes in attitude and structural changes towards advancing gender equity.


Subject(s)
Anesthesiology , Career Choice , Humans , New Zealand , Australia , Female , Male , Surveys and Questionnaires , Gender Equity , Adult , Anesthetists/psychology , Physicians, Women/psychology , Anesthesiologists/psychology , Qualitative Research , Sexism , Middle Aged
11.
Gerontology ; : 1-16, 2024 Apr 18.
Article in English | MEDLINE | ID: mdl-38636462

ABSTRACT

INTRODUCTION: Footcare is an important component of wellbeing in older adults and the promotion of appropriate footcare interventions is imperative for health professionals working with this population. In this scoping review, we describe the health promotion models informing footcare interventions for older adults. The objectives were to (i) understand the context(s) where health promotion models have informed footcare interventions; (ii) identify the health promotion models informing interventions; and (iii) document the effectiveness of theoretically informed health promotion interventions for improving footcare in older adults. METHODS: Footcare interventions developed using health promotion models worldwide and published in English before July 2023 were searched using MEDLINE, Embase, CINAHL, Cochrane Library, and Google Scholar. RESULTS: A total of 2,078 articles were identified, of which 31 were retrieved and assessed for eligibility. Eight articles met the eligibility criteria, with most interventions delivered in Asia (n = 5) and using self-efficacy theory as their theoretical framework (n = 6). Most of the studies included people with diabetes (n = 6) and outcomes were measured using foot health outcomes, knowledge of foot health, and footcare behaviors and self-efficacy. CONCLUSION: This scoping review has identified a range of footcare interventions, with evidence of promising outcomes on improving footcare in older adults. Approaches toward methods and dosage of intervention varied across the studies and more broadly, we identified that few studies report the health promotion model informing the design of intervention(s). Further research is required to ascertain which health promotion model, modality of promotion, and implementation approach are the most effective for improving footcare in older adults.

12.
Front Plant Sci ; 15: 1346853, 2024.
Article in English | MEDLINE | ID: mdl-38495374

ABSTRACT

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue 'omics'-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

13.
Infect Control Hosp Epidemiol ; : 1-10, 2024 Mar 13.
Article in English | MEDLINE | ID: mdl-38477015

ABSTRACT

OBJECTIVE: To synthesize evidence and identify gaps in the literature on environmental cleaning and disinfection in the operating room based on a human factors and systems engineering approach guided by the Systems Engineering Initiative for Patient Safety (SEIPS) model. DESIGN: A systematic scoping review. METHODS: Following the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines, we searched 4 databases (ie, PubMed, EMBASE, OVID, CINAHL) for empirical studies on operating-room cleaning and disinfection. Studies were categorized based on their objectives and designs and were coded using the SEIPS model. The quality of randomized controlled trials and quasi-experimental studies with a nonequivalent groups design was assessed using version 2 of the Cochrane risk-of-bias tool for randomized trials. RESULTS: In total, 40 studies were reviewed and categorized into 3 groups: observational studies examining the effectiveness of operating-room cleaning and disinfections (11 studies), observational study assessing compliance with operating-room cleaning and disinfection (1 study), and interventional studies to improve operating-room cleaning and disinfection (28 studies). The SEIPS-based analysis only identified 3 observational studies examining individual work-system components influencing the effectiveness of operating-room cleaning and disinfection. Furthermore, most interventional studies addressed single work-system components, including tools and technologies (20 studies), tasks (3 studies), and organization (3 studies). Only 2 studies implemented interventions targeting multiple work-system components. CONCLUSIONS: The existing literature shows suboptimal compliance and inconsistent effectiveness of operating-room cleaning and disinfection. Improvement efforts have been largely focused on cleaning and disinfection tools and technologies and staff monitoring and training. Future research is needed (1) to systematically examine work-system factors influencing operating-room cleaning and disinfection and (2) to redesign the entire work system to optimize operating-room cleaning and disinfection.

