A high-dimensional platform for observing neutrophil-parasite interactions.

Diarrheal diseases with infectious etiology remain a major cause of death globally, particularly in low-income countries. Entamoeba histolytica is a pathogenic protozoan parasite that is the causative agent of amebiasis. Amebiasis has a wide presentation in clinical severity with many factors, including the bacterial microbiota, contributing to this variation. The innate immune response also plays a critical role in regulating the severity of E. histolytica infection, with neutrophils reported to have a protective role. Despite this, the precise mechanism of how neutrophils mediate amebic killing is poorly understood. Thus, modern platforms that allow for inquiry of granulocyte-ameba interactions will increase our understanding of this disease. Herein, we describe an assay for neutrophil killing of E. histolytica by utilizing high-dimensional spectral flow cytometry. Neutrophils were isolated from wild-type 5-week-old C57BL/6 mice and co-cultured with E. histolytica at various multiplicity of infections (MOIs). After co-culture, neutrophils and E. histolytica were stained for spectral flow cytometry. Cell populations were identified using surface markers and fluorescence minus one (FMO) controls. We have previously shown that animals colonized with a component of the human microbiota, Clostridium scindens, were protected from E. histolytica. This protection was associated with elevated neutrophil count. Here, we explored amebic killing capacity and observed that neutrophils from animals with C. scindens possessed heightened amebic killing compared with controls. Thus, this study establishes a novel platform that can provide an in-depth analysis of granulocyte-parasite interactions in various contexts, including during alteration of the intestinal microbiota.IMPORTANCEThe tools for studying host immune cell-E. histolytica interactions are limited. Factors, such as parasite heterogeneity, infectivity, and difficulties with culture systems and animal models, make interrogation of these interactions challenging. Thus, Entamoeba researchers can benefit from next-generation models that allow for the analysis of both host and parasite cells. Here, we demonstrate the use of a novel platform that allows for the determination of parasite-host cell interactions and customizable high-dimensional phenotyping of both populations. Indeed, spectral flow cytometry can approach >40 markers on a single panel and can be paired with custom-developed parasite antibodies that can be conjugated to fluorochromes via commercially available kits. This platform affords researchers the capability to test highly precise hypotheses regarding host-parasite interactions.

Investigating the impact of antibiotic-induced dysbiosis on protection from Clostridium difficile colitis by mouse colonic innate lymphoid cells.

Innate lymphoid cells (ILCs) play a critical role in maintaining intestinal health in homeostatic and diseased conditions. During Clostridium difficile infection (CDI), IL-33 activates ILC2 to protect from colonic damage and mortality. The function of IL-33 and ILC is tightly regulated by the intestinal microbiota. We set out to determine the impact of antibiotic-induced disruption of the microbiome on ILC function. Our goal was to understand antibiotic-induced changes in ILC function on susceptibility to C. difficile colitis in a mouse model. We utilized high-throughput single-cell RNAseq to investigate the phenotypic features of colonic ILC at baseline, after antibiotic administration with or without IL-33 treatment. We identified a heterogeneous landscape of colonic ILCs with gene signatures of inflammatory, anti-inflammatory, migratory, progenitor, plastic, and antigen-presenting ILCs. Antibiotic treatment decreased ILC2 while coordinately increasing ILC1 and ILC3 phenotypes. Notably, Ifng+, Ccl5+, and Il23r+ ILC increased after antibiotics. IL-33 treatment counteracted the antibiotic effect by downregulating ILC1 and ILC3 and activating ILC2. In addition, IL-33 treatment markedly induced the expression of type 2 genes, including Areg and Il5. Finally, we identified amphiregulin, produced by ILC2, as protective during C. difficile infection. Together, our data expand our understanding of how antibiotics induce susceptibility to C. difficile colitis through their impact on ILC subsets and function.IMPORTANCEClostridium difficile infection (CDI) accounts for around 500,000 symptomatic cases and over 20,000 deaths annually in the United States alone. A major risk factor of CDI is antibiotic-induced dysbiosis of the gut. Microbiota-regulated IL-33 and innate lymphoid cells (ILCs) are important in determining the outcomes of C. difficile infection. Understanding how antibiotic and IL-33 treatment alter the phenotype of colon ILCs is important to identify potential therapeutics. Here, we performed single-cell RNAseq of mouse colon ILCs collected at baseline, after antibiotic treatment, and after IL-33 treatment. We identified heterogeneous subpopulations of all three ILC subtypes in the mouse colon. Our analysis revealed several potential pathways of antibiotic-mediated increased susceptibility to intestinal infection. Our discovery that Areg is abundantly expressed by ILCs, and the protection of mice from CDI by amphiregulin treatment, suggests that the amphiregulin-epidermal growth factor receptor pathway is a potential therapeutic target for treating intestinal colitis.

