Predictive parameters for spontaneous joint bleeding during emicizumab prophylaxis.

Emicizumab is approved for prophylaxis of patients with hemophilia A (HA). Despite its efficacy in reducing bleeding, a few patients on emicizumab still experience hemarthrosis, but no tool is yet available to identify those at higher risk of spontaneous joint bleeding. To evaluate whether laboratory measurements (global coagulation assays and emicizumab concentration) and/or arthropathy scores can distinguish patients at higher risk of spontaneous joint bleeding while on emicizumab prophylaxis. Thrombin generation assay (TGA) was assessed upon the addition of tissue factor and synthetic phospholipids. Non-activated thromboelastography (NATEM) was performed in citrated whole blood. Emicizumab concentrations were measured with a modified one-stage FVIII assay. The degree of hemophilic arthropathy was assessed with the Haemophilia Joint Health Score (HJHS) and Hemophilia Early Arthropathy Detection with Ultrasound score (HEAD-US). A Cox proportional hazards model was used to evaluate the association between variables and bleeding. The predictive power of these variables was investigated by ROC analysis. Forty HA patients with and without inhibitors on emicizumab prophylaxis were enrolled in an observational cohort study. Ten of 40 developed spontaneous joint bleeding. None of the lab parameters were able to distinguish patients at higher risk of spontaneous joint bleeding. ROC analysis showed that during emicizumab prophylaxis only the presence of synovitis and a higher HEAD-US score were associated with spontaneous joint bleeding (AUC 0.84). A greater degree of arthropathy and the presence of synovitis could help to predict the risk of spontaneous joint bleeding in HA patients on emicizumab prophylaxis.

Performance of a clinical risk prediction model for inhibitor formation in severe haemophilia A.

BACKGROUND: There is a need to identify patients with haemophilia who have a very low or high risk of developing inhibitors. These patients could be candidates for personalized treatment strategies. AIMS: The aim of this study was to externally validate a previously published prediction model for inhibitor development and to develop a new prediction model that incorporates novel predictors. METHODS: The population consisted of 251 previously untreated or minimally treated patients with severe haemophilia A enrolled in the SIPPET study. The outcome was inhibitor formation. Model discrimination was measured using the C-statistic, and model calibration was assessed with a calibration plot. The new model was internally validated using bootstrap resampling. RESULTS: Firstly, the previously published prediction model was validated. It consisted of three variables: family history of inhibitor development, F8 gene mutation and intensity of first treatment with factor VIII (FVIII). The C-statistic was 0.53 (95% CI: 0.46-0.60), and calibration was limited. Furthermore, a new prediction model was developed that consisted of four predictors: F8 gene mutation, intensity of first treatment with FVIII, the presence of factor VIII non-neutralizing antibodies before treatment initiation and lastly FVIII product type (recombinant vs. plasma-derived). The C-statistic was 0.66 (95 CI: 0.57-0.75), and calibration was moderate. Using a model cut-off point of 10%, positive- and negative predictive values were 0.22 and 0.95, respectively. CONCLUSION: Performance of all prediction models was limited. However, the new model with all predictors may be useful for identifying a small number of patients with a low risk of inhibitor formation.

Anti-TNF-α Treatment Reduces the Baseline Procoagulant Imbalance of Patients With Inflammatory Bowel Diseases.