14.
Dev Comp Immunol ; 156: 105161, 2024 Jul.
Article in English | MEDLINE | ID: mdl-38521379

ABSTRACT

Low-oxygen levels (hypoxia) in aquatic habitats are becoming more common because of global warming and eutrophication. However, the effects on the health/disease status of fishes, the world's largest group of vertebrates, are unclear. Therefore, we assessed how long-term hypoxia affected the immune function of sablefish, an ecologically and economically important North Pacific species, including the response to a formalin-killed Aeromonas salmonicida bacterin. Sablefish were held at normoxia or hypoxia (100% or 40% air saturated seawater, respectively) for 6-16 weeks, while we measured a diverse array of immunological traits. Given that the sablefish is a non-model organism, this involved the development of a species-specific methodological toolbox comprised of qPCR primers for 16 key immune genes, assays for blood antibacterial defences, the assessment of blood immunoglobulin (IgM) levels with ELISA, and flow cytometry and confocal microscopy techniques. We show that innate immune parameters were typically elevated in response to the bacterial antigens, but were not substantially affected by hypoxia. In contrast, hypoxia completely prevented the ∼1.5-fold increase in blood IgM level that was observed under normoxic conditions following bacterin exposure, implying a serious impairment of adaptive immunity. Since the sablefish is naturally hypoxia tolerant, our results demonstrate that climate change-related deoxygenation may be a serious threat to the immune competency of fishes.


Subject(s)
Adaptive Immunity , Aeromonas salmonicida , Climate Change , Fish Diseases , Animals , Aeromonas salmonicida/immunology , Aeromonas salmonicida/physiology , Fish Diseases/immunology , Fish Diseases/microbiology , Hypoxia/immunology , Immunity, Innate , Immunoglobulin M/blood , Immunoglobulin M/immunology , Fishes/immunology , Fishes/microbiology , Oxygen/metabolism , Gram-Negative Bacterial Infections/immunology , Antigens, Bacterial/immunology
15.
Nat Commun ; 15(1): 1817, 2024 Feb 28.
Article in English | MEDLINE | ID: mdl-38418817

ABSTRACT

Plants and microbes communicate to collaborate to stop pests, scavenge nutrients, and react to environmental change. Microbiota consisting of thousands of species interact with each other and plants using a large chemical language that is interpreted by complex regulatory networks. In this work, we develop modular interkingdom communication channels, enabling bacteria to convey environmental stimuli to plants. We introduce a "sender device" in Pseudomonas putida and Klebsiella pneumoniae, that produces the small molecule p-coumaroyl-homoserine lactone (pC-HSL) when the output of a sensor or circuit turns on. This molecule triggers a "receiver device" in the plant to activate gene expression. We validate this system in Arabidopsis thaliana and Solanum tuberosum (potato) grown hydroponically and in soil, demonstrating its modularity by swapping bacteria that process different stimuli, including IPTG, aTc and arsenic. Programmable communication channels between bacteria and plants will enable microbial sentinels to transmit information to crops and provide the building blocks for designing artificial consortia.


Subject(s)
Arabidopsis , Microbiota , Pseudomonas putida , Solanum tuberosum , Arabidopsis/genetics , Crops, Agricultural
16.
Plant Cell Rep ; 43(3): 69, 2024 Feb 12.
Article in English | MEDLINE | ID: mdl-38345745

ABSTRACT

KEY MESSAGE: Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.


Subject(s)
Oryza , Oryza/genetics , Droughts , Plants, Genetically Modified/genetics , Promoter Regions, Genetic/genetics , Gene Expression Regulation, Plant
17.
JTO Clin Res Rep ; 5(2): 100623, 2024 Feb.
Article in English | MEDLINE | ID: mdl-38357092

