Camelid-derived Tcell engagers harnessing human γδ T cells as promising antitumor immunotherapeutic agents.

In the last decade, there has been a surge in developing immunotherapies to enhance the immune system's ability to eliminate tumor cells. Bispecific antibodies known as T cell engagers (TCEs) present an attractive strategy in this pursuit. TCEs aim to guide cytotoxic T cells toward tumor cells, thereby inducing a strong activation and subsequent tumor cell lysis. In this study, we investigated the activity of different TCEs on both conventional alpha-beta (αß) T cells and unconventional gamma delta (γδ) T cells. TCEs were built using camelid single-domain antibodies (VHHs) targeting the tumor-associated antigen CEACAM5 (CEA), together with T cell receptor chains or a CD3 domain. We show that Vγ9Vδ2 T cells display stronger in vitro antitumor activity than αß T cells when stimulated with a CD3xCEA TCE. Furthermore, restricting the activation of fresh human peripheral T cells to Vγ9Vδ2 T cells limited the production of protumor factors and proinflammatory cytokines, commonly associated with toxicity in patients. Taken together, our findings provide further insights that γδ T cell-specific TCEs hold promise as specific, effective, and potentially safe molecules to improve antitumor immunotherapies.

Discovery of SOCS7 as a versatile E3 ligase for protein-based degraders.

Targeted protein degradation (TPD) strategy harnesses the ubiquitin-proteasome system (UPS) to degrade a protein of interest (POI) by bringing it into proximity with an E3 ubiquitin ligase. However, the limited availability of functional E3 ligases and the emergence of resistance through mutations in UPS components restrict this approach. Therefore, identifying alternative E3 ligases suitable for TPD is important to develop new degraders and overcome potential resistance mechanisms. Here, we use a protein-based degrader method, by fusing an anti-tag intracellular antibody to an E3 ligase, to screen E3 ligases enabling the degradation of a tagged POI. We identify SOCS7 E3 ligase as effective biodegrader, able to deplete its target in various cell lines regardless of the POI's subcellular localization. We show its utility by generating a SOCS7-based KRAS degrader that inhibits mutant KRAS pancreatic cancer cells' proliferation. These findings highlight SOCS7 versatility as valuable E3 ligase for generating potent degraders.

Lysosomal membrane proteins LAMP1 and LIMP2 are segregated in the Golgi apparatus independently of their clathrin adaptor binding motif.

To reach the lysosome, lysosomal membrane proteins (LMPs) are translocated in the endoplasmic reticulum after synthesis and then transported to the Golgi apparatus. The existence of a direct transport from the Golgi apparatus to the endosomes but also of an indirect route through the plasma membrane has been described. Clathrin adaptor binding motifs contained in the cytosolic tail of LMPs have been described as key players in their intracellular trafficking. Here we used the RUSH assay to synchronize the biosynthetic transport of multiple LMPs. After exiting the Golgi apparatus, RUSH-synchronized LAMP1 was addressed to the cell surface both after overexpression or at endogenous level. Its YXXΦ motif was not involved in the transport from the Golgi apparatus to the plasma membrane but in its endocytosis. LAMP1 and LIMP2 were sorted from each other after reaching the Golgi apparatus. LIMP2 was incorporated in punctate structures for export from the Golgi apparatus from which LAMP1 is excluded. LIMP2-containing post-Golgi transport intermediates did not rely neither on its adaptor binding signal nor on its C-terminal cytoplasmic domain.

Large-scale antibody immune response mapping of splenic B cells and bone marrow plasma cells in a transgenic mouse model.

