Association between rs61764370, rs9266, and rs140080026 polymorphisms of the KRAS gene and breast cancer risk in a Mexican population.

OBJECTIVE: Polymorphisms of the KRAS gene have been shown to be associated with cancer. However, their association with breast cancer (BC) has been inconsistent. The purpose of this study was to determine the frequency with which the rs61764370, rs9266, and rs140080026 polymorphisms of the KRAS gene are associated with BC in patients of the Mexican population. PATIENTS AND METHODS: The rs61764370 A>C or T>G and rs140080026 A>G polymorphisms were determined by Polymerase Chain Reaction (PCR), and the rs9266 A>G polymorphism was determined by DNA sequencing of healthy Mexican subjects and BC patients. RESULTS: We observed that 78% of BC patients are overweight and/or obese, 57% have metastatic lymph nodes, 64% have luminal A/B cancer subtypes, and 61% have stage III-IV cancer. The rs61764370 polymorphism was associated with BC susceptibility when the BC patients and the control group were compared for the AC genotype (p = 0.020), AC vs. AA genotypes (heterozygous model: p = 0.016), AC/CC genotype (dominant model: p = 0.002), and the C allele (p = 0.007). The AC/CC genotype (p = 0.018; rs61764370) and AG/GG genotype (p = 0.005; rs9266) were associated with age in BC patients ≥50 years old. The AC/CC (rs61764370) and AG/GG (rs9266) genotypes were classified by molecular subtype, TNM stage, miscarriage, lymph node metastasis, ductal type, and Ki-67. These classifications were also associated with BC patients, indicating that these factors may significantly contribute to BC risk. The AAA (OR 0.65, 95% CI 0.43-0.98, p = 0.039) and CAA (OR 3.25, 95% CI 1.13-9.36, p = 0.021) haplotypes were also associated with BC susceptibility. In addition, 94 polymorphisms were identified on the 3'UTR of the KRAS gene GRCh 38/hg3 (25,209,490-25,209,122) in BC (n = 112) and control (n = 113) samples. However, 92 of these polymorphisms have only expressed the major allele (wild-type allele). CONCLUSIONS: The rs61764370 polymorphism in the KRAS gene was associated with BC susceptibility in the Mexican population. The dominant model of the rs61764370 and rs9266 polymorphisms (classified by molecular subtype, miscarriage, TNM stage, lymph node metastasis, and Ki-67) could significantly contribute to BC risk in patients ≥50 years. The CAA haplotype could significantly contribute to BC risk in the Mexican population analyzed.

Scaling Analysis of an Image Encryption Scheme Based on Chaotic Dynamical Systems.

Despite that many image encryption systems based on chaotic or hyperchaotic systems have been proposed to protect different kinds of information, it has been crucial to achieve as much security as possible in such systems. In this sense, we numerically implement a known image encryption system with some variants, making special emphasis when two operations are considered in the scrambling stage. The variants of such an encryption system are based on some hyperchaotic systems, which generated some substitution boxes and the keys of the system. With the aim to have a more complete evaluation, some internal stages of the image encryption scheme have been evaluated by using common statistical tests, and also the scaling behavior of the encrypted images has been calculated by means of a two-dimensional detrended fluctuation analysis (2D-DFA). Our results show that the image encryption systems that include two operations or transformations in the scrambling stage present a better performance than those encryption systems that consider just one operation. In fact, the 2D-DFA approach was more sensitive than some common statistical tests to determine more clearly the impact of multiple operations in the scrambling process, confirming that this scaling method can be used as a perceptual security metric, and it may contribute to having better image encryption systems.

The ERBB2 gene polymorphisms rs2643194, rs2934971, and rs1058808 are associated with increased risk of gastric cancer.

