Robert J. Genco: Pioneer in Oral Science Advancement.

Professor Robert J. Genco made extraordinary research advances in immunology, periodontology, and microbiology research, pioneering major advances in oral science. In addition to his extraordinary research advancements in oral biology, his pioneering advances in oral science leadership at the local/university, national, and international levels are recognized worldwide, as are his educational advancements. In his era, he is truly the "father" of oral science.

DC-STAMP Is an Osteoclast Fusogen Engaged in Periodontal Bone Resorption.

Dendritic cell-specific transmembrane protein (DC-STAMP) plays a key role in the induction of osteoclast (OC) cell fusion, as well as DC-mediated immune regulation. While DC-STAMP gene expression is upregulated in the gingival tissue with periodontitis, its pathophysiological roles in periodontitis remain unclear. To evaluate the effects of DC-STAMP in periodontitis, anti-DC-STAMP-monoclonal antibody (mAb) was tested in a mouse model of ligature-induced periodontitis ( n = 6-7/group) where Pasteurella pneumotropica ( Pp)-reactive immune response activated T cells to produce receptor activator of nuclear factor kappa-B ligand (RANKL), which, in turn, promotes the periodontal bone loss via upregulation of osteoclastogenesis. DC-STAMP was expressed on the cell surface of mature multinuclear OCs, as well as immature mononuclear OCs, in primary cultures of RANKL-stimulated bone marrow cells. Anti-DC-STAMP-mAb suppressed the emergence of large, but not small, multinuclear OCs, suggesting that DC-STAMP is engaged in the late stage of cell fusion. Anti-DC-STAMP-mAb also inhibited pit formation caused by RANKL-stimulated bone marrow cells. Attachment of ligature to a second maxillary molar induced DC-STAMP messenger RNA and protein, along with elevated tartrate-resistant acid phosphatase-positive (TRAP+) OCs and alveolar bone loss. As we expected, systemic administration of anti-DC-STAMP-mAb downregulated the ligature-induced alveolar bone loss. Importantly, local injection of anti-DC-STAMP-mAb also suppressed alveolar bone loss and reduced the total number of multinucleated TRAP+ cells in mice that received ligature attachment. Attachment of ligature induced significantly elevated tumor necrosis factor-α, interleukin-1ß, and RANKL in the gingival tissue compared with the control site without ligature ( P < 0.05), which was unaffected by local injection with either anti-DC-STAMP-mAb or control-mAb. Neither in vivo anti- Pp IgG antibody nor in vitro anti- Pp T-cell response and resultant production of RANKL was affected by anti-DC-STAMP-mAb. This study illustrated the roles of DC-STAMP in promoting local OC cell fusion without affecting adaptive immune responses to oral bacteria. Therefore, it is plausible that a novel therapeutic regimen targeting DC-STAMP could suppress periodontal bone loss.

Recent advances in host defense mechanisms/therapies against oral infectious diseases and consequences for systemic disease.

The innate and adaptive immune systems are both crucial to oral disease mechanisms and their impact on systemic health status. Greater understanding of these interrelationships will yield opportunities to identify new therapeutic targets to modulate disease processes and/or increase host resistance to infectious or inflammatory insult. The topics addressed reflect the latest advances in our knowledge of the role of innate and adaptive immune systems and inflammatory mechanisms in infectious diseases affecting the oral cavity, including periodontitis and candidiasis. In addition, several potential links with systemic inflammatory conditions, such as cardiovascular disease, are explored. The findings elucidate some of the defense mechanisms utilized by host tissues, including the role of IL-17 in providing immunity to oral candidiasis, the antimicrobial defense of mucosal epithelial cells, and the pro-resolution effects of the natural inflammatory regulators, proresolvins and lipoxins. They also describe the role of immune cells in mediating pathologic bone resorption in periodontal disease. These insights highlight the potential for therapeutic benefit of immunomodulatory interventions that bolster or modulate host defense mechanisms in both oral and systemic disease. Among the promising new therapeutic approaches discussed here are epithelial cell gene therapy, passive immunization against immune cell targets, and the use of proresolvin agents.

Expression of receptor activator of nuclear factor-kappaB ligand by B cells in response to oral bacteria.