BACKGROUND: Inflammatory bowel diseases (IBD) are characterized by an increased thrombosis risk of uncertain etiology. Coagulation derangement arising from inflammation may be a triggering factor. We hypothesized that strong inflammation inhibitors (eg, anti-tumor necrosis factor-α drugs) may affect coagulation. METHODS: Forty patients with IBD were compared with 57 control patients for coagulation factors and endogenous thrombin potential (ETP), the latter being the most sensitive marker of in vivo pro- and anticoagulation balance. We measured ETP in the presence and absence of thrombomodulin (the physiologic protein C [PC] activator). Coagulation at different timepoints was also assessed for 28 of these patients during infliximab treatment. RESULTS: The median ETP (nM thrombin × minutes) and range (minimum-maximum) were each higher in patients at baseline than in control patients in both the absence (2120 [1611-3041] vs 1865 [1270-2337]) and the presence (1453 [464-2522] vs 831 [104-1741]) of thrombomodulin. The ETP ratio (with/without thrombomodulin) was high at baseline (0.73 [0.21-0.90] vs 0.45 [0.07-0.85]). The ETP and ETP ratio declined during treatment and were significantly lower at the end than at baseline. Factor (F) VIII and fibrinogen, which were high at baseline, decreased during treatment and at the end were significantly lower than at baseline. The FVIII/PC ratio, which was high in patients at baseline, declined during treatment and at the end was lower than at baseline. C-reactive protein recorded at the end of treatment was lower than at baseline. CONCLUSIONS: Patients with IBD have a procoagulant imbalance as shown by increased ETP at baseline. The ETP decreases during treatment with infliximab, which is related to decreased FVIII and FVIII/PC ratio. This effect is also related to the improvement of inflammation as shown by decreased fibrinogen and C-reactive protein.

Characterization of the neutralizing anti-emicizumab antibody in a patient with hemophilia A and inhibitor.

BACKGROUND: The genetically engineered, humanized, bispecific monoclonal antibody emicizumab (Hemlibra) that mimics the cofactor activity of activated factor VIII (FVIII) has been approved for treatment of hemophilia A patients with and without inhibitor. In the pivotal premarketing clinical trials, emicizumab prophylaxis significantly reduced bleeding rates compared with previous treatments and was well tolerated. However, a consequence of this novel therapy may be the host immune response to a foreign protein. OBJECTIVE: Characterization of the neutralizing anti-emicizumab antibody associated with the loss of treatment efficacy. PATIENT: A pediatric hemophilia A patient with inhibitor enrolled in the HAVEN2 (Study of Emicizumab Administered Subcutaneously (SC) in Pediatric Participants With Hemophilia A and Factor VIII (FVIII) Inhibitors) clinical trial. METHODS: The anti-emicizumab antibody has been characterized with Western blot and enzyme-linked immunosorbent assay (ELISA). The antibody was affinity purified and sequenced. Binding affinity to full-length and papain-digested emicizumab was analyzed using surface plasmon resonance and byo-layer interferometry. RESULTS: The neutralizing anti-emicizumab antibody was highly polyclonal with high-affinity binding mainly to the Fab portion of emicizumab with a small amount of binding to the Fc portion. Molecular interaction experiments between emicizumab and the purified antibody indicated the presence of at least two components with similar affinities. CONCLUSIONS: Although the incidence of neutralizing anti-emicizumab antibody is rare, this study highlights the importance of a close monitoring and the need of a simple laboratory assay to promptly detect these antibodies in patients with a history of poor drug efficacy.

IgG subclasses as biomarkers for persistence of factor VIII inhibitors in previously untreated patients with severe haemophilia A.

We investigated longitudinally the behaviour of anti-factor VIII (anti-FVIII) IgG subclasses for 6 months from inhibitor development in 43 patients from the Survey of Inhibitors in Plasma-Products Exposed Toddlers (SIPPET) trial who developed persistent or transient inhibitors. We first analysed 43 patients within 60 days post inhibitor detection. Then, 14 of these 43 patients were studied at five time points over 6 months. Our study showed that during the first 60 days, the risk of inhibitor persistence increased with the concomitant presence of an increasing number of IgG subclasses. Over the 6-month period post inhibitor detection, only the IgG2 subclass could be considered a hallmark of inhibitor persistence.

Evaluation of a New, Rapid, Fully Automated Assay for the Measurement of ADAMTS13 Activity.