Gastric cancer (GC) is the third most lethal type of cancer worldwide. Single nucleotide polymorphisms (SNPs) in regulatory sites or coding regions can modify the expression of genes involved in gastric carcinogenesis, as ERBB2, which encodes for the tyrosine-kinase receptor HER-2. The aim of this work was to analyze the association of the polymorphisms: rs2643194, rs2517951, rs2643195, rs2934971, and rs1058808 with GC, as they have not yet been analyzed in GC patients, as well as to report their frequency in the general Mexican population (GMP). We studied genomic DNA from subjects with GC (n=74), gastric inflammatory diseases (GID, n=76 control subjects), and GMP (n=102). Genotypes were obtained by means of real-time PCR and DNA-sequencing. The risks for GC were estimated through odds ratio (OR) using the Cochran-Armitage trend test and multinomial logistic regression. Increased risk for GC was observed under the dominant inheritance model for the rs2643194 TT or CT genotypes with an OR of 2.75 (95%CI 1.12-6.75, P=0.023); the rs2934971 TT or GT genotypes with an OR of 2.41 (95%CI 1.01-5.76, P=0.043), and the rs1058808 GG or CG genotypes with an OR of 2.21 (95%CI 1.00-4.87, P=0.046). The SNPs rs2643194, rs2934971, and rs1058808 of the ERBB2 gene were associated with increased risk for GC.

The ERBB2 gene polymorphisms rs2643194, rs2934971, and rs1058808 are associated with increased risk of gastric cancer

Gastric cancer (GC) is the third most lethal type of cancer worldwide. Single nucleotide polymorphisms (SNPs) in regulatory sites or coding regions can modify the expression of genes involved in gastric carcinogenesis, as ERBB2, which encodes for the tyrosine-kinase receptor HER-2. The aim of this work was to analyze the association of the polymorphisms: rs2643194, rs2517951, rs2643195, rs2934971, and rs1058808 with GC, as they have not yet been analyzed in GC patients, as well as to report their frequency in the general Mexican population (GMP). We studied genomic DNA from subjects with GC (n=74), gastric inflammatory diseases (GID, n=76 control subjects), and GMP (n=102). Genotypes were obtained by means of real-time PCR and DNA-sequencing. The risks for GC were estimated through odds ratio (OR) using the Cochran-Armitage trend test and multinomial logistic regression. Increased risk for GC was observed under the dominant inheritance model for the rs2643194 TT or CT genotypes with an OR of 2.75 (95%CI 1.12−6.75, P=0.023); the rs2934971 TT or GT genotypes with an OR of 2.41 (95%CI 1.01−5.76, P=0.043), and the rs1058808 GG or CG genotypes with an OR of 2.21 (95%CI 1.00−4.87, P=0.046). The SNPs rs2643194, rs2934971, and rs1058808 of the ERBB2 gene were associated with increased risk for GC.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Determination of SCN1A genetic variants in Mexican patients with refractory epilepsy and Dravet syndrome.

Mutations in the SCN1A gene can result in syndromes associated with epilepsy, including the Dravet syndrome (DS). However, the prevalence of such mutations in these diseases varies widely between different studies, and has not been examined in Mexican patients with epilepsy. Therefore, the objective of this study was to determine the frequency of SCN1A mutations (in the exon 26) in a cohort of Mexican patients with DS and refractory epilepsy (RE). We recruited 24 Mexican patients (14 males and 10 females), of which 15 were diagnosed with RE and 9 were diagnosed with DS. The SCN1A gene was sequenced to uncover mutations in exon 26. We detected 2 novel genotypes in 2 DS patients. One was a synonymous variant, c.5418 G > A (E1806E), and the other was a missense variant, c. 5324 T > C (L1775P). The missense mutation was predicted to be damaging with a score of 100% by the PolyPhen-2 program. The frequency of pathogenic variants was 4.17% in all the patients and 11.1% in DS patients, which, together with other publications, emphasize that specific and more severe phenotypes are associated with SCN1A mutations.

Association between the CDH1-472delA and -160C>A polymorphisms and diffuse and intestinal gastric cancer in a Mexican population.

Gastric cancer (GC), the third leading cause of cancer-related deaths in Mexico and worldwide, can be classified into diffuse (DGC) or intestinal (IGC) types based on its histological characteristics. DGC is characterized by reduced expression of the cell adhesion protein E-cadherin, which is encoded by CDH1. The -472delA (rs5030625) and -160C>A (rs16260) polymorphisms in CDH1 induce a decrease in gene transcription; in fact, these mutated alleles have been associated with GC in some populations, with conflicting results. The aim of this study was to determine the association between the CDH1 -472delA and -160C>A polymorphisms and DGC and IGC in Mexican patients. The study was conducted in 24, 23, 48, and 93 individuals with DGC and IGC, without GC (control), and belonging to the general Mexican population (GMP), respectively. The genotypes were obtained by polymerase chain reaction - restriction fragment length polymorphism and the obtained data analyzed using Arlequin 3.1. The frequencies of the mutated allele (A) of -472delA were 0.326, 0.318, 0.284, and 0.296 in the DGC, IGC, control, and GMP groups, respectively, and those of the -160C>A polymorphism were 0.174, 0.318, 0.313, and 0.280, respectively. The genotype and allele frequencies of the two polymorphisms did not differ significantly (P > 0.05) among DGC, IGC, and control subjects. Therefore, we concluded that the CDH1 -472delA and -160C>A polymorphisms are not associated with DGC or IGC in patients from western Mexico.