Molecular characterization of antibody immunity and human antibody discovery is mainly carried out using peripheral memory B cells, and occasionally plasmablasts, that express B cell receptors (BCRs) on their cell surface. Despite the importance of plasma cells (PCs) as the dominant source of circulating antibodies in serum, PCs are rarely utilized because they do not express surface BCRs and cannot be analyzed using antigen-based fluorescence-activated cell sorting. Here, we studied the antibodies encoded by the entire mature B cell populations, including PCs, and compared the antibody repertoires of bone marrow and spleen compartments elicited by immunization in a human immunoglobulin transgenic mouse strain. To circumvent prior technical limitations for analysis of plasma cells, we applied single-cell antibody heavy and light chain gene capture from the entire mature B cell repertoires followed by yeast display functional analysis using a cytokine as a model immunogen. We performed affinity-based sorting of antibody yeast display libraries and large-scale next-generation sequencing analyses to follow antibody lineage performance, with experimental validation of 76 monoclonal antibodies against the cytokine antigen that identified three antibodies with exquisite double-digit picomolar binding affinity. We observed that spleen B cell populations generated higher affinity antibodies compared to bone marrow PCs and that antigen-specific splenic B cells had higher average levels of somatic hypermutation. A degree of clonal overlap was also observed between bone marrow and spleen antibody repertoires, indicating common origins of certain clones across lymphoid compartments. These data demonstrate a new capacity to functionally analyze antigen-specific B cell populations of different lymphoid organs, including PCs, for high-affinity antibody discovery and detailed fundamental studies of antibody immunity.

An extensive survey of phytoviral RNA 3' uridylation identifies extreme variations and virus-specific patterns.

Viral RNAs can be uridylated in eukaryotic hosts. However, our knowledge of uridylation patterns and roles remains rudimentary for phytoviruses. Here, we report global 3' terminal RNA uridylation profiles for representatives of the main families of positive single-stranded RNA phytoviruses. We detected uridylation in all 47 viral RNAs investigated here, revealing its prevalence. Yet, uridylation levels of viral RNAs varied from 0.2% to 90%. Unexpectedly, most poly(A) tails of grapevine fanleaf virus (GFLV) RNAs, including encapsidated tails, were strictly monouridylated, which corresponds to an unidentified type of viral genomic RNA extremity. This monouridylation appears beneficial for GFLV because it became dominant when plants were infected with nonuridylated GFLV transcripts. We found that GFLV RNA monouridylation is independent of the known terminal uridylyltransferases (TUTases) HEN1 SUPPRESSOR 1 (HESO1) and UTP:RNA URIDYLYLTRANSFERASE 1 (URT1) in Arabidopsis (Arabidopsis thaliana). By contrast, both TUTases can uridylate other viral RNAs like turnip crinkle virus (TCV) and turnip mosaic virus (TuMV) RNAs. Interestingly, TCV and TuMV degradation intermediates were differentially uridylated by HESO1 and URT1. Although the lack of both TUTases did not prevent viral infection, we detected degradation intermediates of TCV RNA at higher levels in an Arabidopsis heso1 urt1 mutant, suggesting that uridylation participates in clearing viral RNA. Collectively, our work unveils an extreme diversity of uridylation patterns across phytoviruses and constitutes a valuable resource to further decipher pro- and antiviral roles of uridylation.

Deciphering cross-species reactivity of LAMP-1 antibodies using deep mutational epitope mapping and AlphaFold.

Delineating the precise regions on an antigen that are targeted by antibodies has become a key step for the development of antibody therapeutics. X-ray crystallography and cryogenic electron microscopy are considered the gold standard for providing precise information about these binding sites at atomic resolution. However, they are labor-intensive and a successful outcome is not guaranteed. We used deep mutational scanning (DMS) of the human LAMP-1 antigen displayed on yeast surface and leveraged next-generation sequencing to observe the effect of individual mutants on the binding of two LAMP-1 antibodies and to determine their functional epitopes on LAMP-1. Fine-tuned epitope mapping by DMS approaches is augmented by knowledge of experimental antigen structure. As human LAMP-1 structure has not yet been solved, we used the AlphaFold predicted structure of the full-length protein to combine with DMS data and ultimately finely map antibody epitopes. The accuracy of this method was confirmed by comparing the results to the co-crystal structure of one of the two antibodies with a LAMP-1 luminal domain. Finally, we used AlphaFold models of non-human LAMP-1 to understand the lack of mAb cross-reactivity. While both epitopes in the murine form exhibit multiple mutations in comparison to human LAMP-1, only one and two mutations in the Macaca form suffice to hinder the recognition by mAb B and A, respectively. Altogether, this study promotes a new application of AlphaFold to speed up precision mapping of antibody-antigen interactions and consequently accelerate antibody engineering for optimization.