Development and Human Factors Evaluation of a Portable Auditory Localization Training System.

OBJECTIVE: To design and develop a Portable Auditory Localization Acclimation Training (PALAT) system capable of producing psychoacoustically accurate localization cues; evaluate the training effect against a proven full-scale, laboratory-grade system under three listening conditions; and determine if the PALAT system is sensitive to differences among electronic level-dependent hearing protection devices (HPDs). BACKGROUND: In-laboratory auditory localization training has demonstrated the ability to improve localization performance with the open (natural) ear, that is, unoccluded, and while wearing HPDs. The military requires a portable system capable of imparting similar training benefits as those demonstrated in laboratory experiments. METHOD: In a full-factorial repeated measures design experiment, 12 audiometrically normal participants completed localization training and testing using an identical, optimized training protocol on two training systems under three listening conditions (open ear, TEP-100, and ComTac™ III). Statistical tests were performed on mean absolute accuracy score and front-back reversal errors. RESULTS: No statistical difference existed between the PALAT and laboratory-grade DRILCOM systems on two dependent localization accuracy measurements at all stages of training. In addition, the PALAT system detected the same localization performance differences among the three listening conditions. CONCLUSION: The PALAT system imparted similar training benefits as the DRILCOM system and was sensitive to HPD localization performance differences. APPLICATION: The user-operable PALAT system and optimized training protocol can be employed by the military, law enforcement, and various industries, to improve auditory localization performance in conditions where auditory situation awareness is critical to safety.

Secondary bile acids function through the vitamin D receptor in myeloid progenitors to promote myelopoiesis.

Metabolic products of the microbiota can alter hematopoiesis. However, the contribution and site of action of bile acids is poorly understood. Here, we demonstrate that the secondary bile acids, deoxycholic acid (DCA) and lithocholic acid (LCA), increase bone marrow myelopoiesis. Treatment of bone marrow cells with DCA and LCA preferentially expanded immunophenotypic and functional colony-forming unit-granulocyte and macrophage (CFU-GM) granulocyte-monocyte progenitors (GMPs). DCA treatment of sorted hematopoietic stem and progenitor cells (HSPCs) increased CFU-GMs, indicating that direct exposure of HSPCs to DCA sufficed to increase GMPs. The vitamin D receptor (VDR) was required for the DCA-induced increase in CFU-GMs and GMPs. Single-cell RNA sequencing revealed that DCA significantly upregulated genes associated with myeloid differentiation and proliferation in GMPs. The action of DCA on HSPCs to expand GMPs in a VDR-dependent manner suggests microbiome-host interactions could directly affect bone marrow hematopoiesis and potentially the severity of infectious and inflammatory disease.

Melanoma: Does It Present Differently in Darker Skin Tones?

Introduction: There are vast differences in clinical presentations of melanoma across skin tones. Individuals with darker skin tones tend to have a higher prevalence of advanced-stage melanoma, which correlates with increased mortality. We designed this interactive workshop to increase nursing and medical trainees' awareness of the epidemiology, prevention, and treatment of melanoma in individuals of darker skin tones. Methods: The Kern model was used in the design, implementation, and evaluation of the workshop. The 75-minute workshop consisted of a PowerPoint presentation, video-based reflection activities, and case studies. Evaluation consisted of pre- and postworkshop questionnaires. The workshop was implemented two times among 63 nursing students, 11 medical students/residents, and six medical faculty. Results: Seventy-one participants completed the pre- and postworkshop evaluations. A comparison of pre- and postworkshop responses utilizing the Wilcoxon matched-pair signed rank test showed a statistically significant increase in learners' confidence to address each learning objective. Discussion: Through this interactive educational presentation, medical and nursing trainees can gain heightened awareness of melanoma across various skin tones, especially unique presentations in darker skin tones.

First report of tomato chlorotic dwarf viroid infecting litchi tomato (Solanum sisymbriifolium).