INTRODUCTION: We investigated receptor activator of nuclear factor-kappaB ligand (RANKL) expression by B lymphocytes during early and late aspects of the immune response to Aggregatibacter actinomycetemcomitans, a gram-negative, anaerobic bacterium associated with aggressive periodontal disease. METHODS: Expression of messenger RNA transcripts (tumor necrosis factor-alpha, Toll-like receptors 4 and 9, interleukins 4 and 10, and RANKL) involved in early (1-day) and late (10-day) responses in cultured rat splenocytes was examined by reverse transcription-polymerase chain reaction (RT-PCR). The immune cell distribution (T, B, and natural killer cells and macrophages) in cultured rat splenocytes and RANKL expression in B cells were determined by flow cytometric analyses. B-cell capacity for induction of osteoclast differentiation was evaluated by coculture with RAW 264.7 cells followed by a tartrate-resistant acid phosphatase (TRAP) activity assay. RESULTS: The expression levels of interleukins 4 and 10 in cultured cells were not changed in the presence of A. actinomycetemcomitans until cultured for 3 days, and peaked after 7 days. After culture for 10 days, the percentages of B and T cells, the overall RANKL messenger RNA transcripts, and the percentage of RANKL-expressing immunoglobulin G-positive cells were significantly increased in the presence of A. actinomycetemcomitans. These increases were considerably greater in cells isolated from A. actinomycetemcomitans-immunized animals than from non-immunized animals. RAW 264.7 cells demonstrated significantly increased TRAP activity when cocultured with B cells from A. actinomycetemcomitans-immunized animals. The addition of human osteoprotegerin-Fc to the culture significantly diminished such increases. CONCLUSION: This study suggests that B-lymphocyte involvement in the immune response to A. actinomycetemcomitans through upregulation of RANKL expression potentially contribute to bone resorption in periodontal disease.

Mutans streptococcal infection induces salivary antibody to virulence proteins and associated functional domains.

The interplay between mucosal immune responses to natural exposure to mutans streptococci and the incorporation and accumulation of these cariogenic microorganisms in oral biofilms is unclear. An initial approach to explore this question would be to assess the native secretory immunity emerging as a consequence of Streptococcus mutans infection. To this end, we analyzed salivary immunoglobulin A (IgA) antibody to mutans streptococcal glucosyltransferase (Gtf) and glucan binding protein B (GbpB) and to domains associated with enzyme function and major histocompatibility complex (MHC) class II binding in two experiments. Salivas were collected from approximately 45-day-old Sprague-Dawley rats, which were then infected with S. mutans SJ32. Infection was verified and allowed to continue for 2 to 2.5 months. Salivas were again collected following the infection period. Pre- and postinfection salivas were then analyzed for IgA antibody activity using peptide- or protein-coated microsphere Luminex technology. S. mutans infection induced significant levels of salivary IgA antibody to Gtf (P < 0.002) and GbpB (P < 0.001) in both experiments, although the levels were usually far lower than the levels achieved when mucosal immunization is used. Significantly (P < 0.035 to P < 0.001) elevated levels of postinfection salivary IgA antibody to 6/10 Gtf peptides associated with either enzyme function or MHC binding were detected. The postinfection levels of antibody to two GbpB peptides in the N-terminal region of the six GbpB peptides assayed were also elevated (P < 0.031 and P < 0.001). Interestingly, the patterns of the rodent response to GbpB peptides were similar to the patterns seen in salivas from young children during their initial exposure to S. mutans. Thus, the presence of a detectable postinfection salivary IgA response to mutans streptococcal virulence-associated components, coupled with the correspondence between rat and human mucosal immune responsiveness to naturally presented Gtf and GbpB epitopes, suggests that the rat may be a useful model for defining mucosal responses that could be expected in humans. Under controlled infection conditions, such a model could prove to be helpful for unraveling relationships between the host response and oral biofilm development.

Cross-reactive adaptive immune response to oral commensal bacteria results in an induction of receptor activator of nuclear factor-kappaB ligand (RANKL)-dependent periodontal bone resorption in a mouse model.