Dup-24 bp in the CHIT1 Gene in Six Mexican Amerindian Populations.

Chitotriosidase (CHIT, EC 3.2.1.14) is an enzyme secreted by activated macrophages with the ability to hydrolyze the chitin of pathogens. The high activity of this enzyme has been used as a secondary biomarker of response to treatment in patients with Gaucher disease (OMIM 230800). Within the world's population, approximately 6% is homozygous and 35% is heterozygous for the most common polymorphism in the CHIT1 gene, a 24-bp duplication (dup-24 bp), with homozygosity of this duplication causing inactivation of the enzyme but without major consequences for health. To determine the frequency of the dup-24 bp CHIT1 gene in indigenous populations from Mexico, 692 samples were analyzed: Purepecha (49), Tarahumara (97), Huichol (97), Mayan (139), Tenek (97), and Nahua (213). We found that the groups were in Hardy-Weinberg equilibrium. The dup-24 bp allele frequency was found to be (in order of highest to lowest) 37% (Mayan), 34% (Huichol and Nahua), 33% (Purepecha), 31% (Tenek), and 29% (Tarahumara).

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population.

Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein with tyrosine-kinase activity that plays an important role in multiple cellular functions. EGFR overexpression has been observed in several types of tumors and it is significantly associated with disease stage, survival, prognosis, and progression of cancer. The polymorphisms -216G>T, -191C>A, and (CA)n first intervening sequence (IVS1) have been related to EGFR overexpression and have been studied in several types of cancer, but not in gastric cancer (GC). The aim of this study was to determine the association of these 3 polymorphisms and GC. Genomic DNA from 68 GC patients and 102 healthy blood donors were analyzed. Polymorphisms were identified by DNA-sequencing (-216G>T and -191C>A) and GeneScan (CA)n IVS1. The results showed that the distribution of the -216G>T and -191C>A genotypes differed between groups (P < 0.05). The odds ratio for the -216TT genotype was 4.59 (95% confidence interval = 1.55-13.54, P < 0.05) and 10.71 (95% confidence interval = 2.31-49.59, P < 0.05) for the -191AA genotype, both in a recessive model. The genotype and allele distributions of the (CA)n IVS1 repeat was similar in both groups. In conclusion, the -216TT and -191AA genotypes and GA haplotype of the EGFR gene were found to be associated with an increased risk of gastric cancer in a Mexican population.

5' and 3' ß-globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups.

OBJECTIVE: The purpose of this study was to determine the ß-globin cluster haplotype variability of two Mexican indigenous groups-Purepechas (PUR) and Tarahumaras (TAR)-and their relationship with other world populations. METHODS: The 5' and 3' haplotypes (Hp) of the ß globin cluster in 71 PUR and 53 TAR individuals were analyzed. Five polymorphisms in the 5'Hp (ε, (G) γ, (A) γ, 5'ψß and 3'ψß) and five in the 3'Hp (IVS2: 16, 46, 74, 81 and 3' end +339) were identified by restriction enzymes and direct DNA sequencing. 5'Hp and 3'Hp frequencies in PUR and TAR were compared with reported frequencies from 47 and 10 worldwide populations, respectively. RESULTS: Sixteen different 5'Hps were observed in the indigenous Mexican groups, 11 in each population, with the most common being 5'Hp 1. Eight 3'Hps were detected, seven in PUR and six in TAR, the most frequent being 3'Hp C. Three new 3'Hps were found, A8 (CTGCT) in both populations, C9 (GTGCA) in TAR and E1 (GTTCT) in PUR. The comparative analysis showed that 5'Hp frequencies in PUR were significantly different than those in all populations except the Brazilian-Guarani, while TAR were significantly similar to Aché and North Han Chinese. 3'Hp frequencies were similar between PUR and TAR, as well as with Nuu-Chah-Nulth, Mongolian and Sumatran populations. CONCLUSIONS: The 5'Hp analysis showed great variability in worldwide populations, including PUR and TAR, while 3'Hp frequencies were similar among indigenous Mexican and other populations with Asiatic origins. This suggests that 5'Hp exposes the microevolutionary process of each population and the 3'Hp establishes genetic relationships among populations.