Litchi tomato (LT) (Solanum sisymbriifolium) is a solanaceous weed that is considered a biological control tool to manage potato cyst nematode (PCN) in Europe and is being explored for use in Idaho. Two Several LT lines were clonally maintained as stocks in the university greenhouse since 2013 and were also established in tissue culture at the same time. In 2018, tomato (Solanum lycopersicum cv. Alisa Craig) scions were grafted onto two LT rootstocks originating either from healthy-looking greenhouse stocks or from tissue culture-maintained plants. Unexpectedly, tomatoes grafted onto the greenhouse-maintained rootstocks of LT displayed severe symptoms of stunting, foliar deformation, and chlorosis, while grafts onto the same LT lines from tissue culture produced healthy-looking tomato plants. Tests for the presence of several viruses known to infect solanaceous plants were conducted on symptomatic tomato scion tissues using ImmunoStrips (Agdia, Elkhard, IN) and RT-PCR (Elwan et al. 2017) but yielded negative results. High throughput sequencing (HTS) was then used to identify possible pathogens that could have been responsible for the symptoms observed in tomato scions. Samples from two symptomatic tomato scions, two asymptomatic scions grafted onto the tissue culture-derived plants, and two greenhouse-maintained rootstocks were subjected to HTS. Total RNA from the four tomato and two LT samples was depleted of ribosomal RNA and subjected to HTS on an Illumina MiSeq platform producing 300-bp paired-end reads and raw reads were adapter and quality cleaned. For the tomato samples, the clean reads were mapped against the S. lycopersicum L. reference genome, and unmapped paired reads were assembled producing between 4,368 and 8,645 contigs. For the LT samples, all clean reads were directly assembled, producing 13,982 and 18,595 contigs. In the symptomatic tomato scions and the two LT rootstock samples, a 487-nt contig was found, comprising an ~1.35 tomato chlorotic dwarf viroid (TCDVd) genome and exhibiting 99.7% identity with it (GenBank accession AF162131; Singh et al. 1999). No other virus-related or viroid contigs were identified. RT-PCR analysis using a pospiviroid primer set Pospi1-FW/RE (Verhoeven et al. 2004), and a TCDVd-specific primer set TCDVd-Fw/TCDVd-Rev (Olmedo-Velarde et al. 2019) produced 198-nt and 218-nt bands, respectively, thus confirming the presence of TCDVd in tomato and LT samples. These PCR products were Sanger sequenced and confirmed to be TCDVd-specific; the complete sequence of the Idaho isolate of TCDVd was deposited in GenBank under the accession number OQ679776. Presence of TCDVd in LT plant tissue was confirmed by the APHIS PPQ Laboratory in Laurel, MD. Asymptomatic tomatoes and LT plants from tissue culture were found negative for TCDVd. Previously, TCDVd was reported to affect greenhouse tomatoes in Arizona and Hawaii (Ling et al. et al. 2009; Olmedo-Velarde et al. 2019), however, this is the first report of TCDVd infecting litchi tomato (S. sisymbriifolium). Five additional greenhouse-maintained LT lines were found TCDVd-positive using RT-PCR and Sanger sequencing. Given the very mild or asymptomatic infection of TCDVd in this host, molecular diagnostic methods should be used to screen LT lines for the presence of this viroid to avoid inadvertent spread of TCDVd. Another viroid, potato spindle tuber viroid, was reported to be transmitted through LT seed (Fowkes et al. 2021), and transmission of TCDVd through LT seed may also be responsible for this TCDVd outbreak in the university greenhouse, although no direct evidence was collected. To the best of our knowledge, this is the first report of TCDVd infection in S. sisymbriifolium and also the first report of the TCDVd occurrence in Idaho.

Quadriceps Strain and TKA: Contribution of the Tourniquet and Intramedullary Rod to Postoperative Thigh Pain: A Randomized Controlled Trial.

BACKGROUND: Thigh pain is relatively common after total knee arthroplasty (TKA) and has been attributed to compression of the thigh muscles by the tourniquet used during surgery. Thigh pain that occurs after a TKA that was performed without a tourniquet may be due to a strain of the quadriceps muscle or insertion of the intramedullary (IM) rod. The purpose of the present study was to determine the cause of thigh pain after TKA in a randomized controlled trial evaluating tourniquet use, IM rod use, and quadriceps strain. METHODS: This prospective randomized controlled trial enrolled 97 subjects undergoing primary knee arthroplasty into 4 groups according to tourniquet use (yes or no) and IM rod use (yes or no). Quadriceps strain was evaluated with magnetic resonance imaging (MRI) on postoperative day 1 (POD 1). Data collected preoperatively, intraoperatively, and postoperatively until the 6-week clinical visit included pain levels for the knee and thigh (recorded separately) and knee range of motion. RESULTS: Regardless of tourniquet or IM rod use, 73 (75%) of the 97 patients reported thigh pain on POD 1. Thigh pain at 2 weeks postoperatively was indicative of a quadriceps strain. Use of a tourniquet and patient-reported thigh pain at 2 weeks increased the odds of a quadriceps strain, whereas IM rod use did not significantly contribute to thigh pain. CONCLUSIONS: The etiology of thigh pain after TKA may be multifactorial; however, an iatrogenic quadriceps strain is one source of thigh pain after TKA, especially if the pain persists 2 weeks after surgery. LEVEL OF EVIDENCE: Prognostic Level I . See Instructions for Authors for a complete description of levels of evidence.