INTRODUCTION: The present study examined whether induction of an adaptive immune response to orally colonizing non-pathogenic Pasteurella pneumotropica by immunization with the phylogenetically closely related bacterium, Actinobacillus actinomycetemcomitans, can result in periodontal bone loss in mice. METHODS: BALB/c mice harboring P. pneumotropica (P. pneumotropica(+) mice) in the oral cavity or control P. pneumotropica-free mice were immunized with fixed A. actinomycetemcomitans. The animals were sacrificed on day 30, and the following measurements were carried out: (i) serum immunoglobulin G and gingival T-cell responses to A. actinomycetemcomitans and P. pneumotropica; (ii) periodontal bone loss; and (iii) identification of receptor activator of nuclear factor-kappaB ligand (RANKL) -positive T cells in gingival tissue. RESULTS: Immunization with A. actinomycetemcomitans induced a significantly elevated serum immunoglobulin G response to the 29-kDa A. actinomycetemcomitans outer membrane protein (Omp29), which showed strong cross-reactivity with P. pneumotropica OmpA compared to results in the control non-immunized mice. The A. actinomycetemcomitans-immunized P. pneumotropica(+) mice developed remarkable periodontal bone loss in a RANKL-dependent manner, as determined by the abrogation of bone loss by treatment with osteoprotegerin-Fc. The T cells isolated from the gingival tissue of A. actinomycetemcomitans-immunized P. pneumotropica(+) mice showed an in vitro proliferative response to both A. actinomycetemcomitans and P. pneumotropica antigen presentation, as well as production of soluble(s)RANKL in the culture supernatant. Double-color confocal microscopy demonstrated that the frequency of RANKL(+) T cells in the gingival tissue of A. actinomycetemcomitans-immunized P. pneumotropica(+) mice was remarkably elevated compared to control mice. CONCLUSION: The induction of an adaptive immune response to orally colonizing non-pathogenic P. pneumotropica results in RANKL-dependent periodontal bone loss in mice.

Diminished forkhead box P3/CD25 double-positive T regulatory cells are associated with the increased nuclear factor-kappaB ligand (RANKL+) T cells in bone resorption lesion of periodontal disease.

Periodontal disease involves multi-bacterial infections accompanied by inflammatory bone resorption lesions. The abundant T and B lymphocyte infiltrates are the major sources of the osteoclast differentiation factor, receptor activator for nuclear factor-kappaB ligand (RANKL) which, in turn, contributes to the development of bone resorption in periodontal disease. In the present study, we found that the concentrations of RANKL and regulatory T cell (T(reg))-associated cytokine, interleukin (IL)-10, in the periodontal tissue homogenates were correlated negatively, whereas RANKL and proinflammatory cytokine, IL-1beta, showed positive correlation. Also, according to the fluorescent-immunohistochemistry, the frequency of forkhead box P3 (FoxP3)/CD25 double-positive cells was diminished strikingly in the bone resorption lesion of periodontal disease compared to healthy gingival tissue, while CD25 or FoxP3 single positive cells were still observed in lesions where abundant RANKL+ lymphocytes were present. Very importantly, few or no expressions of FoxP3 by the RANKL+ lymphocytes were observed in the diseased periodontal tissues. Finally, IL-10 suppressed both soluble RANKL (sRANKL) and membrane RANKL (mRANKL) expression by peripheral blood mononuclear cells (PBMC) activated in vitro in a bacterial antigen-specific manner. Taken together, these results suggested that FoxP3/CD25 double-positive T(reg) cells may play a role in the down-regulation of RANKL expression by activated lymphocytes in periodontal diseased tissues. This leads to the conclusion that the phenomenon of diminished CD25+FoxP3+ T(reg) cells appears to be associated with the increased RANKL+ T cells in the bone resorption lesion of periodontal disease.

Immunogenic and protective potential of mutans streptococcal glucosyltransferase peptide constructs selected by major histocompatibility complex class II allele binding.