Thrombotic thrombocytopenic purpura (TTP) is a rare thrombotic microangiopathy (TMA) characterized by the severe deficiency of a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13 (ADAMTS13) activity (< 10%). Rapid ADAMTS13 testing is crucial for an early diagnosis and optimal management of acute TTP. We evaluated the performance of the HemosIL AcuStar ADAMTS13 activity assay (Instrumentation Laboratory, Bedford, Massachusetts, United States), a fully automated chemiluminescent immunoassay with an analytical time of 33 minutes. A method comparison study was performed on 176 samples from 49 healthy donors and 127 TMA patients (109 TTP, 7 atypical hemolytic uremic syndrome, 11 other TMAs), comparing this new assay with an in-house FRETS-VWF73 assay and a commercial enzyme-linked immunosorbent assay (ELISA) (TECHNOZYM ADAMTS-13 Activity, Technoclone GmbH, Vienna, Austria). Agreement between methods was assessed with focus on ADAMTS13 activity less than 10%, the medical decision level relevant for TTP diagnosis. The HemosIL AcuStar ADAMTS13 Activity showed good correlation with both the FRETS-VWF73 (r = 0.96) and ELISA (r = 0.96) methods. Slope of the Passing-Bablok regression was 1.05 for FRETS-VWF73 and 1.02 for ELISA, and absolute bias at the medical decision level was +0.1 and +0.3%, respectively. The study also revealed high agreement with FRETS-VWF73 (kappa 0.97) and ELISA (kappa 0.98) methods in classifying TTP patients with a severe deficiency of ADAMTS13 activity. Because of its short turnaround time and full automation, the HemosIL AcuStar ADAMTS13 activity assay might become the assay of choice to rapidly test ADAMTS13 activity in plasma and thus establish the diagnosis of acute TTP in emergency settings.

Molecular Aggregation of Marketed Recombinant FVIII Products: Biochemical Evidence and Functional Effects.

Background Recombinant (rec-) coagulation factor VIII concentrates available for hemophilia A (HA) treatment differ in cell line production and structure, which could affect their pharmacodynamics and immunogenicity. Clinical trials showed that previously untreated patients with severe HA present higher rates of inhibitor development if treated with rec-FVIII products and that differences do exist as to inhibitor's formation among different rec-FVIII products. This finding could arise from several causes, such as absence of von Willebrand factor, different glycosylation profiles, or processes of molecular aggregation of the recombinant FVIII molecules. Objectives/Methods In this study, using size exclusion high-performance liquid chromatography (SE-HPLC), dynamic light scattering (DLS) spectroscopy, and functional biochemical assays, we investigated the purity grade, FX activating ability, and aggregation status of three recombinant marketed products (Advate [Baxalta], Refacto AF [Pfizer], and Kogenate [Bayer]). Results The overall analysis of the results obtained with SE-HPLC and DLS spectroscopy showed that the three recombinant FVIII concentrates contain low but significant amounts of molecular aggregates. This phenomenon was less evident for the Advate product. Molecular aggregation negatively affects the in vitro pharmacodynamics of the concentrates with higher aggregates' content. Conclusions This study shows that the three pharmaceutical formulations of recombinant FVIII contain variable amounts of molecular aggregates after their reconstitution at therapeutic concentrations. This phenomenon negatively affects the in vitro potency of the products with higher aggregates' content and might be invoked as a contributing cause of their increased risk to induce the formation of FVIII inhibitors.

Clinical and Laboratory Features of Patients with Acquired Thrombotic Thrombocytopenic Purpura: Fourteen Years of the Milan TTP Registry.

Acquired thrombotic thrombocytopenic purpura (TTP) is a rare thrombotic microangiopathy caused by the immune-mediated severe deficiency of ADAMTS13. We hereby report the demographic and disease-related data of acquired TTP patients recorded in the Milan TTP Registry (www.ttpdatabase.org). We performed a cross-sectional study of 302 individuals enrolled in our registry for an acute episode of acquired TTP occurred between 2002 and 2015 (female 77%; median age at onset 40 years, interquartile range: 30-50). Twenty per cent of patients had concomitant autoimmune disorders. Among potential triggers of acute episodes, infections were the most prevalent (27%), followed by estroprogestinics use and pregnancy (5 and 4% of women, respectively). At presentation, systemic (72%), bleeding (68%) and neurological (43%) symptoms were the most frequent, whereas a lower prevalence of renal (18%) and cardiovascular (10%) signs and symptoms was observed. Almost all acute events were treated by plasma exchange and steroids, and 15% by rituximab. Exacerbation of acute TTP occurred in 15% of events. The TTP-related mortality was 5%. In survivors, the median number of plasma exchange procedures to remission was 9 (interquartile range: 6-14), longer for first events than relapses (median difference 3, 95% confidence interval: 2-4). Of 251 survivors of the first TTP episode with at least a 6-month follow-up, 55% had a relapse. In conclusion, acquired TTP is a severe disease with highly variable clinical presentation, usually requiring a long hospitalization. The Milan TTP Registry represents a powerful tool to improve our knowledge and management of acquired TTP.