Superiorization-inspired unrolled SART algorithm with U-Net generated perturbations for sparse-view and limited-angle CT reconstruction.

Objective.Unrolled algorithms are a promising approach for reconstruction of CT images in challenging scenarios, such as low-dose, sparse-view and limited-angle imaging. In an unrolled algorithm, a fixed number of iterations of a reconstruction method are unrolled into multiple layers of a neural network, and interspersed with trainable layers. The entire network is then trained end-to-end in a supervised fashion, to learn an appropriate regularizer from training data. In this paper we propose a novel unrolled algorithm, and compare its performance with several other approaches on sparse-view and limited-angle CT.Approach.The proposed algorithm is inspired by the superiorization methodology, an optimization heuristic in which iterates of a feasibility-seeking method are perturbed between iterations, typically using descent directions of a model-based penalty function. Our algorithm instead uses a modified U-net architecture to introduce the perturbations, allowing a network to learn beneficial perturbations to the image at various stages of the reconstruction, based on the training data.Main Results.In several numerical experiments modeling sparse-view and limited angle CT scenarios, the algorithm provides excellent results. In particular, it outperforms several competing unrolled methods in limited-angle scenarios, while providing comparable or better performance on sparse-view scenarios.Significance.This work represents a first step towards exploiting the power of deep learning within the superiorization methodology. Additionally, it studies the effect of network architecture on the performance of unrolled methods, as well as the effectiveness of the unrolled approach on both limited-angle CT, where previous studies have primarily focused on the sparse-view and low-dose cases.

Rapid, inexpensive fabrication of electrophoretic microdevices for fluorescence detection.

The laser print, cut, and laminate (PCL) method for microfluidic device fabrication can be leveraged for rapid and inexpensive prototyping of electrophoretic microchips useful for optimizing separation conditions. The rapid prototyping capability allows the evaluation of fluidic architecture, applied fields, reagent concentrations, and sieving matrix, all within the context of using fluorescence-compatible substrates. Cyclic olefin copolymer and toner-coated polyethylene terephthalate (tPeT) were utilized with the PCL technique and bonding methods optimized to improve device durability during electrophoresis. A series of separation channel designs and centrifugation conditions that provided successful loading of sieving polymer in less than 3 min was described. Separation of a 400-base DNA sizing ladder provided calculated base resolution between 3 and 4 bases, a greater than 18-fold improvement over separations on similar substrates. Finally, the accuracy and precision capabilities of these devices were demonstrated by separating and sizing DNA fragments of 147 and 167 bases as 148.62 ± 2 and 166.48 ± 3 bases, respectively.

The CellRaft AIRⓇ system: A novel system enabling organoid imaging, identification, and isolation.

Three-dimensional (3D) culture systems have been developed that can re-capitulate organ level responses, simulate compound diffusion through complex structures, and assess cellular heterogeneity of tissues, making them attractive models for advanced in vitro research and discovery. Organoids are a unique subtype of 3D cell culture that are grown from stem cells, are self-organizing, and closely replicate in vivo pathophysiology. Organoids have been used to understand tissue development, model diseases, test drug sensitivity and toxicity, and advance regenerative medicine. However, traditional organoid culture methods are inadequate because they are low throughput and ill-suited for single organoid imaging, phenotypic assessment, and isolation from heterogenous organoid populations. To address these bottlenecks, we have adapted our tissue culture consumable and instrumentation to enable automated imaging, identification, and isolation of individual organoids. Organoids grown on the 3D CytoSortⓇ Array can be reliably tracked, imaged, and phenotypically analyzed using brightfield and fluorescent microscopy as they grow over time, then released and transferred fully intact for use in downstream applications. Using mouse hepatic and pancreatic organoids, we have demonstrated the use of this technology for single-organoid imaging, clonal organoid generation, parent organoid subcloning, and single-organoid RNA extraction for downstream gene expression or transcriptomic analysis. The results validate the ability of the CellRaft AIRⓇ System to facilitate efficient, user-friendly, and automated workflows broadly applicable to organoid research by overcoming several pain points: 1) single organoid time-course imaging and phenotypic assessment, 2) establishment of single cell-derived organoids, and 3) isolation and retrieval of single organoids for downstream applications.