Mutans streptococcal glucosyltransferases (GTF) have been demonstrated to be effective components of dental caries vaccines. We had previously selected peptide subunits of GTF for vaccine development based on putative functional significance and conservation of GTF primary structure among enzyme isoforms. In this study, 20 20-mer linear GTF peptides were synthesized, 17 identified on the basis of the highest potential major histocompatibility complex (MHC) class II-binding activity using computer-generated algorithms (Epimatrix and ProPred) and 3 with previously demonstrated functional significance. The immunoreactivities of these peptides were explored with rodent systems. Sera from GTF-immunized rats, assessed for binding to linear peptides by enzyme-linked immunosorbent assay, demonstrated immunoglobulin G antibody reactivity with peptides 6 and 11 and a T-cell proliferation response to peptides 6, 9, 11, and 16. Multiple antigenic peptide (MAP) constructs were synthesized from promising linear sequences. Rats that were immunized with MAP 7, 11, or 16, respectively, responded well to the immunizing MAP. Most importantly, a robust immune response (antibody and T-cell proliferation) was observed to native GTF following MAP 11 (amino acids 847 to 866; VVINNDKFVSWGITDFEM) immunization. This response inhibited GTF enzyme function. Two dental caries pathogenesis experiments were performed wherein rats were immunized with MAP constructs 11, 16, and/or 11 plus 16, followed by infection with cariogenic Streptococcus sobrinus. In both experiments cariogenic bacterial recoveries were reduced relative to total streptococci in the MAP 11- and MAP 11 plus 16-immunized groups, and the extent of dental caries was also significantly reduced in these groups. Thus, we have identified a peptide with projected avid MHC-binding activity that elicited immunoreactivity with native GTF and demonstrated protection against dental caries infection after immunization, implying that this peptide may be important in a subunit dental caries vaccine.

Innate immune peptide LL-37 displays distinct expression pattern from beta-defensins in inflamed gingival tissue.

Anti-microbial peptides produced from mucosal epithelium appear to play pivotal roles in the host innate immune defence system in the oral cavity. In particular, human beta-defensins (hBDs) and the cathelicidin-type anti-microbial peptide, LL-37, were reported to kill periodontal disease-associated bacteria. In contrast to well-studied hBDs, little is known about the expression profiles of LL-37 in gingival tissue. In this study, the anti-microbial peptides expressed in gingival tissue were analysed using immunohistochemistry and enxyme-linked immunosorbent assay (ELISA). Immunohistochemistry revealed that neutrophils expressed only LL-37, but not hBD-2 or hBD-3, and that such expression was prominent in the inflammatory lesions when compared to healthy gingivae which showed very few or no LL-37 expressing neutrophils. Gingival epithelial cells (GEC), however, expressed all three examined anti-microbial peptides, irrespective of the presence or absence of inflammation. Moreover, as determined by ELISA, the concentration of LL-37 in the gingival tissue homogenates determined was correlated positively with the depth of the gingival crevice. Stimulation with periodontal bacteria in vitro induced both hBD-2 and LL-37 expressions by GEC, whereas peripheral blood neutrophils produced only LL-37 production, but not hBD-2, in response to the bacterial stimulation. These findings suggest that LL-37 displays distinct expression patterns from those of hBDs in gingival tissue.

Effect of adoptive transfer of antigen-specific B cells on periodontal bone resorption.

BACKGROUND AND OBJECTIVES: Host immune responses to periodontal pathogens have been considered to contribute to the alveolar bone destruction in periodontitis. However, the role of B lymphocytes in the pathogenesis of periodontal bone loss is not clear. METHODS: We examined the effect of adoptive transfer of antigen-specific B cells from rat spleens on experimental periodontal bone resorption. Donor rats were immunized intraperitoneally (i.p.) with formalin-killed Actinobacillus actinomycetemcomitans. Antigen-specific B cells were prepared from splenocytes by first binding CD43(+) cells to Petri dishes coated with anti-CD43 antibody to remove T cells, and non-binding cells were passed through a nylon wool column to deplete accessory cells. The retained cells were then collected and bound to A. actinomycetemcomitans-coated Petri dishes for enrichment of A. actinomycetemcomitans-binding B cells (AAB). A. actinomycetemcomitans non-binding B cells (ANB) and B cells from non-immunized donor rats (NIB) were also collected from these procedures. Each type of B cell was injected into a group of recipient rats that were then orally infected with live A. actinomycetemcomitans. RESULTS: At termination, the antibody levels to A. actinomycetemcomitans in serum and gingival wash fluids were significantly higher in the recipients transferred with AAB when compared to the recipients transferred with ANB or NIB. A markedly elevated number of antibody-forming cells were observed in the spleens of the recipients transferred with AAB, and these recipient rats also exhibited significantly increased bone resorption when compared to the other groups. CONCLUSIONS: It is suggested that B cells can contribute to periodontal bone resorption and that antigen-triggering of B cells is required for the bone resorption.