Gaining insight in the behaviour of imidazolium-based ionic liquids as additives in reversed-phase liquid chromatography for the analysis of basic compounds.

In reversed-phase liquid chromatography in the absence of additives, cationic basic compounds give rise to broad and asymmetrical peaks as a result of ionic interactions with residual free silanols on silica-based stationary phases. Ionic liquids (ILs), added to the mobile phase, have been suggested as alternatives to amines to block the activity of silanols. However, the dual character of ILs should be considered: both cation and anion may be adsorbed on the stationary phase, thereby creating a double asymmetrical layer positively or negatively charged, depending on the relative adsorption of both ions. In this work, a study of the performance of six imidazolium-based ILs (the chlorides and tetrafluoroborates of 1-ethyl-, 1-butyl- and 1-hexyl-3-methylimidazolium) as modifiers of the chromatographic behaviour of a group of 10 ß-blockers is performed, and compared with triethylamine and dimethyloctylamine. In order to gain more insight in the behaviour of ILs in RPLC, the changes in the nature of the chromatographic system, at increasing concentration of the additives, were followed based on retention and peak shape modelling. The multiple interactions that amines and ILs experience inside the chromatographic system suggest that the suppressing potency should be measured based on the shape of chromatographic peaks and not on the changes in retention. The ILs 1-hexyl-3-methyl-imidazolium chloride and tetrafluoroborate offered the most interesting features for the separation of the basic drugs.

Meningococcal carriage prevalence in university students, 1824 years of age in Santiago, Chile.

INTRODUCTION: Neisseria meningitidis invasive disease is a major public health problem. Pharyngeal carriage is considered a prerequisite for invasive infection. Prevalence reaches 10% in general population and up to 30% in the 20-24 years age group. The aim of this study was to asses pharyngeal carriage prevalence in healthy subjects aged 18-24 years, and as secondary endpoints evaluate known risk factors, to identify serogroups and sequence in the isolated strains. METHODS: Cross-sectional study in 500 healthy subjects; students from Universidad de Chile aged 18-24 years, Santiago, Chile, October 2012. Each subject underwent a risk factor survey prior to throat culture sampling. Samples were processed in one central Microbiology Laboratory of Hospital Luis Calvo Mackenna and serogrouping and sequencing was performed at Instituto de Salud Pública de Chile. RESULTS: We obtained throat samples from 500 healthy subjects, 20 (4%) positive for N. meningitidis. Of positive strains 20% were serogroup B, 15% W and the rest non groupable. The median age was 20 years, 50% were men. Of the risk factors evaluated, 24% were current smokers, 16% shared a room, 72% had kissed someone during the last month, 64% had gone to pub and 76% had consumed alcohol in the same period of time. DISCUSSION: Literatures meningococcal carriage prevalence reaches up to 30% in people aged 18-24 years. Prevalence in our study was 4%. Different interpretations could be given; one could be the absence of overcrowding in our students because of the lack of dorms in our scholar system and also the characteristics of our enrolled group. CONCLUSIONS: Our results suggest the necessity to extend the study to other age groups and to other cities, to better understand the Chilean reality, as well as others regions of America, considering that these results cannot be extrapolated to another countries.

Sexual behavior of castrated boars treated with prostaglandin F(2alpha).