The IL-33-ILC2 pathway protects from amebic colitis.

Entamoeba histolytica is a pathogenic protozoan parasite that causes intestinal colitis, diarrhea, and in some cases, liver abscess. Through transcriptomics analysis, we observed that E. histolytica infection was associated with increased expression of IL-33 mRNA in both the human and murine colon. IL-33, the IL-1 family cytokine, is released after cell injury to alert the immune system of tissue damage. Treatment with recombinant IL-33 protected mice from amebic infection and intestinal tissue damage; moreover, blocking IL-33 signaling made mice more susceptible to amebiasis. IL-33 limited the recruitment of inflammatory immune cells and decreased the pro-inflammatory cytokine IL-6 in the cecum. Type 2 immune responses were upregulated by IL-33 treatment during amebic infection. Interestingly, administration of IL-33 protected RAG2-/- mice but not RAG2-/-γc-/- mice, demonstrating that IL-33-mediated protection required the presence of innate lymphoid cells (ILCs). IL-33 induced recruitment of ILC2 but not ILC1 and ILC3 in RAG2-/- mice. At baseline and after amebic infection, there was a significantly higher IL13+ILC2s in C57BL/J mice, which are naturally resistant to amebiasis, than CBA/J mice. Adoptive transfer of ILC2s to RAG2-/-γc-/- mice restored IL-33-mediated protection. These data reveal that the IL-33-ILC2 pathway is an important host defense mechanism against amebic colitis.

First report of grapevine rupestris vein feathering virus in wine grapes in Idaho.

Grapevine rupestris vein feathering virus (GRVFV) was found associated with chlorotic discolorations of leaf veins in a Greek grapevine cultivar (El Beaino et al. 2001; Abou Ghanem-Sabanadzovic et al. 2003) or with Syrah decline (Al Rwahnih et al. 2009). In the United States, GRVFV was reported to occur in California (Al Rwahnih et al. 2009) and in Washington State (Chingandu et al. 2021). Wine grape production in Idaho is known to be affected by several viruses, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (GFkV; Kanuya et al. 2012), and grapevine red blotch virus (GRBV; Thompson et al. 2019b), but the GRVFV status was not addressed previously. In 2018, leaf and petiole samples from five declining Chardonnay vines were collected from a single vineyard in Canyon County of Idaho. Ribodepleted total RNA prepared from these samples was subjected to a high-throughput sequencing (HTS) analysis on a MiSeq platform as described previously (Thompson et al. 2019a), yielding between 3,623,716 and 4,467,149 300-bp paired-end reads. Briefly, raw reads were adapter and quality cleaned, mapped against the Vitis vinifera L., reference genome. Unmapped paired reads were assembled, producing between 829 and 1,996 contigs over 1,000-nt in length. All five samples were found to contain GLRaV-3 and the two common viroids, hop stunt viroid and grapevine yellow speckle viroid, while four contigs ranging in size from 1,361 to 6,736 and exhibiting homology with the GRVFV were found in three out of the five Chardonnay samples analyzed. Those GRVFV-specific contigs had 98.5-98.7% pairwise identity. A nearly complete genome of GRVFV-ID was assembled from the HTS data of one sample, and the 3'-terminus of the genome was acquired using the RACE methodology; the 6,736-nt sequence has been deposited in the GenBank database under the accession number MZ027155. BLASTn analysis of this sequence revealed 90.7% identity to the closest match in the GenBank database (MH544699, isolate SK931from Slovakia). In the fall of 2020, six commercially operating vineyards in Canyon and Nez Perce Counties of Idaho, including the original one, were sampled for the total of 26 sampled plants of white and red wine grape cultivars, based on visual symptoms of leaf reddening, leaf rolling, and chlorosis, and tested by reverse transcription (RT)-PCR using newly designed GRVFV-specific primers, GRVFV-F1 (5'- GAAGCAACAGTGCCCGTCTC -3') and GRVFV-R1 (5'- AGGTCGCTTTACGGACCTTTTCTT -3'). Four plants were found positive for GRVFV by RT-PCR; these positive samples came from three vineyards in Canyon County, from the same wine grape cultivar, Chardonnay. Amplified RT-PCR products were directly sequenced using conventional Sanger methodology, and confirmed to represent 662-nt segments of the GRVFV genome exhibiting 98.6-99.1% pairwise identity to the HTS-derived full-length genome of GRVFV-ID (MZ027155). The four corresponding partial sequences were deposited under the accession numbers MZ020577 to MZ020580. This close identity between the GRVFV sequences from three different Idaho vineyards, coming from the same cultivar Chardonnay, may suggest a common origin of the original GRVFV infection, possibly the same supplier of the original Chardonnay planting material. The California GRVFV sequence AY706994 was 80% identical to the GRVFV-ID, while the recently reported partial sequences of GRVFV from Washington State (MT782067-MT782070; Chingandu et al. 2021) were found to be only 82-85% identical to the GRVFV-ID. Presence of GRVFV might have contributed to the decline of the original Chardonnay vines, although the exact role of GRVFV in a mixed infection with GLRaV-3 is not clear at the moment. To the best of our knowledge, this is the first report of GRVFV in wine grapes in Idaho.