Potassium channel-blockers as therapeutic agents to interfere with bone resorption of periodontal disease.

UNLABELLED: Inflammatory lesions of periodontal disease contain all the cellular components, including abundant activated/memory T- and B-cells, necessary to control immunological interactive networks and to accelerate bone resorption by RANKL-dependent and -independent mechanisms. Blockade of RANKL function has been shown to ameliorate periodontal bone resorption and other osteopenic disorders without affecting inflammation. Development of therapies aimed at decreasing the expression of RANKL and pro-inflammatory cytokines by T-cells constitutes a promising strategy to ameliorate not only bone resorption, but also inflammation. Several reports have demonstrated that the potassium channels Kv1.3 and IKCa1, through the use of selective blockers, play important roles in T-cell-mediated events, including T-cell proliferation and the production of pro-inflammatory cytokines. More recently, a potassium channel-blocker for Kv1.3 has been shown to down-regulate bone resorption by decreasing the ratio of RANKL-to-OPG expression by memory-activated T-cells. In this article, we first summarize the mechanisms by which chronically activated/memory T-cells, in concert with B-cells and macrophages, trigger inflammatory bone resorption. Then, we describe the main structural and functional characteristics of potassium channels Kv1.3 and IKCa1 in some of the cells implicated in periodontal disease progression. Finally, this review elucidates some recent advances in the use of potassium channel-blockers of Kv1.3 and IKCa1 to ameliorate the clinical signs or side-effects of several immunological disorders and to decrease inflammatory bone resorption in periodontal disease. ABBREVIATIONS: AICD, activation-induced cell death; APC, antigen-presenting cells; B(K), large conductance; CRAC, calcium release-activated calcium channels; DC, dendritic cell; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IFN-gamma, interferon-gamma; IP(3), inositol (1,4,5)-triphosphate; (K)ir, inward rectifier; JNK, c-Jun N-terminal kinase; I(K), intermediate conductance; LPS, lipopolysaccharide; L, ligand; MCSF, macrophage colony-stimulating factor; MHC, major histocompatibility complex; NFAT, nuclear factor of activated T-cells; RANK, receptor activator of nuclear factor-kappaB; T(CM), central memory T-cells; T(EM), effector memory T-cells; TNF, tumor necrosis factor; TRAIL, TNF-related apoptosis-inducing ligand; OPG, osteoprotegerin; Omp29, 29-kDa outer membrane protein; PKC, protein kinase C; PLC, phospholipase C; RT-PCR, reverse-transcriptase polymerase chain-reaction; S(K), small conductance; TCR, T-cell receptor; and (K)v, voltage-gated.

Influence of microparticle formulation on immunogenicity of SYI, a synthetic peptide derived from Streptococcus mutans GbpB.

Subcutaneous immunization with SYI, a peptide construct based on Streptococcus mutans glucan binding protein B (GbpB) residues 113-132, significantly reduces experimental dental caries. Since mucosal immunization may be preferred for human vaccine applications, the present objective was to determine what formulation of SYI combined with polylactide-coglycolide microparticles could give rise to significant levels of salivary IgA antibody reactive with the native GbpB protein. A comparison of the SYI construct, loaded into or mixed with polylactide-coglycolide revealed the SYI-loaded microparticles to induce significant and sustainable levels of salivary and nasal wash IgA antibody to the peptide and the native protein. SYI mixed with unloaded microparticles was less effective in mucosal antibody response induction. These studies indicate that mucosal immunization with the SYI construct can induce salivary IgA antibody to a pathogenesis-associated component of S. mutans if delivered within polylactide-coglycolide microparticles, suggesting that this approach could successfully induce protective salivary immunity to dental caries caused by S. mutans.

