First Report of a New Disease of Onion in Georgia Caused by a Nonfluorescent Pseudomonas Species.

Since 2007, a new disease of onion (Allium cepa) called yellow bud has been a problem in Georgia. Emerging leaves display intense chlorosis and older leaves exhibit extensive leaf blight. Yield reductions can be severe due to stand loss and reduced bulb size. Symptomatic plants are also more prone to freeze damage. The suspected causal agent is a slow-growing, white bacterium isolated onto nutrient agar (NA) by streak isolation. The bacterium grew more vigorously on NA supplemented with 0.5% yeast extract (NA+). Six strains of the bacterium all had gram-negative, rod-shaped cells and were strict aerobes. The strains produced levan, were negative for oxidase, potato rot, and arginine dihydrolase, and produced a hypersensitive reaction in tobacco. These are all characteristics of Pseudomonas group Ia as outlined by Lelliott et al. (2) and differ from characteristics of known Pseudomonas pathogens of onion such as P. aeruginosa, P. marginalis, and P. viridiflava that belong to groups Va, IVa, and II, respectively. The yellow bud bacterial strains were also nonfluorescent on King's medium B and were ice nucleation active. Universal primers PA16SF and PA16SR (ATCCTGGCTCAGATTGAACG and TTCCCCTACGGTTACCTTGTT) were used to amplify the 16S rRNA gene. The resulting consensus nucleotide sequence (GenBank Accession No. JF939841) of the six isolates matched those strains of P. syringae pv. atropurpurea, P. syringae pv. maculicola, P. syringae pv. porri, and P. amygdali (96 to 98% similarity). Primers 1 and 2 (GGCGCTCCCTCGCACTT and GGTATTGGCGGGGGTGC) were used to amplify the coronafacate ligase (cfl) gene. The resulting consensus nucleotide sequence for the six isolates (GenBank Accession No. JF939842) matched the cfl gene from P. syringae pv. tomato, P. syringae pv. morsprunorum, P. syrinage pv. aesculi, and P. syringae pv. glycinea (97 to 99% similarity). Representative strains had 0.95 to 0.99% similarity to P. syringae pv. coronafaciens using Biolog (Biolog, Hayward, CA), and 0.72 to 0.96% similarity to P. syringaepv. tomato using fatty acid analysis (MIDI Inc., Newark, DE). For each of eight representative yellow bud strains, 10 greenhouse-grown onion seedlings of cv. Pegasus were inoculated on one leaf. Bacteria grown on NA+ were suspended in sterile tap water and adjusted to ~1 × 108 CFU/ml. With a hypodermic syringe and needle, 1.0 ml of inoculum was injected in to the hollow cavity of an emerging onion leaf. Chlorosis developed on inoculated leaves in 5 days and was identical to that observed with natural infections. All inoculated plants died within 14 days, confirming pathogenicity. Bacteria with characteristics described above were reisolated from symptomatic leaves. Ten control plants inoculated with sterile water remained asymptomatic. Based on the methods listed above, the yellow bud bacterium was identified as P. syringae, but pathovar designation or genomospecies (1) could not be determined because results varied among the different methods tested. The disease has been spreading throughout the Vidalia onion-growing region since it was first observed. There is significant potential for the disease to become more widespread since it also has been observed in direct-seeded, onion transplant beds. References: (1) J. P. Euzéby. List of Prokaryotic Names with Standing in Nomenclature-Genus Pseudomonas. Online publication. Retrieved from http://www.bacterio.cict.fr/p/pseudomonas.html , 2010. (2) R. A. Lelliott et al. J. Appl. Bact. 29:470, 1966.

First Report of Colletotrichum gloeosporioides Causing 'Twister Disease' of Onion (Allium cepa) in Georgia.

