Growth recovery lines in children: A comparison between psychosocial short stature and other pathological causes of short stature.

BACKGROUND: Psychosocial short stature (PSS) is a rare disorder associated with emotional deprivation. Growth recovery lines (GRLs), the radiodense bands in metaphyseal bones, are indicators of stress. OBJECTIVE: To evaluate the efficacy of using GRLs in the distal radius to identify PSS. PARTICIPANTS AND SETTING: This retrospective cohort study included children 15-138 months of age with short stature whose hands and wrists were radiographed between 2011 and 2020 at Matsuyama Red Cross Hospital in Japan. METHODS: PSS was determined if a child with short stature had been reported to be abused or neglected. Other pathological short statures were diagnosed per the established criteria. GRLs, height velocity before and after specific treatment, insulin-like growth factor 1, and the difference between chronological and skeletal age were assessed. RESULTS: The PSS and other short stature groups comprised of 7 and 11 children, respectively. The body mass index of the PSS group was smaller than that of other short stature group (-1.15 standard deviation [SD] vs. 0.57 SD, P = 0.003). The PSS group had significantly more GRLs than the other group (5.3 vs. 0.5, P = 0.011). Height velocity before treatment in the PSS group was significantly lower (-5.46 SD vs. -1.86 SD, P = 0.005), with no significant differences in other variables. The specificity for PSS was >90% when children with short stature had at least three GRLs in both distal radii. CONCLUSIONS: Abuse or neglect should be considered in children with short stature having multiple GRLs in the distal radius.

The Relation between Hepatotoxicity and the Total Coumarin Intake from Traditional Japanese Medicines Containing Cinnamon Bark.

Cinnamon bark is commonly used in traditional Japanese herbal medicines (Kampo medicines). The coumarin contained in cinnamon is known to be hepatotoxic, and a tolerable daily intake (TDI) of 0.1 mg/kg/day, has been quantified and used in Europe to insure safety. Risk assessments for hepatotoxicity by the cinnamon contained in foods have been reported. However, no such assessment of cinnamon bark has been reported and the coumarin content of Kampo medicines derived from cinnamon bark is not yet known. To assess the risk for hepatotoxicity by Kampo medicines, we evaluated the daily coumarin intake of patients who were prescribed Kampo medicines and investigated the relation between hepatotoxicity and the coumarin intake. The clinical data of 129 outpatients (18 male and 111 female, median age 58 years) who had been prescribed keishibukuryogankayokuinin (TJ-125) between April 2008 and March 2013 was retrospectively investigated. Concurrent Kampo medicines and liver function were also surveyed. In addition to TJ-125, the patients took some of the other 32 Kampo preparations and 22 decoctions that include cinnamon bark. The coumarin content of these Kampo medicines was determined by high performance liquid chromatography (HPLC). TJ-125 had the highest daily content of coumarin (5.63 mg/day), calculated from the daily cinnamon bark dosage reported in the information leaflet inserted in each package of Kampo medicine. The coumarin content in 1g cinnamon bark decoction was 3.0 mg. The daily coumarin intake of the patients was 0.113 (0.049-0.541) mg/kg/day, with 98 patients (76.0%) exceeding the TDI. Twenty-three patients had an abnormal change in liver function test value, but no significant difference was found in the incidence of abnormal change between the group consuming less than the TDI value (6/31, 19.4%) and the group consuming equal to or greater than the TDI value (17/98, 17.3%). In addition, no abnormal change related to cinnamon bark was found for individual patients. This paper was done to assess the risk of hepatotoxicity by the coumarin contained in Kampo medicines and to clarify whether or not the Kampo preparations in general use that contain cinnamon bark may be safely used in clinical practice.

Sustained phosphorylation of mutated FGFR3 is a crucial feature of genetic dwarfism and induces apoptosis in the ATDC5 chondrogenic cell line via PLCgamma-activated STAT1.

The most frequent type of rhizomelic dwarfism, achondroplasia (ACH), is caused by mutations in the fibroblast growth factor receptor 3 (FGFR3) gene. Mutations in FGFR3 result in skeletal dysplasias of variable severity, including mild phenotypic effects in hypochondroplasia (HCH), severe phenotypic effects in thanatophoric dysplasia types I (TDI) and II (TDII), and severe but survivable phenotypic effects in severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN). To explore the molecular mechanisms that result in the different phenotypes, we investigated the kinetics of mutated versions of FGFR3. First, we assayed the phosphorylation states of the mutated FGFR3s and found that the level of phosphorylation in TDI-FGFR3 was lower than in ACH-FGFR3, although the other mutants were phosphorylated according to phenotypic severity. Second, we analyzed the duration of the phosphorylation. TDI-FGFR3 was not highly phosphorylated under ligand-free conditions, but the peak phosphorylation levels of TDI-FGFR3 and ACH-FGFR3 were maintained for 30 min after stimulation with FGF-1. Moreover, ligand-dependent phosphorylation of TDI-FGFR3, but not ACH-FGFR3, lasted for more than 8 h after FGF-1 administration. The other mutant proteins showed sustained phosphorylation independent of ligand presence. Third, we investigated the intracellular localization of the mutant proteins. Immunofluorescence analysis showed accumulations of TDII-FGFR3, SADDAN-FGFR3, and a portion of TDI-FGFR3 in the endoplasmic reticulum (ER). Based on these data, we concluded that sustained phosphorylation of FGFR3 causes chondrodysplasia, and the phenotypic severity depends on the proportion of ER-localized mutant FGFR3. In FGFR3 signaling, the transcription factor, signal transducer and activator of transcription 1 (STAT1) inhibit proliferation and induce apoptosis of chondrocytes. Here we reveal that phospholipase C gamma (PLCgamma) mediates FGFR3-induced STAT1 activation. Both PLCgamma and STAT1 were activated by FGFR3 signaling, but a dominant-negative form of PLCgamma (DN-PLCgamma) remarkably reduced STAT1 phosphorylation. Apoptosis assays revealed that the constitutively active forms of FGFR3 (TDII-FGFR3) and STAT1 (STAT1-C) induce apoptosis of chondrogenic ATDC5 cells via caspase activity. DN-PLCgamma reduced the apoptosis of ATDC5 cells expressing TDII-FGFR3, but over-expression of both DN-PLCgamma and STAT1-C induced apoptosis. Therefore, we conclude that a PLCgamma-STAT1 pathway mediates apoptotic signaling by FGFR3.