The objectives were to test the hypothesis that exogenous prostaglandin F(2alpha) (PGF(2alpha)) temporarily restores sexual behavior of castrated boars, and to evaluate effects of PGF(2alpha) on serum hormone concentrations. At 35 d after castration, nine lean-type adult boars were randomly assigned to three treatments in a 3x3 latin square (with three replicates). Treatments were three doses of PGF(2alpha) doses (0, 10, and 20mg) and three periods of treatment, with 5 d between each period. Serum testosterone (T) concentrations were non-detectable at the start of the experiment. Serum concentrations of estradiol (E2), LH, prolactin (PRL), and cortisol were unaffected (P>0.05) by PGF(2alpha) treatment. The interval from treatment to ejaculation in boars treated with 10mg (758s) or 20mg (660s) PGF(2alpha) did not differ, but were different (P < 0.05) from control boars (>1 800s). Ejaculation duration and false mounts differed (P < 0.05) between control boars and boars treated with 10 or 20mg PGF(2alpha). In conclusion, PGF(2alpha) treatment did not change serum concentrations of T, E2, LH, PRL, or cortisol, but restored sexual behavior. This restoration may have been due to an effect of PGF(2alpha) directly in specific areas of the brain, or indirectly via release of other hormones that stimulated areas in the brain that affected sexual behavior.

Desarrollo de una guía de atención a los familiares del paciente crítico / Development of an attention guideline for the critical patient's family

IntroducciónEn el contexto de un proyecto de investigación-acción participativa (IAP) en una unidad de cuidados intensivos (UCI), se consensuaron 4 propuestas de cambio para mejorar los cuidados a los familiares del paciente crítico. Una de ellas fue la elaboración de una guía de cuidados a los familiares, derivada de la voluntad de los participantes de mejorar la atención a este grupo de usuarios.Objetivos1) Diseñar una guía de atención adaptada a las necesidades de profesionales y usuarios. 2) Establecer un acuerdo de mínimos en la atención a los familiares.Material y métodosMetodología cualitativa, diseño IAP. Para cada una de las iniciativas se creó un grupo de trabajo integrado mayoritariamente por profesionales de la UCI y coordinado por un investigador. En el caso de la guía se creó, además, una comunidad virtual como herramienta de trabajo para agilizar la comunicación entre los participantes, disminuyendo las reuniones presenciales. La participación fue voluntaria. Para su elaboración se dispuso de una guía de práctica clínica traducida al castellano y una revisión bibliográfica actualizada.ResultadosSe han implicado 24 profesionales. Desarrollamos una guía con los siguientes apartados: introducción, objetivos, experiencias y necesidades de los familiares en UCI, estrategias de actuación, procedimientos específicos y recursos del hospital. Diseñamos las estrategias para su difusión e implantación.ConclusionesLa guía es una herramienta útil para dar seguridad al profesional y unificar criterios de actuación. Las siguientes fases del proyecto de IAP evaluarán el impacto en profesionales y usuarios(AU)

IntroductionWithin the context of participatory action research (PAR) at an Intensive Care Unit (ICU), 4 proposals for change were agreed by consensus to improve the attention given to families of critical patients. One proposal was the creation of a guideline for attending to family members, inspired by the participants’ desire to improve the attention given to this group of users.Objectives1) To design a guide that would meet the needs of professionals and users. 2) To reach an agreement on the minimum requirements for attention given to families of critical patients.Materials and methodsQualitative methodology, based on PAR. For each of the initiatives, a working group was created, composed mainly of professionals from the ICU coordinated by a researcher. In the case of the guide, an online community was also created as a working tool to speed up communications among the participants, reducing the number of face-to-face sessions. Participation was voluntary. To draft the guideline, a Clinical Practice Guideline for support the family was made available, which had been translated into Spanish, together with an up-to-date bibliography.ResultsTwenty four professionals were involved. We developed a guide that contained the following sections: introduction, objectives, the experiences and needs of families of patients in the ICU, strategies for action, specific procedures, and hospital resources. We designed strategies for the diffusion and implementation of the guide.ConclusionsThe guide is a useful tool that offers the professionals greater assurances and unifying criteria for action. During subsequent stages of the PAR project, an assessment will be made of the impact on professionals and users(AU)

[Development of an attention guideline for the critical patient's family]. / Desarrollo de una guía de atención a los familiares del paciente crítico.