ABSTRACT

Introduction: NSCLC transformation to SCLC has been best characterized with EGFR-mutant NSCLC, with emerging case reports seen in ALK, RET, and KRAS-altered NSCLC. Previous reports revealed transformed SCLC from EGFR-mutant NSCLC portends very poor prognosis and lack effective treatment. Genomic analyses revealed TP53 and RB1 loss of function increase the risk of SCLC transformation. Little has been reported on the detailed clinicogenomic characteristics and potential therapeutic targets for this patient population. Methods: In this study, we conducted a single-center retrospective analysis of clinical and genomic characteristics of patients with EGFR-mutant NSCLC transformed to SCLC. Demographic data, treatment course, and clinical molecular testing reports were extracted from electronic medical records. Kaplan-Meier analyses were used to estimate survival outcomes. Next generation sequencing-based assays was used to identify EGFR and co-occurring genetic alterations in tissue or plasma before and after SCLC transformation. Single-cell RNA sequencing (scRNA-seq) was performed on a patient-derived-xenograft model generated from a patient with EGFR-NSCLC transformed SCLC tumor. Results: A total of 34 patients were identified in our study. Median age at initial diagnosis was 58, and median time to SCLC transformation was 24.2 months. 68% were female and 82% were never smokers. 79% of patients were diagnosed as stage IV disease, and over half had brain metastases at baseline. Median overall survival of the entire cohort was 38.3 months from initial diagnoses and 12.4 months from time of SCLC transformation. Most patients harbored EGFR exon19 deletions as opposed to exon21 L858R alteration. Continuing EGFR tyrosine kinase inhibitor post-transformation did not improve overall survival compared with those patients where tyrosine kinase inhibitor was stopped in our cohort. In the 20 paired pretransformed and post-transformed patient samples, statistically significant enrichment was seen with PIK3CA alterations (p = 0.04) post-transformation. Profiling of longitudinal liquid biopsy samples suggest emergence of SCLC genetic alterations before biopsy-proven SCLC, as shown by increasing variant allele frequency of TP53, RB1, PIK3CA alterations. ScRNA-seq revealed potential therapeutic targets including DLL3, CD276 (B7-H3) and PTK7 were widely expressed in transformed SCLC. Conclusions: SCLC transformation is a potential treatment resistance mechanism in driver-mutant NSCLC. In our cohort of 34 EGFR-mutant NSCLC, poor prognosis was observed after SCLC transformation. Clinicogenomic analyses of paired and longitudinal samples identified genomic alterations emerging post-transformation and scRNA-seq reveal potential therapeutic targets in this population. Further studies are needed to rigorously validate biomarkers and therapeutic targets for this patient population.

18.
Plant Biotechnol J ; 22(6): 1596-1609, 2024 Jun.
Article in English | MEDLINE | ID: mdl-38232002

ABSTRACT

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.


Subject(s)
Gene Expression Regulation, Plant , Plants, Genetically Modified , Populus , Promoter Regions, Genetic , Populus/genetics , Populus/metabolism , Promoter Regions, Genetic/genetics , Plants, Genetically Modified/genetics , Dehydration/genetics , Stress, Physiological/genetics , Organ Specificity/genetics , Plant Leaves/genetics , Plant Leaves/metabolism
19.
Trends Plant Sci ; 29(2): 126-129, 2024 02.
Article in English | MEDLINE | ID: mdl-37778886

ABSTRACT

Plant metabolic engineering must take into consideration the heterogeneous cell types that play a role in metabolite production; cells do not participate equally. We posit that artificial intelligence (AI) developed for biomedical purposes can be applied to plant cell characterization to accelerate the development of metabolic engineering strategies in plants.


Subject(s)
Metabolic Engineering , Plant Cells , Plant Cells/metabolism , Artificial Intelligence , Plants/genetics , Plants/metabolism
20.
J Bioeth Inq ; 20(4): 607-616, 2023 Dec.
Article in English | MEDLINE | ID: mdl-38064166

ABSTRACT

During the early years of the COVID-19 pandemic, preclinical and clinical research were sped up and scaled up in both the public and private sectors and in partnerships between them. This resulted in some extraordinary advances, but it also raised a range of issues regarding the ethics, rigour, and integrity of scientific research, academic publication, and public communication. Many of the failures of scientific rigour and integrity that occurred during the pandemic were exacerbated by the rush to generate, disseminate, and implement research findings, which not only created opportunities for unscrupulous actors but also compromised the methodological, peer review, and advisory processes that would usually identify sub-standard research and prevent compromised clinical or policy-level decisions. While it would be tempting to attribute these failures of science and its translation solely to the "unprecedented" circumstances of the COVID-19 pandemic, the reality is that they preceded the pandemic and will continue to arise once it is over. Existing strategies for promoting scientific rigour and integrity need to be made more rigorous, better integrated into research training and institutional cultures, and made more sophisticated. They might also need to be modified or supplemented with other strategies that are fit for purpose not only in public health emergencies but in any research that is sped-up and scaled up to address urgent unmet medical needs.


Subject(s)
Biomedical Research , COVID-19 , Scientific Misconduct , Humans , Pandemics , COVID-19/epidemiology , Peer Review
SELECTION OF CITATIONS
SEARCH DETAIL
...