Gut microbiome communication with bone marrow regulates susceptibility to amebiasis.

The microbiome provides resistance to infection. However, the underlying mechanisms are poorly understood. We demonstrate that colonization with the intestinal bacterium Clostridium scindens protects from Entamoeba histolytica colitis via innate immunity. Introduction of C. scindens into the gut microbiota epigenetically altered and expanded bone marrow granulocyte-monocyte progenitors (GMPs) and resulted in increased intestinal neutrophils with subsequent challenge with E. histolytica. Introduction of C. scindens alone was sufficient to expand GMPs in gnotobiotic mice. Adoptive transfer of bone marrow from C. scindens-colonized mice into naive mice protected against amebic colitis and increased intestinal neutrophils. Children without E. histolytica diarrhea also had a higher abundance of Lachnoclostridia. Lachnoclostridia C. scindens can metabolize the bile salt cholate, so we measured deoxycholate and discovered that it was increased in the sera of C. scindens-colonized specific pathogen-free and gnotobiotic mice, as well as in children protected from amebiasis. Administration of deoxycholate alone increased GMPs and provided protection from amebiasis. We elucidated a mechanism by which C. scindens and the microbially metabolized bile salt deoxycholic acid alter hematopoietic precursors and provide innate protection from later infection with E. histolytica.

Optimisation of an auditory azimuth localisation training protocol for military service members.

Objective: Design an optimised auditory azimuth localisation training protocol by: (1) differing the number of training stimuli presentations to determine the highest angular accuracy achieved in the fewest training sessions, (2) evaluating the presence of training transfer from a broadband stimulus to untrained military-relevant stimuli and (3) measuring the effect of differing training strategies on localisation accuracy.Design: Two pilot studies of 18 and six subjects, respectively, determined the number of presentations and type of stimuli to be included in a localisation training experiment that evaluated different training strategies. In the pilot studies, participants trained using eight Learning Units (LU) and then tested using untrained stimuli. In the main experiment, 40 participants completed eight LUs using four different learning strategies, with 10 participants randomly assigned to each condition.Sample: All participants were ages 18-42 normal-hearing listeners with thresholds not exceeding 25 dB HL and asymmetry not exceeding 15 dB HL.Results: Transfer of training occurred using three of the four untrained stimuli. The training strategy that resulted in the highest localisation accuracy involved active participation.Conclusions: Training with a broadband stimulus transfers to untrained broadband stimuli. Training involving the active participation strategy resulted in the greatest localisation accuracy.

Analysis of polyhexamethylene biguanide and alexidine in contact lens solutions using capillary electrophoresis, ultra-performance liquid chromatography and quadrupole time of flight mass spectrometry.

Polymeric biguanides, as well as quaternary ammonium compounds, are ubiquitous antimicrobial agents in healthcare. Due to the highly cationic and polymeric nature of these compounds and the complex matrices in which they are found, the analytical characterization of products containing them remains challenging. In this work an efficient, sensitive, and high-resolution separation protocol was developed to perform quantitative measurements (sub-mg L-1) of alexidine dihydrochloride (ADH) and polyhexamethylene biguanide (PHMB) in commercial multipurpose contact lens solutions (MPS). Initially, contactless conductivity (C4D) detection was explored, but lacked adequate selectivity and sensitivity to quantify PHMB or ADH in commercial MPS. To overcome these limitations, an alternative approach using solid phase extraction (SPE) followed by separation with reversed phase ultra-performance liquid chromatography (RP-UPLC) was developed for both ADH and PHMB separation and detection. The most sensitive and reliable method investigated utilized standard additions to compensate for matrix effects. For ADH, concentration values measured with the presented method were consistent with data provided by the MPS manufacturer (1.6 mg L-1) within 0.10 mg L-1. PHMB quantification in MPS products was successful at concentrations <1 mg L-1 with quantitative reproducibility better than 2% RSD. Comparison of blind sample testing using the RP-UPLC method showed strong correlation (R2 = 0.939) of PHMB concentrations with results obtained by the United States Food and Drug Administration using a published HPLC-Evaporative light scattering detection (ELSD) assay. A significant advantage of this method is the ability to partially resolve PHMB polydispersity, which to date has been minimally studied and explained. By coupling with electrospray mass spectrometry (MS), a general trend was observed for increased retention as a function of PHMB chain length. The improved robustness and reproducibility of UV detection versus ELSD coupled with the superior resolving power of UPLC is an asset to the detection and characterization of PHMB and ADH. In addition to quality control of MPS, this method has potential application to the analyses skin wipes, wound dressings and other medical products where understanding how manufacturing processes lead to differences in polydispersity is important to maximize the antimicrobial properties while minimizing toxicologic effects.