ADAMTS13-specific circulating immune complexes as potential predictors of relapse in patients with acquired thrombotic thrombocytopenic purpura.

BACKGROUND: Acquired thrombotic thrombocytopenic purpura (TTP) is a rare thrombotic microangiopathy due to the development of autoantibodies against the VWF-cleaving protease ADAMTS13. ADAMTS13-specific circulating immune complexes (CICs) have been described in patients with acquired TTP, but their clinical relevance remained to be established. The aim of this study was to assess the association between ADAMTS13-specific CICs and ADAMTS13-related measurements, clinical and laboratory markers of disease severity, and occurrence of TTP relapse, in autoimmune TTP patients. MATERIAL AND METHODS: We measured ADAMTS13-specific CICs in 51 patients with severe ADAMTS13 deficiency and anti-ADAMTS13 autoantibodies, at the first episode of acquired TTP. The associations between ADAMTS13-specific CICs and the variables of interest were assessed by linear, logistic and Cox proportional hazard regression models, where appropriate. RESULTS: The prevalence of ADAMTS13-specific CICs in patients experiencing the first TTP episode was 39% (95% confidence intervals [CI]: 26-52%). ADAMTS13-specific CICs were not associated neither with laboratory markers of disease severity, nor with patterns of clinical presentation. Conversely, among 45 survivors, a positive association was found between the presence of ADAMTS13-specific CICs and the risk of recurrence within 2years after the first TTP episode (adjusted hazard ratio, 3.4 [95% CI: 0.9 to 13.5]). CONCLUSIONS: ADAMTS13-specific CICs seem to be able to predict the recurrence of acute TTP episodes in the first 2years after disease onset. Therefore, their measurement might be used as a tool to stratify the risk of disease relapse, with potential influence on surveillance and therapeutic choices during remission phase.

Nonneutralizing antibodies against factor VIII and risk of inhibitor development in severe hemophilia A.

The development of anti-factor VIII (FVIII) neutralizing antibodies (inhibitors) is the major complication in hemophilia A. Nonneutralizing antibodies (NNAs) have been detected in hemophilia patients and also in unaffected individuals. The aim of this study was to assess the prevalence of NNAs and to evaluate whether their presence is associated with the development of inhibitors in a cohort of previously untreated or minimally treated patients with hemophilia A; plasma samples of 237 patients with severe hemophilia A enrolled in the SIPPET trial were collected before any exposure to FVIII concentrates and analyzed for the presence of anti-FVIII NNAs. Patients were observed for the development of neutralizing antibodies. NNAs were found in 18 (7.6%) of 237 patients at screening, and there was a clear age gradient. Of those with NNAs, 7 patients subsequently developed an inhibitor for a cumulative incidence of 45.4% (95% confidence interval [CI], 19.5% to 71.3%); among the 219 patients without NNAs, 64 (29%) developed an inhibitor (cumulative incidence, 34.0%; 95% CI, 27.1%-40.9%). In Cox regression analyses, patients with NNAs at screening had an 83% higher incidence of inhibitor development than patients without NNAs (hazard ratio [HR], 1.83; 95% CI, 0.84-3.99). For high-titer inhibitors, the incidence rate had an almost threefold increase (HR, 2.74; 95% CI, 1.23-6.12). These associations did not materially change after adjustment. The presence of anti-FVIII NNAs in patients with severe hemophilia A who were not previously exposed to FVIII concentrates is associated with an increased incidence of inhibitors.

