First Report of Meloidogyne graminicola Naturally Infecting Cyperus difformis in China.

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) µm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) µm, stylet = 11.7 ± 1.5 (9.7 to 14.4) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) µm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) µm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) µm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) µm, BW = 16.9 ±1.7 (14.1 to 19.7) µm, stylet = 13.2 ± 0.6 (12.5 to 14.9) µm, DGO = 3.3 ± 0.5 (2.6 to 4.4) µm, tail = 71.6 ± 5.5 (65.1 to 82.0) µm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) µm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.

Comparative transcriptome analysis reveals key genes associated with pigmentation in radish (Raphanus sativus L.) skin and flesh.

Radish (Raphanus sativus) is an important vegetable worldwide that exhibits different flesh and skin colors. The anthocyanins responsible for the red and purple coloring in radishes possess nutritional value and pharmaceutical potential. To explore the structural and regulatory networks related to anthocyanin biosynthesis and identify key genes, we performed comparative transcriptome analyses of the skin and flesh of six colored radish accessions. The transcript profiles showed that each accession had a species-specific transcript profile. For radish pigmentation accumulation, the expression levels of anthocyanin biosynthetic genes (RsTT4, RsC4H, RsTT7, RsCCOAMT, RsDFR, and RsLDOX) were significantly upregulated in the red- and purple-colored accessions, but were downregulated or absent in the white and black accessions. The correlation test, combined with metabolome (PCC > 0.95), revealed five structural genes (RsTT4, RsDFR, RsCCOAMT, RsF3H, and RsBG8L) and three transcription factors (RsTT8-1, RsTT8-2, and RsPAR1) to be significantly correlated with flavonoids in the skin of the taproot. Four structural genes (RsBG8L, RsDFR, RsCCOAMT, and RsLDOX) and nine transcription factors (RsTT8-1, RsTT8-2, RsMYB24L, RsbHLH57, RsPAR2L, RsbHLH113L, RsOGR3L, RsMYB24, and RsMYB34L) were found to be significantly correlated with metabolites in the flesh of the taproot. This study provides a foundation for future studies on the gene functions and genetic diversity of radish pigmentation and should aid in the cultivation of new valuable radish varieties.

A Comparative Metabolomics Study of Flavonoids in Radish with Different Skin and Flesh Colors (Raphanus sativus L.).

Radish (Raphanus sativus) is an important worldwide vegetable with a wide variety of colors that affect its appearance and nutritional quality. However, the large-scale detection, identification, and quantification of flavonoids in multicolor radish have rarely been studied. To uncover the diversity and accession-specific flavonoids in radish, liquid chromatography electrospray ionization-tandem mass spectrometry was used to analyze the metabolic profiles in the skin and flesh of six colored radish accessions: light-red Manshenhong, dark-red Touxinhong (TXH), purple Zijinling (ZJL), Xinlimei with red flesh (XLMF) and green skin, white Shizhuangbai (SZB), and black radish. In total, 133 flavonoids, including 16 dihydroflavones, 44 flavones, 14 flavonoids, 9 anthocyanins, and 28 flavonols, were characterized. The flavonoid metabolic profiles differed among the different colored radishes. Red and purple radishes contained similar anthocyanin compounds responsible for color pigmentation, including red cyanidin, callistephin, and pelargonin. Purple ZJL was most enriched with cyanidin o-syringic acid and cyanin, whereas callistephin and pelargonin were more abundant in dark-red TXH. Additionally, the black and white radishes shared similar anthocyanin and flavonoid profiles, suggesting that the color of black radishes was not caused by anthocyanin but by other metabolites. The metabolites in colored radishes that differed from SZB were mainly involved in the biosynthesis of plant secondary metabolites, such as flavonoid, flavone, flavonol, isoflavonoid, and phenylpropanoid biosynthesis. This study provides new insights into the differences in metabolite profiles among radishes with different skin and flesh colors. The results will be useful for aiding the cultivation of valuable new radish varieties.