PTH has the potential to rescue disturbed bone growth in achondroplasia.

INTRODUCTION: Achondroplasia (Ach), the most common form of short-limb short stature, and related disorders are caused by constitutively active point mutations in the fibroblast growth factor receptor 3 (FGFR3) gene. Recent studies have provided a large body of evidence for the role of the proliferation and differentiation of chondrocytes in these disorders. Furthermore, a G380R mutation in FGFR3 (FGFR3(Ach)), which results in achondroplasia, induces apoptosis in the chondrogenic cell line ATDC5. This is associated with a decrease in the expression of PTHrP, which shares the same receptor with PTH, and it is significant that PTHrP rescues these cells from apoptosis. METHODS: Fetuses derived from transgenic mice expressing FGFR3(Ach) under the control of the type II collagen promoter (AchTG) or from wild-type mice were obtained on the 15th day of pregnancy. The femurs were collected from these specimens and cultured for 4 days with PTH. The effects of PTH treatment were then determined by morphometric and histological analyses, in situ hybridization of type X collagen mRNA, and the TUNEL assay. RESULTS: AchTG femurs showed suppressed growth compared with wild type (0.29+/-0.10 mm vs. 0.46+/-0.06 mm, respectively; p<0.05), particularly in cartilage. PTH treatments improved the growth velocity in the femurs of the AchTG (0.50+/-0.06 mm; p<0.01 vs. control). This was associated with the inhibition of both differentiation and apoptosis in chondrocytes. CONCLUSIONS: Our data suggest that PTH inhibits differentiation and apoptosis in chondrocytes and improves bone growth. These effects thus counterbalance the effects of FGFR3 mutations. PTH therefore is a potential therapeutic agent for achondroplasia.

An effective case of growth hormone treatment on cartilage-hair hypoplasia.

Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far. Growth hormone (GH) action has its effect on linear growth and on bone remodeling and homeostasis. Recently, GH has been used to improve severe short stature caused by not only GH deficiency (GHD) but also some skeletal dysplasias including achondroplasia. To improve severe short stature, we treated the patient with 0.175 mg kg-1 week-1 of GH for 7 years. His height was improved from -4.2 SD to -3.0 SD by 1 year of GH treatment. Following treatment had given positive effects continuously on his height to -2.6 SD by 3.1 years GH medication. Then, when he was 6 years old, surgical lengthening was performed and his height reached to -2.0 SD. After the surgery, we continued GH treatment. Additional GH treatment of 3.6 more years had kept his height to -2.0 SD. However, when he was 8 years old, because there was an interruption of GH treatment, the velocity of his height was obviously decreased comparing before and during the interruption, which was calculated 3.4 and 2.2 cm/year, respectively, and the SD score was decreased to -2.1 SD. This result of total 7 years of GH treatment suggested that GH treatment significantly improved his disturbed bone growth and had also positive efficacy to keep growth rate. This result implies the connection between GH signal and RMRP gene. Additionally, GH may be considered to be an efficient treatment for CHH.

Molecular basis for the treatment of achondroplasia.

Achondroplasia (ACH), the most common form of short-limbed dwarfism, and its related disorders are caused by constitutively activated point-mutated fibroblast growth factor receptor 3 (FGFR3). Recent studies have provided a large body of evidence to prove chondrocyte proliferation and differentiation in these disorders. However, little is known about the possible effects of the FGFR3 mutants on apoptosis of chondrocytes. In the present study, we analyzed apoptosis using a chondrogenic cell line, ATDC5, expressing the FGFR3 mutants causing ACH and thanatophoric dysplasia, which is a more severe neonatal lethal form comprising type I and type II. We found that the introduction of these mutated FGFR3s into ATDC5 cells decreased mRNA expression of parathyroid hormone-related peptide (PTHrP) and induced apoptosis. Importantly, replacement of PTHrP prevented the apoptotic changes in ATDC5 cells expressing ACH mutant. Insulin-like growth factor (IGF)-I, which is an important mediator of growth hormone (GH), also reduced apoptosis in ATDC5 cells expressing ACH mutant. IGF-I prevented apoptosis through the phosphatidylinositol 3-kinase and mitogen-activated protein kinase pathways, indicating the mechanisms by which GH treatment improves disturbed bone growth in ACH.