Remote glucosyltransferase-microparticle vaccine delivery induces protective immunity in the oral cavity.

Intranasally administered dental caries vaccines show significant promise for human application. Alternate mucosal routes may be required, however, to induce caries-protective salivary IgA antibody in children with respiratory diseases. Since rectal mucosa contains inductive lymphoid tissue, we hypothesized that the rectal route could be used to induce salivary immunity to mutans streptococcal glucosyltransferase (GTF), resulting in protective immunity to experimental dental caries. We first explored the ability of glucosyltransferase, incorporated into polylactide-co-glycolide (PLGA) microparticles (MP), and administered rectally together with mucosal adjuvant, to induce a salivary IgA antibody response. Groups of Sprague-Dawley rats (6/group) were immunized rectally on days 0, 7, 14 and 21 with a) GTF-MP alone, b) GTF-MP with cholera toxin, c) GTF-MP with detoxified mutant Escherichia coli toxin (dLT), or d) sham immunized with PLGA and cholera toxin. An additional group was immunized intranasally with GTF-MP alone. Saliva and nasal washes of all intranasally immunized rats contained IgA antibody to glucosyltransferase on day 28. Salivary IgA antibody was also detected in 7/12 rats rectally immunized with GTF-MP and cholera toxin or dLT, although responses were lower than those obtained by intranasal immunization. Most fecal extracts from rectally delivered GTF-MP plus cholera toxin or dLT rats contained IgA antibody to GTF-MP. Low levels of fecal IgA antibody were detected in 3/6 intranasally immunized rats and 2/6 rats rectally immunized with GTF-MP alone. We then examined the extent to which salivary IgA antibody induced by the rectal route could be protective. At 25, 31 and 38 days of age, two groups of female Sprague-Dawley rats (13/group) were rectally immunized with GTF-MP and cholera toxin or with empty microparticles and cholera toxin (sham group). A third group was intranasally immunized with GTF-MP alone. After demonstrating salivary IgA responses to GTF in most GTF-immunized rats, all animals were infected with streptomycin-resistant Streptococcus sobrinus and placed on diet 2000. After 79 days of infection, total caries on molar surfaces were lower in both rectally (7.9 +/- 1.0) and intranasally (7.1 +/- 0.9; P < 0.0.03) immunized groups compared with the sham-immunized group (11.9 +/- 1.6). Smooth surface caries were significantly lower (P < 0.05) in both rectally and intranasally immunized groups. These results support the interconnectedness of the mucosal immune system and indicate that rectal immunization with GTF-MP, together with adjuvant, or intranasal immunization with GTF-MP alone, can induce protective levels of salivary antibody in rats.

Facilitated intranasal induction of mucosal and systemic immunity to mutans streptococcal glucosyltransferase peptide vaccines.

Synthetic peptide vaccines which are derived from functional domains of Streptococcus mutans glucosyltransferases (GTF) have been shown to induce protective immunity in Sprague-Dawley rats after subcutaneous injection in the salivary gland region. Since mucosal induction of salivary immunity would be preferable in humans, we explored methods to induce mucosal antibody in the rat to the GTF peptide vaccines HDS and HDS-GLU after intranasal administration. Several methods of facilitation of the immune response were studied: the incorporation of peptides in bioadhesive poly(D,L-lactide-coglycolide) (PLGA) microparticles, the use of monoepitopic (HDS) or diepitopic (HDS-GLU) peptide constructs, or the use of mucosal adjuvants. Salivary immunoglobulin A (IgA) responses were not detected after intranasal administration of diepitopic HDS-GLU peptide constructs in alum or after incorporation into PLGA microparticles. However, significant primary and secondary salivary IgA and serum IgG antibody responses to HDS were induced in all rats when cholera holotoxin (CT) or a detoxified mutant Escherichia coli heat-labile enterotoxin (R192G LT) were intranasally administered with HDS peptide constructs in PLGA. Coadministration of LT with HDS resulted in predominantly IgG2a responses in the serum, while coadministration with CT resulted in significant IgG1 and IgG2a responses to HDS. Serum IgG antibody, which was induced to the HDS peptide construct by coadministration with these adjuvants, also bound intact mutans streptococcal GTF in an enzyme-linked immunosorbent assay and inhibited its enzymatic activity. Thus, immune responses which are potentially protective for dental caries can be induced to peptide-based GTF vaccines after mucosal administration if combined with the CT or LT R192G mucosal adjuvant.