In the fall of 2007, onion seedlings with twisted and distorted leaves were observed in seedbeds in multiple fields in the Vidalia onion region of Georgia. Tests for viruses and bacteria were negative and chemical injury was deemed improbable because of disease distribution in the fields. Upon further investigation, fungal fruiting bodies were observed on the outside sheath of a few of the seedlings. Symptomatic plants were cut into 1-cm segments and surface sterilized in 70% ethanol for 3 min. After rinsing in sterile water, the segments were placed onto potato dextrose agar amended with tetracycline. The fungus isolated from symptomatic plants fit the description of Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. Conidia were aseptate, cylindrical, and hyaline. Sequencing of the internal transcribed spacer region and a BLAST search in GenBank (99% sequence similarity to C. gloeosporioides accessions) confirmed the identification. Ten onion seedlings were spray inoculated with a suspension of 1 × 107 spores/ml until runoff, and four seedlings were inoculated with water as negative controls. Plants were bagged for 12 h to maintain high relative humidity. Five plants were placed in the greenhouse and five plants placed in a growth chamber at 22°C. All plants inoculated with C. gloeosporioides developed distorted and twisted leaves 3 weeks after inoculation in the growth chamber and 5 weeks after inoculation in the greenhouse. Night time temperatures in the greenhouse (15°C) were lower than those in the growth chamber (22°C). Seedlings inoculated with water showed no symptoms. The fungus was reisolated from symptomatic plants. C. gloeosporioides has been reported to cause a disease called twister on onion in tropical regions (1). The fall of 2007 was unusually warm with maximum temperatures reaching 26°C during the day. The pathogen is present on many crops in the United States, but to our knowledge, this is the first report of C. gloeosporioides causing twister disease of onion in the United States. In Nigeria and Brazil, yield losses as much as 100% were observed in fields with infected onions (1). The impact of infection on the growth of the transplants and subsequent yield in Vidalia onions is currently unknown. References: (1) J. P. Hill. Compendium of Onion and Garlic Diseases. 2nd ed. The American Phytopathological Society, St. Paul, MN, 2008.

Use of Fatty Acid Methyl Ester Profiles to Compare Copper-Tolerant and Copper-Sensitive Strains of Pantoea ananatis.

ABSTRACT A survey was conducted to evaluate differences in fatty acid methyl ester (FAME) profiles among strains of Pantoea ananatis, causal agent of center rot of onion (Allium cepa), isolated from 15 different onion cultivars in three different sites in Georgia. Differences in FAME composition were determined by plotting principal components (PCs) in two-dimensional plots. Euclidean distance squared (ED(2)) values indicated a high degree of similarity among strains. Plotting of PCs calculated from P. ananatis strains capable of growing on media amended with copper sulfate pentahydrate (200 mug/ml) indicated that copper-tolerant strains grouped into tight clusters separate from clusters formed by wild-type strains. However, unlike copper-sensitive strains, the copper-tolerant strains tended to cluster by location. A total of 80, 60, and 73% of the strains from Tift1, Tift2, and Tattnall, respectively, exhibited either confluent growth or partial growth on copper-amended medium. However, all strains were sensitive to a mixture of copper sulfate pentahydrate (200 mug/ml) and maneb (40 mug/ml). When copper-tolerant clones were analyzed and compared with their wild-type parents, in all cases the plotting of PCs developed from copper-tolerant clones formed tight clusters separate from clusters formed by the parents. Eigenvalues generated from these tests indicated that two components provided a good summary of the data, accounting for 98, 98, and 96% of the standardized variance for strains Pna 1-15B, Pna 1-12B, and Pna 2-5A, respectively. Furthermore, feature 4 (cis-9-hexadecenoic acid/2-hydroxy-13-methyltetradecanoic acid) and feature 7 (cis-9/trans-12/cis-7-octadecenoic acid) were the highest or second highest absolute values for PC1 in all three strains of the parents versus copper-tolerant clones, and hexadecanoic acid was the highest absolute value for PC2 in all three strains. Along with those fatty acids, dodecanoic acid and feature 3 (3-hydroxytetradecanoic acid/14-methylpentadecenoic acid) also had an impact on the differences observed between copper-sensitive parents and copper-resistant mutants. Finding these changes in bacterial fatty acid composition could lead to the development of a laboratory assay to identify copper-tolerant strains using gas chromatography as well as providing clues to further elucidate the mode of action of copper tolerance.

First Report of Vidalia Onion (Allium cepa) Naturally Infected with Tomato spotted wilt virus and Iris yellow spot virus (Family Bunyaviridae, Genus Tospovirus) in Georgia.