INTRODUCTION: Within the context of participatory action research (PAR) at an Intensive Care Unit (ICU), 4 proposals for change were agreed by consensus to improve the attention given to families of critical patients. One proposal was the creation of a guideline for attending to family members, inspired by the participants' desire to improve the attention given to this group of users. OBJECTIVES: 1) To design a guide that would meet the needs of professionals and users. 2) To reach an agreement on the minimum requirements for attention given to families of critical patients. MATERIALS AND METHODS: Qualitative methodology, based on PAR. For each of the initiatives, a working group was created, composed mainly of professionals from the ICU coordinated by a researcher. In the case of the guide, an online community was also created as a working tool to speed up communications among the participants, reducing the number of face-to-face sessions. Participation was voluntary. To draft the guideline, a Clinical Practice Guideline for support the family was made available, which had been translated into Spanish, together with an up-to-date bibliography. RESULTS: Twenty four professionals were involved. We developed a guide that contained the following sections: introduction, objectives, the experiences and needs of families of patients in the ICU, strategies for action, specific procedures, and hospital resources. We designed strategies for the diffusion and implementation of the guide. CONCLUSIONS: The guide is a useful tool that offers the professionals greater assurances and unifying criteria for action. During subsequent stages of the PAR project, an assessment will be made of the impact on professionals and users.

Ovarian follicular dynamics after cauterization of the dominant follicle in anestrous ewes.

An experiment was conducted to ascertain if follicles could reach ovulatory size after the largest follicle (dominant) has been removed at different times during a progestin treatment in anestrous ewes, and secondly to determine if these new follicles could respond to an hCG-induced ovulation and have similar function as corpora lutea. Mature crossbred sheep (n=44) in anestrous were treated with an intravaginal sponge containing 40 mg of FGA (day 0=sponge insertion) for 9 days. Treatments consisted of cauterization of the largest follicle on the experimental day 3 (T1), day 6 (T2) and day 9 (T3); day 12 to ascertain the size of the largest follicle in control ewes. During laparotomies, the diameters of the largest follicle (DF), and those of the second and third largest follicles (SF1 and SF2, respectively) were determined. On day 12, a second laparotomy was performed for those ewes which had their DF cauterized on days 3, 6 and 9, a fourth group was left intact and only laparotomized on day 12. At this time, the size of the new DF, SF1 and SF2 were determined. Immediately after the laparotomy on day 12, all the ewes were treated with 1000 i.u. of hCG to induce ovulation. Blood samples were collected daily from day 0 to 50 and samples were analyzed for progesterone concentrations. The size of the DF at the time of sponge removal was smaller that those observed on day 3 or 6 of sponge suggesting that follicles in ewes treated with this progestin regress and a new wave of follicular development ensues between day 6 and the time of sponge removal. The size of the DF on day 12 was also smaller in ewes that have the largest follicle removed at the time of sponge removal reflecting that these follicles had a shorter period of growth; however, the rate of growth was greater for these follicles than for follicles arising after cauterization on day 3 or 6 after sponge insertion. There were no differences among treatments, in the number of ewes that formed a corpus luteum (CL) in response to hCG. Life span of the corpora lutea did not differ among ewes having their DF removed on day 6 or 9 or those that served as controls, however, ewes that had their DF removed on day 3 developed longer lived CL in a larger proportion of animals. Average progesterone concentration during the life span of the induced corpora lutea was greater in control ewes than in any other experimental group. These observations allow us to conclude that, (a) the follicular dynamics observed in anestrous ewes treated with a progestin intravaginal sponge resembles that observed during the normal estrous cycle in the ewe; (b) the effects of progesterone on life span of the corpus luteum could not be only related to direct effects at the follicle but also involve changes in other components of the uterine-ovarian-hypothalamic axis; (c) the mechanisms controlling luteal life span seem to be different to those mechanisms controlling the function of the induced corpus luteum.

Taquicardia nodal automática: signo de alarma detoxicidad digitálica grave / Nodal automatic tachycardia: warning sign of posible severe digital toxicity

No disponible

[Non-compliance of the treatment with antibiotics in non-severe acute infections]. / Incumplimiento del tratamiento con antibióticos en infecciones agudas no graves.

BACKGROUND: To determine the nonfulfillment of antiinfectious therapy in clinical practice. MATERIAL AND METHODS: Fulfillment was quantified by tablet counting (TC) in the homes of 366 patients undergoing antibiotic treatment and the motives and predictive factors were identified. RESULTS: Nonfulfillment was of 61% (95% confidence interval [CI] 55.4-66.6%). Patient improvement was the main reason for discontinuation (54.5%). The predictive factors were greater length of treatment (p = 0.000004), dose (p = 0.0019) and number of tablets (p = 0.0000). CONCLUSIONS: Nonfulfillment of antiinfectious treatment in clinical practice is high, mainly due to clinical improvement and to the greater complexity and length of treatment.