Diepitopic construct of functionally and epitopically complementary peptides enhances immunogenicity, reactivity with glucosyltransferase, and protection from dental caries.

Coimmunization with peptide constructs from catalytic (CAT) and glucan-binding (GLU) domains of glucosyltransferase (GTF) of mutans streptococci has resulted in enhanced levels of antibody to the CAT construct and to GTF. We designed and synthesized a diepitopic construct (CAT-GLU) containing two copies of both CAT (B epitope only) and GLU (B and T epitope) peptides. The immunogenicity of this diepitopic construct was compared with that of individual CAT and GLU constructs by immunizing groups of Sprague-Dawley rats subcutaneously in the salivary gland vicinity with the CAT-GLU, CAT, or GLU construct or by treating rats by sham immunization. Levels of serum immunoglobulin G (IgG) antibody to GTF or CAT in the CAT-GLU group were significantly greater than in GLU- or CAT-immunized groups. Immunization with CAT-GLU was compared to coimmunization with a mixture of CAT and GLU in a second rodent experiment under a similar protocol. CAT-GLU immunization resulted in serum IgG and salivary IgA responses to GTF and CAT which were greater than after coimmunization. Immunization with the diepitopic construct and communization with CAT and GLU constructs showed proliferation of T lymphocytes to GTF. Immunization with either the CAT or GLU construct has been shown to elicit significant protection in a rodent dental caries model. Similarly in this study, the enhanced response to GTF after immunization with the CAT-GLU construct resulted in protective effects on dental caries. Therefore, the CAT-GLU diepitopic construct can be a potentially important antigen for a caries vaccine, giving rise to greater immune response than after immunization with CAT, GLU, or a mixture of the two.

Involvement of T-lymphocytes in periodontal disease and in direct and indirect induction of bone resorption.

Periodontal disease is a peripheral infection involving species of gram-negative organisms. T-lymphocytes can be found in the dense inflammatory infiltrate in this disease. CD4+ and CD8+ T-cells are present in periodontal lesions, as are memory/activated T-lymphocytes. In addition, Th1- and Th2-type T-lymphocytes and their associated cytokines with a subtle polarization to Th1 may be present. Th1-type T-cells up-regulate the production of pro-inflammatory cytokines IL-1 and TNF-alpha, which can induce bone resorption indirectly by promoting differentiation of osteoclast precursors and subsequently by activating osteoclasts. Such osteoclast differentiation is dependent on stimulation of osteoprotegerin ligand (OPG-L) production by osteoblastic cells. By contrast, activated T-cells, by virtue of direct production and expression of OPG-L, can directly promote osteoclast differentiation. OPG-L appears to be predominantly expressed on Th1-type cells. The direct and indirect T-cell involvement in periodontal bone resorption appears to be dependent on the degree of Th1-type T-cell recruitment into inflamed gingival tissues. This T-cell recruitment is regulated by adhesion molecules and chemokines/chemokine receptors. The adhesion molecules involved include alpha4 and alpha6 integrins, LFA-1, and ICAM-1. The Th1-type T-cells preferentially express CCR5 and CXCR3, which are found prominently in diseased gingivae. By contrast, little CCR4, expressed by Th2-type T-cells, can be detected. Also, the chemokine ligands RANTES, MIP1-alpha (both CCR5), and IP-10 (CXCR3 ligand) were elevated in inflamed periodontal tissues. The T-cell features in diseased periodontal tissues can be compared with those in rheumatoid arthritis, wherein bone resorption often attributed to Th1-type T-cell involvement has also been demonstrated.

Oligonucleotide containing CpG motifs enhances immune response to mucosally or systemically administered tetanus toxoid.