Vidalia onion is an important crop in Georgia's agriculture with worldwide recognition as a specialty vegetable. Vidalia onions are shortday, Granex-type sweet onions grown within a specific area of southeastern Georgia. Tomato spotted wilt virus (TSWV) has been endemic to Georgia crops for the past decade, but has gone undetected in Vidalia onions. Tobacco thrips (Frankliniella fusca) and Western flower thrips (Frankliniella occidentalis) are the primary vectors for TSWV in this region, and a number of plant species serve as reproductive reservoirs for the vector or virus. Iris yellow spot virus (IYSV), an emerging tospovirus that is potentially a devastating pathogen of onion, has been reported in many locations in the western United States (2,4). Thrips tabaci is the known vector for IYSV, but it is unknown if noncrop plants play a role in its epidemiology in Georgia. During October 2003, a small (n = 12) sampling of onions with chlorosis and dieback of unknown etiology from the Vidalia region was screened for a variety of viruses, and TSWV and IYSV infections were serologically detected. Since that time, leaf and bulb tissues from 4,424 onion samples were screened for TSWV and IYSV using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) with commercial kits (Agdia Inc., Elkhart, IN). Samples were collected from 53 locations in the Vidalia region during the growing season between November 2003 and March 2004. Plants exhibiting stress, such as tip dieback, necrotic lesions, chlorosis or environmental damage were selected. Of these, 306 were positive for TSWV and 396 were positive for IYSV using positive threshold absorbance of three times the average plus two standard deviations of healthy negative onion controls. Positive serological findings of the onion tissues were verified by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) for TSWV (3) and RT-PCR for IYSV (1). In both instances, a region of the viral nucleocapsid (N) gene was amplified. The PCR products were analyzed with gel electrophoresis with an ethidium bromide stain in 0.8% agarose. Eighty-six percent (n = 263) of the TSWV ELISA-positive samples exhibited the expected 774-bp product and 55 percent (n = 217) of the IYSV ELISA-positive samples exhibited the expected 962-bp product. The reduced success of the IYSV verification could be attributed to the age and deteriorated condition of the samples at the time of amplification. Thrips tabaci were obtained from onion seedbeds and cull piles within the early sampling (n = 84) and screened for TSWV by the use of an indirect-ELISA to the nonstructural (NSs) protein of TSWV. Of the thrips sampled, 25 were positive in ELISA. While the incidence of IYSV and TSWV in the Vidalia onion crop has been documented, more research is needed to illuminate their potential danger to Vidalia onions. References: (1) I. Cortês et al. Phytopathology 88:1276, 1998. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) R. K. Jain et al. Plant Dis. 82:900, 1998. (4) J. W. Moyer et al. (Abstr.) Phytopathology 93(suppl.):S115, 2003.

First Report of a Leaf Blight of Onion Caused by Xanthomonas spp. in Georgia.

In October of 2001 and 2002, a leaf blight was reported affecting Vidalia onion (Allium cepa) cvs. Pegasus and Sweet Vidalia, respectively, in one field each. Lesions on onion seedlings began as a water-soaked, tip dieback that gradually blighted the entire leaf. Symptoms on onion transplants appeared as elongated, water-soaked lesions that typically collapsed at the point of initial infection. In both cases, disease was very severe on seedlings, and disease incidence was 50% or more in both fields. Warm temperatures combined with overhead irrigation and above average rainfall likely enhanced the severity and spread of disease. Disease was not detected on more mature onions once cool, dry conditions occurred later in the season, and no significant economic loss occurred. Seed was tested from seed lots of the aforementioned cultivars and Xanthomonas spp. were not found. Diseased tissue was macerated in sterile, phosphate-buffered saline, and 10 µl of the resulting suspension was streaked on nutrient agar plates. Yellow-pigmented, gram-negative, rod-shaped bacteria were isolated routinely from diseased tissue. Bacteria were catalase-positive, cellulolytic, oxidase-negative, amylolytic, proteolytic, and utilized glucose in an oxidative manner. Analysis of whole cell, fatty acid methyl esters (FAME) using the Microbial Identification System (MIS, Sherlock version 3.1; MIDI, Inc., Newark, DE) identified four representative strains of the bacterium as a pathovar of Xanthomonas axonopodis (similarity indices 0.75 to 0.83). Known Xanthomonas spp. from onion from Colorado and Texas (1,2) had similar FAME profiles when analyzed by the MIDI system. Onion plants were grown under greenhouse conditions for 2 months and inoculated by injecting the base of a quill with 1.0 ml of bacterial suspensions (1 × 107 CFU ml-1) of the Xanthomonas sp. isolated from Georgia, and negative controls were inoculated with 1 ml of sterile water. Disease symptoms developed on plants inoculated with bacterial suspensions in 4 to 7 days and Xanthomonas sp. was isolated from the lesions produced. Disease symptoms occurred when the same suspension was sprayed on onion foliage. No symptoms occurred on plants inoculated with 1 ml of sterile water. To our knowledge, this is the first report of Xanthomonas spp. affecting Vidalia onions. References: (1) T. Isakeit et al. Plant Dis. 84:201, 2000. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:922, 2000.