Prevalence of 'Candidatus Liberibacter solanacearum' Haplotypes in Potato Tubers and Psyllid Vectors in Idaho From 2012 to 2018.

'Candidatus Liberibacter solanacearum' (Lso) is an uncultured, phloem-associated bacterium causing a severe tuber disease in potato called zebra chip (ZC). Seven haplotypes of Lso have been described in different hosts, with haplotypes A and B found associated with infections in potato and tomato. In the field, Lso is transmitted by the potato psyllid (Bactericera cockerelli), and between 2011 and 2015, a significant change in Lso haplotype prevalence was previously reported in Idaho: from exclusively A haplotype found in tested psyllids in 2012 to mainly B haplotype found in collected psyllids in 2015. However, prevalence of Lso haplotypes in Idaho was not analyzed in potato tubers exhibiting symptoms of ZC. To fill in this knowledge gap, prevalence of Lso haplotypes was investigated in potato tubers harvested in southern Idaho between 2012 and 2018, and it was found to change from exclusively A haplotype in the 2012 season to an almost equal A and B haplotype distribution during the 2016 season. During the same period, haplotype distribution of Lso in psyllid vectors collected using yellow sticky traps also changed, but in psyllids, the shift from A haplotype of Lso to B haplotype was complete, with no A haplotype detected in 2016 to 2018. The changes in the haplotype prevalence of the Lso circulating in potato fields in southern Idaho may be, among other factors, responsible for a decrease in the ZC incidence in Idaho potato fields between an outbreak of the disease in 2012 and a very low level of ZC afterward.

A Novel Genetic Variant of Grapevine leafroll-associated virus-3 (GLRaV-3) from Idaho Grapevines.

Grapevine leafroll-associated virus-3 (GLRaV-3) is a major constraint on profitable grapevine cultivation. The virus is transmitted efficiently by mealybugs and soft scale insects, or through vegetative propagation by cuttings, and is present worldwide, wherever grapevines are grown. GLRaV-3 exists as a complex of genetic variants currently classified in several phylogenetic groups that can differ from each other by as much as 30% in nucleotide sequence of the whole genome. In the course of the GLRaV-3 testing of wine grapes in southern Idaho, plants of two grapevine cultivars were found to harbor a novel genetic variant of GLRaV-3, named ID45, which exhibited ≤80% nucleotide sequence identity level to the known GLRaV-3 isolates in its most conserved HSP70h gene. The ID45 variant caused no foliar symptoms in 'Cabernet Sauvignon' in the fall, and was demonstrated to have poor reactivity to commercial virus-specific antibodies. The entire 18,478-nt genome sequence of the GLRaV-3-ID45 was determined using a combination of high-throughput and conventional Sanger sequencing, and demonstrated to have typical organization for the genus Ampelovirus (family Closteroviridae), with only 70 to 77% identity level to the GLRaV-3 genomes from other established phylogroups. We concluded that ID45 represented a new phylogenetic group IX of GLRaV-3. Database search using ID45 nucleotide sequence as a query suggested that this novel ID45 variant is present in at least one other grape-growing state in the U.S., California, and in Brazil. An RT-PCR based test was developed to distinguish ID45 from the predominant GLRaV-3 phylogroup I found in Idaho in single and mixed infections.

Rapid multiplex DNA amplification on an inexpensive microdevice for human identification via short tandem repeat analysis.