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation of macrophages and thus stimulation of the immune system. We tested an oligonucleotide containing an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for the ability to affect antibody levels to tetanus toxoid (Tt). Groups of male Rowett rats (n=5-6/group) received colloidal aluminium hydroxide (Al(OH)3) either alone, or with Tt bound to the Al(OH)3, or with Tt bound to Al(OH)3 with the addition of the CpG oligonucleotide. Antigens were administered subcutaneously in the salivary gland vicinity once, or by gastric intubation on 3 consecutive days. On day 124 all animals were given a boost with the same material by the same route. Serum IgG and saliva IgA antibody to Tt was determined by ELISA. Serum antibody levels were significantly higher in ODN+Tt treated rats than in Tt-alone rats immunized by either route after primary or booster immunizations. Thus, administration of an ODN containing unmethylated CpG motifs along with an immunogen bound to Al(OH)3 can result in enhanced specific antibody when administered by intragastric as well as subcutaneous routes.

Cytokine profiles of T-lymphocytes from gingival tissues with pathological pocketing.

Periodontal disease is an infection in which destruction occurs at sites remote from the infection, resulting in pathological pocketing. Intervening between the infection and the destruction is a dense mononuclear inflammatory infiltrate. It has been suggested that this infiltrate might have characteristics and the destructive potential of Th1-type T lymphocytes. To ascertain the nature of the infiltrates we investigated the expression of mRNA for IL-2, IL-5, and IFN-gamma by gingival mononuclear cells (GMC) from healthy (n = 8) or adult periodontitis (AP) patients (n = 25) by using cytokine-specific reverse-transcription/polymerase-chain-reaction (RT-PCR). GMC, as obtained from patients' tissues, expressed IL-2, IFN-gamma, or IL-5 mRNA. Significantly higher proportions of GMC from AP patients expressed IL-2 and IFN-gamma mRNA than did those from healthy subjects. IFN-gamma was the most consistent cytokine message detected. In other experiments, gingival T-lymphocytes (n = 12) and CD4+ and CD8+ gingival T-lymphocytes (n = 16) were isolated from gingival tissues removed surgically from AP patients. AP gingival T-lymphocytes expressed mRNA for IL-2, IFN-gamma, or IL-6 prior to stimulation. After stimulation with Con A, the cells significantly up-regulated IL-5 and IL-6 message expression. Both CD4+ and CD8+ gingival T-lymphocytes expressed IFN-gamma, IL-5, and some IL-2. This cumulative cytokine profile observed in these experiments is consistent with the predominance of Th1-type cells in pathological tissues and with Th2-type cells, which can also be present, being up-regulated under appropriate stimulation. Importantly, CD4+ and CD8+ lymphocytes were shown to express T1- and T2-type cytokine message, emphasizing the potential for CD8+ T-lymphocytes to participate in periodontal disease pathology.

Serum IgG reactivity to subgingival bacteria in initial periodontitis, gingivitis and healthy subjects.

BACKGROUND/AIMS: Established periodontal diseases may be associated with antibody responses to periodontal pathogens, but it is not known at which stage of disease this antibody response is initiated. This study aimed to characterize the host systemic response in initial periodontitis, gingivitis, and periodontal health, to evaluate whether elevated serum antibodies to subgingival species could be detected in initial periodontitis. METHOD: Human systemic immune response were evaluated to 40 subgingival bacterial species in 16 healthy, 21 gingivitis, 11 initial periodontitis and 5 progressing recession adults. Subjects had minimal periodontal attachment level (AL) loss at baseline. Disease categories were determined after 12 months monitoring at three-month intervals. Increased AL loss > or = 1.5 mm (disease activity) at interproximal sites defined initial periodontitis, recession was characterized by AL loss at buccal sites. Serum IgG antibodies were evaluated semi-quantitatively by immunoblot from blood taken at baseline, active and final visits. RESULTS: No antibody was detected from 55% of reactions. When detected, levels were below those reported for advanced periodontitis subjects. There were no major differences in serum antibody levels between healthy, gingivitis and initial periodontitis subjects, despite differences in the subgingival microbiota. Serum antibodies for more species were detected in recession subjects, compared with the other study subjects. No changes in antibody levels were detected between baseline, active, and final visits. No systematic association between species colonization and presence of systemic antibody was observed. CONCLUSIONS: This study did not detect differential elevation of mean serum antibody levels in initial periodontitis subjects, suggesting that serum antibody levels are not sensitive risk markers for initial periodontitis.