Allometric algorithms and the work of the heart.

In mammals, blood velocity at the aortic root varies little with body mass, M, and so the kinetic work is a constant fraction of the total work of the heart, and also of the metabolic rate of the animal. This happens because body metabolism and the cross-sectional area of the aortic root vary to the same power of M. But if metabolism increased with M to a higher power than area, aortic velocity would increase and kinetic work would become a greater fraction of total work in a large animal. In larger animals it could exceed pressure work at rest and even more so in exercise. But there is a limit to how much an increase in aortic area can balance an increase in metabolism without the aorta becoming ridiculously large. Also aortic area should not exceed ventricular area. These factors could dictate how high the power of M is in relation to the metabolism of an animal.

Bacterial Streak and Bulb Rot of Sweet Onion: II. Epiphytic Survival of Pseudomonas viridiflava in Association with Multiple Weed Hosts.

A semiselective agar medium (T-5) was used to sample environment and plant material as a habitat for Pseudomonas viridiflava. Soil, irrigation water, soybean foliage, and foliage from various weeds in an onion-growing area were assayed over a 5-year period. P. viridiflava was recovered only as an epiphytic resident from weed species that included cutleaf evening primrose, dandelion, common fumitory, purple cudweed, spiny sowthistle, Virginia pepperweed, and wild radish. The bacterium apparently overseasons in association with these weeds, because its presence was detected prior to, as well as during, the onion-growing season. Preliminary tests indicated that weed control may suppress bacterial streak and bulb rot levels.

Haldane and indifferent gases: O2 secretion or CO excretion?

The method that Haldane used in 1911, when he claimed that O2 comes to be secreted into the pulmonary capillary blood after a few days at altitude, required that CO be an indifferent gas except for one property: it combines with Hb. But that is now known not to be true. CO is formed when Hb is katabolised, it reacts with many substances in the body, and it is involved in transmissions between cells. If, instead of supposing that CO is an indifferent gas, one proceeds from Barcroft's observation that PaO2 remains equal to PAO2 on going to altitude, the conclusion from Haldane's observations must be that he showed that CO has come to be actively excreted from the body after a few days at altitude. And that presumably happened because, as Killick (J. Physiol., London, 107: 27-44, 1948) suggested, Haldane's method required that the subject be repeatedly exposed to CO. The transport of CO around the body by Hb, and the possible effects on this, and on DLCO, of active excretion of CO, have to be considered.

Alveolar Pco2 and Po2 of high-altitude natives living at sea level.

This study was designed to determine whether subjects born at high altitude (HA; 2,000 m or above) who subsequently move to near sea level (SL) develop end-tidal PCO2 (PETCO2) and PO2 (PETO2) values that equal those of SL natives living near SL. A total of 108 male HA natives living near SL were identified by survey of a district in Lima, Peru, and a further 108 male SL natives from the same district were identified as control subjects. Of these subjects, satisfactory data for inclusion in the study were obtained from 93 HA and 82 SL subjects. Mean PETCO2 and PETO2 values were 37.7 +/- 2.5 (SD) and 104.7 +/- 3.2 Torr, respectively, in HA subjects and 37.7 +/- 2.2 and 104.8 +/- 3.0 Torr, respectively, in SL subjects. The average difference between SL natives and HA natives for PETCO2 was 0.07 Torr (-0.64 to 0.78; 95% confidence interval) and for PETO2 was 0.05 Torr (-0.89 to 0.99, 95% confidence interval). The average age and weight of the SL and HA subjects did not differ, but the HA subjects were shorter and tended to have larger vital capacities, consistent with their origin at HA. We conclude that the PETCO2 and PETO2 near SL of SL natives and HA natives do not differ.

Effect of waveforms of inspired gas tension on the respiratory oscillations of carotid body discharge.