Next-Generation Sequencing and In Vitro Expression Study of ADAMTS13 Single Nucleotide Variants in Deep Vein Thrombosis.

BACKGROUND: Deep vein thrombosis (DVT) genetic predisposition is partially known. OBJECTIVES: This study aimed at assessing the functional impact of nine ADAMTS13 single nucleotide variants (SNVs) previously reported to be associated as a group with DVT in a burden test and the individual association of selected variants with DVT risk in two replication studies. METHODS: Wild-type and mutant recombinant ADAMTS13 were transiently expressed in HEK293 cells. Antigen and activity of recombinant ADAMTS13 were measured by ELISA and FRETS-VWF73 assays, respectively. The replication studies were performed in an Italian case-control study (Milan study; 298/298 patients/controls) using a next-generation sequencing approach and in a Dutch case-control study (MEGA study; 4306/4887 patients/controls) by TaqMan assays. RESULTS: In vitro results showed reduced ADAMTS13 activity for three SNVs (p.Val154Ile [15%; 95% confidence interval [CI] 14-16], p.Asp187His [19%; 95%[CI] 17-21], p.Arg421Cys [24%; 95%[CI] 22-26]) similar to reduced plasma ADAMTS13 levels of patients carriers for these SNVs. Therefore these three SNVs were interrogated for risk association. The first replication study identified 3 heterozygous carriers (2 cases, 1 control) of p.Arg421Cys (odds ratio [OR] 2, 95%[CI] 0.18-22.25). The second replication study identified 2 heterozygous carriers (1 case, 1 control) of p.Asp187His ([OR] 1.14, 95%[CI] 0.07-18.15) and 10 heterozygous carriers (4 cases, 6 controls) of p.Arg421Cys ([OR] 0.76, 95%[CI] 0.21-2.68). CONCLUSIONS: Three SNVs (p.Val154Ile, p.Asp187His and p.Arg421Cys) showed reduced ex vivo and in vitro ADAMTS13 levels. However, the low frequency of these variants makes it difficult to confirm their association with DVT.

ADAMTS13 content in plasma-derived factor VIII/von Willebrand factor concentrates.

Thrombotic thrombocytopenic purpura (TTP) is a microangiopathy syndrome caused by a congenital or acquired deficiency of ADAMTS13, a plasma metalloprotease that cleaves von Willebrand factor (VWF) and thus prevents the formation of platelet-rich thrombi in the microcirculation. TTP can be fatal if not appropriately and timely treated with the infusion of fresh frozen plasma (FFP) or exchange plasmapheresis, that reverse the process of microangiopathy by removing anti-ADAMTS13 autoantibodies and replacing functional ADAMTS13. The treatment of TTP with FFP is not free from risks and must be administered in hospitals or clinics, owing to the substantial amount of plasma volume infused or exchanged and the frequent need of catheter application. Moreover, most FFPs are not subjected to treatments to remove or inactivate blood-borne infectious agents. A number of recent reports indicate that certain plasma-derived VWF-factor VIII (FVIII) concentrates are clinically effective in the treatment of congenital TTP. In this study, we measured ADAMTS13 levels in various plasma-derived VWF-FVIII concentrates, showing that Koate(®) -DVI (Grifols), contained relatively high amounts of ADAMTS13 and that Alphanate(®) (Grifols) was the closest other product in terms of protease content. Koate(®) -DVI contains, on average (five lots tested), 0.091 ± 0.007 Units of ADAMTS13 activity per IU of FVIII. On the basis of this analysis and other reports of VWF-FVIII concentrate utilization in congenital TTP, potential dosing, and future clinical developments are discussed.

Nonsense-mediated mRNA decay in the ADAMTS13 gene caused by a 29-nucleotide deletion.

BACKGROUND: In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts. DESIGN AND METHODS: In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay. RESULTS: In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies. CONCLUSIONS: In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.

ADAMTS13 and anti-ADAMTS13 antibodies as markers for recurrence of acquired thrombotic thrombocytopenic purpura during remission.