Forensic DNA analysis requires several steps, including DNA extraction, PCR amplification, and separation of PCR fragments. Intuitively, there are numerous situations where it would be beneficial to speed up the overall DNA analysis process; in this work, we focus on the most time-consuming component in the analysis pipeline, namely the polymerase chain reaction (PCR). Primers were specially designed to target 10 human genomic loci, all yielding amplicons shorter than 350 bases, for ease of downstream integration with on-board microchip electrophoresis. Primer concentrations were adjusted specifically for microdevice amplification, resulting in well-balanced short tandem repeat (STR) profiles. Furthermore, studies were performed to push the limits of the DNA polymerase to achieve rapid, multiplexed PCR on various substrates, including transparent and black polyethylene terephthalate (Pe), and with two distinct adhesives, toner and heat sensitive adhesive (HSA). Rapid STR-based multiplexed PCR amplification is demonstrated in 15 min on a Pe microdevice using a custom-built system for fluid flow control and thermocycling for the full 10-plex, and in 10 min for a smaller multiplex consisting of six core CODIS loci plus Amelogenin with amplicons shorter than 200bp. Lastly, preliminary studies indicate the capability of this PCR microdevice platform to be integrated with both upstream DNA extraction, and downstream microchip electrophoresis. This, coupled to the use of reagents that are compatible with lyophilization (lyo-compatible) for PCR, represents the potential for a fully integrated rotationally-driven microdevice for complete forensic DNA analysis.

Simple, Reagentless Quantification of Total Bilirubin in Blood Via Microfluidic Phototreatment and Image Analysis.

Total bilirubin (T-Bil) is an important clinical diagnostic marker that is measured frequently by physicians to assist in the diagnosis, treatment, and monitoring of multiple medical conditions. The work demonstrated here utilizes the 48-year-old mechanism of phototherapy that is commonly implemented in the treatment of infants with exaggerated physiologic and pathologic jaundice but adapts it to the microfluidic level for the ultimate purpose of total bilirubin quantitation. After acquisition of a small volume of blood (<10 µL) and through subsequent separation (plasma + red blood cells), a 3 µL plasma sample was imaged by a portable scanner and analyzed through a custom algorithm for color intensity. After blue light irradiation for 10 min at 470 nm, the sample was reimaged and analyzed. The resulting intensities obtained pre- and postimaging (clearly observed through a color change from yellow to clear) were then utilized to calculate the total bilirubin concentration. A total of 34 blood samples were analyzed with microfluidic photo treatment-image analysis (µPIA) and were found to have a Deming-regression slope of 0.97 (R2 = 0.960) when compared to the total bilirubin values determined in the clinical laboratory. We demonstrate the implementation of a centrifugal microdevice fabricated through the Print, Cut, and Laminate (PCL) method that accepts eight whole blood samples and provides the capabilities to not only quantitate total bilirubin (Deming-regression slope of 0.95, R2 = 0.990) but allow future integration with excess plasma sufficient for additional downstream clinical assays. This work will highlight the inexpensive nature of the analysis (absence of caustic, viscous, or additional reagents), the simplicity (does not require any chemical reactions), speed (sample-to-answer in <15 min), insusceptibility to biofouling (no protein matrix effects, hemoglobin interferences, and minimized turbidity), low volume plasma requirement (3 µL), and the ability for future downstream integration.

Relative Abundance of Potato Psyllid Haplotypes in Southern Idaho Potato Fields During 2012 to 2015, and Incidence of 'Candidatus Liberibacter solanacearum' Causing Zebra Chip Disease.

Zebra chip (ZC) disease, a serious threat to the potato industry, is caused by the bacterium 'Candidatus Liberibacter solanacearum' (Lso). Five haplotypes (hapA to hapE) of this pathogen have been described so far in different crops, with only hapA and hapB being associated with ZC in potato. Both haplotypes are vectored and transmitted to a variety of solanaceaeous plants by the tomato/potato psyllid, Bactericera cockerelli (Sulc). Psyllids are native to North America, and four haplotypes have been identified and named based on their predominant geographic association: Northwestern, Central, Western, and Southwestern. Although all psyllid haplotypes have been found in southern Idaho potato fields, data on relative haplotype abundances and dynamic changes in the fields over time have not previously been reported. Here, psyllid samples collected in Idaho potato fields from 2012 to 2015 were used to clarify spatial and temporal patterns in distribution and abundance of psyllid and Lso haplotypes. A shift from hapA toward hapB population of Lso was revealed during these four seasons, indicating possible evolution of Lso in Idaho fields. Although we confirmed that Western psyllids were the most abundant by far during the four seasons of observation, we also observed changes in abundance of other haplotypes, including increased diversity of psyllid haplotypes during 2015. Seasonal changes observed for the Northwestern and Central haplotypes could potentially be linked to psyllid migration and/or habitat changes. South-central Idaho exhibited more diversity in psyllid haplotypes than southwestern Idaho.