The responses of carotid body chemoreceptor discharge to repeated ramps (20- to 60-s forcing cycle durations) of inspired gas tensions were studied in spontaneously breathing and in artificially ventilated pentobarbitone-anesthetized cats. In all animals the mean intensity of chemoreceptor discharge followed the frequency of the forcing cycle, and superimposed on this were oscillations at the frequency of ventilation (breath-by-breath oscillations). The amplitude of the breath-by-breath oscillations in discharge was often large, and it waxed and waned with the forcing cycle. It was greatest when the mean level of discharge was falling and smallest near the peak of mean discharge. No qualitative differences were observed between PO2-alone forcing in constant normocapnia and PCO2-alone forcing in constant hypoxia. The variation in the amplitudes of breath-by-breath oscillations was shown to be due primarily to variations in the amplitudes of the downslope component of the discharge oscillation. Variations in the upslope component of individual oscillations were small. The factors responsible for the breath-by-breath oscillations are discussed, and it is concluded that the shape of the waveform of arterial gas tensions that stimulate the peripheral chemoreceptors departs markedly from that of a line joining end-tidal gas tensions. This causes breath-by-breath oscillations of discharge to be very large after an "off" stimulus. Reflex studies involving the forcing of respiratory gases should therefore include consideration of these effects.

Do oxygen tension variations contribute to the respiratory oscillations of chemoreceptor discharge in the cat?

1. A high-frequency high-flow ventilator has been developed which will produce abrupt changes in alveolar gas tensions. We have used it to study the individual contributions of PCO2 and PO2 in producing the oscillations which occur in the discharge of carotid chemoreceptors in the cat with respiration, by producing repeated end-tidal alternations (i) of PCO2 in constant hypoxia, (ii) of PO2 in constant normocapnia and (iii) of both PO2 and PCO2, i.e. of asphyxia. 2. The chemoreceptor response to alternations of PCO2 was always brisker than that to alternations of PO2 at 2, 4 or 8 s cycle durations. 3. An increase in the frequency of the alveolar alternation shortened the difference between the response times to PCO2 and PO2 but it increased the phase difference between the stimulus and the response waveforms. 4. With 4 s cycles, in normocapnic hypoxia, PCO2 was 2.9 times more effective (impulses s-1 Torr-1) than PO2 in producing oscillations in discharge. 5. The oscillations in discharge to simultaneous alternations of PO2 and PCO2 were not significantly different from the sum of individual oscillations to alternations of PCO2 and of PO2 alone. This was true with respect to timing and to amplitude of the oscillation. 6. Usually the amplitude of the chemoreceptor discharge oscillation in response to an asphyxial alternation was greater than the amplitude of the oscillation to either its PCO2 or its PO2 component alone. However, at the highest frequencies used, the phase relation between the PCO2 and PO2 components of the response could lead to the summed asphyxial response being less than its individual components. 7. The amplitudes and shapes of the oscillations in response to 4 s PCO2 alternations were not affected by changing either the steady-background PO2 or PCO2, but the amplitudes of the oscillations to pure PO2 alternations were enhanced by hypoxia and by hypercapnia. The importance of PO2 and PCO2 in giving rise to the natural respiratory oscillations in chemoreceptor discharge depends on the mean levels of the two gases. In normocapnic hypoxia (PO2 ca. 50 Torr) they are equally important but when PO2 is raised it becomes less important.

The effect on breathing of abruptly reducing the discharge of central chemoreceptors.

Tris, a powerful CO2 buffer, was injected through one vertebral artery directly at the central chemoreceptive region in bilaterally vagotomized pentobarbitone anaesthetized cats. This was intended to reduce central chemoreceptor drive abruptly. Injections in inspiration shortened that inspiration and prolonged the following expiration. Injections given early in expiration often prolonged that expiration and also the following inspiration, but most injections given in an expiration shortened that expiration and also shortened the following inspiration. Tidal volume (VT) was invariably reduced. A plot of VT against delay from an injection to the termination of inspiration shows that VT falls with a half time of about one second. The changes in the pattern of breathing were similar to those after abrupt removal of carotid body chemoreceptor discharge (Nye et al., 1981) though the latency to the first response of air flow was about 100 msec longer. These observations support the idea that peripheral and central chemoreceptors have similar connections with the respiratory centre.