BACKGROUND: From 20 to 50% of patients who survive an acute episode of the acquired form of thrombotic thrombocytopenic purpura relapse but clinical and laboratory markers of recurrence are not well established. DESIGN AND METHODS: In 109 patients enrolled in an international registry we evaluated, in the frame of a retrospective cohort study, the predictive role of the metalloprotease ADAMTS13 as measured in plasma during remission. Anti-ADAMTS13 antibodies and von Willebrand factor were also evaluated in a smaller number of the same patients. RESULTS: Median values of ADAMTS13 activity and antigen were significantly lower in patients with recurrent thrombotic thrombocytopenic purpura than in those with no recurrence (activity: 12% vs. 41%; p=0.007; antigen: 36% vs. 58%; p=0.003). A severe deficiency of ADAMTS13 activity (10% or less) was associated with a higher likelihood of recurrence (odds ratio 2.9; 95% confidence interval 1.3 to 6.8; p=0.01). Anti-ADAMTS13 antibodies were also more prevalent in patients with recurrent thrombotic thrombocytopenic purpura (odds ratio 3.1; 95% confidence interval 1.4 to 7.3; p=0.006). The presence during remission of both severe ADAMTS13 deficiency and anti-ADAMTS13 antibodies increased the likelihood of recurrence 3.6 times (95% confidence interval 1.4 to 9.0; p=0.006). The presence of ultralarge von Willebrand factor multimers and of associated diseases or conditions did not increase recurrence. CONCLUSIONS: Survivors of an acute episode of acquired thrombotic thrombocytopenic purpura with severely reduced levels of ADAMTS13 and/or with anti-ADAMTS13 antibodies during remission have an approximately three-fold greater likelihood of developing another episode of thrombotic thrombocytopenic purpura than patients with higher protease activity and no antibody.

Mechanisms of the interaction between two ADAMTS13 gene mutations leading to severe deficiency of enzymatic activity.

The inherited deficiency of the von Willebrand factor-cleaving protease ADAMTS13 is associated with rare forms of thrombotic thrombocytopenic purpura (TTP). We investigated a woman with a family history of chronic recurrent TTP and undetectable plasma levels of ADAMTS13 activity. Genetic analysis revealed two missense mutations in the heterozygous state: p.Val88Met substitution in the metalloprotease domain and p.Gly1239Val substitution in the first CUB domain of ADAMTS13. To explore the mechanism of ADAMTS13 deficiency in this patient, the wild type (WT; ADAMT13(WT)) and each mutant construct (ADAMTS13(Val88Met), ADAMTS13(Gly1239Val)) were transiently expressed in HEK 293 and COS-7 cells. To recapitulate the compound heterozygous state of the patient, both mutant ADAMTS13 proteins were also expressed together. The p.Val88Met mutation led to a defect of secretion of the protease associated with a reduction of enzymatic activity, the p.Gly1239Val mutation led to a secretion defect causing intracellular accumulation of the protease. The mechanistic effects of the mutations were further explored by means of differential immunofluorescence, that demonstrated an homogeneous distribution of ADAMTS13(WT) in the Cis-Golgi and endoplasmic reticulum (ER) compartments, a reduction of ADAMTS13(Val88Met) in both compartments, while ADAMTS13(Gly1239Val) failed to reach the Cis-Golgi compartment and remained in the ER.

Standardization of activated protein C resistance testing: effect of residual platelets in frozen plasmas assessed by commercial and home-made methods.

We investigated 42 plasmas prepared at different centrifugation speeds with three activated protein C (APC) resistance methods. The APC ratio for fresh platelet-poor plasma declined significantly after freezing and thawing. This effect was more evident with the original method (average reduction 11.3%) than with either the home-made (3.8%) or the modified method (3.2%). No significant decrease in the APC ratio was observed after freezing and thawing of platelet-free plasmas from the same patients. When frozen platelet-poor plasma was centrifuged at high speed after thawing and before testing, there was no significant decrease in the APC ratio, in comparison with fresh platelet-poor plasma using the home-made and modified methods.