Characterization of Grapevine Fanleaf Virus Isolates in 'Chardonnay' Vines Exhibiting Severe and Mild Symptoms in Two Vineyards.

Fanleaf degeneration is a complex viral disease of Vitis spp. that detrimentally impacts fruit yield and reduces the productive lifespan of most vineyards worldwide. In France, its main causal agent is grapevine fanleaf virus (GFLV). In the past, field experiments were conducted to explore cross-protection as a management strategy of fanleaf degeneration, but results were unsatisfactory because the mild virus strain negatively impacted fruit yield. In order to select new mild GFLV isolates, we examined two old 'Chardonnay' parcels harbouring vines with distinct phenotypes. Symptoms and agronomic performances were monitored over the four-year study on 21 individual vines that were classified into three categories: asymptomatic GFLV-free vines, GFLV-infected vines severely diseased and GFLV-infected vines displaying mild symptoms. The complete coding genomic sequences of GFLV isolates in infected vines was determined by high-throughput sequencing. Most grapevines were infected with multiple genetically divergent variants. While no specific molecular features were apparent for GFLV isolates from vines displaying mild symptoms, a genetic differentiation of GFLV populations depending on the vineyard parcel was observed. The mild symptomatic grapevines identified during this study were established in a greenhouse to recover GFLV variants of potential interest for cross-protection studies.

Severe Stunting Symptoms upon Nepovirus Infection Are Reminiscent of a Chronic Hypersensitive-like Response in a Perennial Woody Fruit Crop.

Virus infection of plants can result in various degrees of detrimental impacts and disparate symptom types and severities. Although great strides have been made in our understanding of the virus-host interactions in herbaceous model plants, the mechanisms underlying symptom development are poorly understood in perennial fruit crops. Grapevine fanleaf virus (GFLV) causes variable symptoms in most vineyards worldwide. To better understand GFLV-grapevine interactions in relation to symptom development, field and greenhouse trials were conducted with a grapevine genotype that exhibits distinct symptoms in response to a severe and a mild strain of GFLV. After validation of the infection status of the experimental vines by high-throughput sequencing, the transcriptomic and metabolomic profiles in plants infected with the two viral strains were tested and compared by RNA-Seq and LC-MS, respectively, in the differentiating grapevine genotype. In vines infected with the severe GFLV strain, 1023 genes, among which some are implicated in the regulation of the hypersensitive-type response, were specifically deregulated, and a higher accumulation of resveratrol and phytohormones was observed. Interestingly, some experimental vines restricted the virus to the rootstock and remained symptomless. Our results suggest that GFLV induces a strain- and cultivar-specific defense reaction similar to a hypersensitive reaction. This type of defense leads to a severe stunting phenotype in some grapevines, whereas others are resistant. This work is the first evidence of a hypersensitive-like reaction in grapevine during virus infection.

Evidence of differential spreading events of grapevine pinot Gris virus in Italy using datamining as a tool.

Since its identification in 2003, grapevine Pinot gris virus (GPGV, Trichovirus) has now been detected in most grape-growing countries. So far, little is known about the epidemiology of this newly emerging virus. In this work, we used datamining as a tool to monitor in-silico the sanitary status of three vineyards in Italy. All data used in the study were recovered from a work that was already published and for which data were publicly available as SRA (Sequence Read Archive, NCBI) files. While incomplete, knowledge gathered from this work was still important, with evidence of differential accumulation of the virus in grapevine according to year, location, and variety-rootstock association. Additional data regarding GPGV genetic diversity were collected. Some advantages and pitfalls of datamining are discussed.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar 'Meunier' in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

Structural basis of nanobody recognition of grapevine fanleaf virus and of virus resistance loss.

Grapevine fanleaf virus (GFLV) is a picorna-like plant virus transmitted by nematodes that affects vineyards worldwide. Nanobody (Nb)-mediated resistance against GFLV has been created recently, and shown to be highly effective in plants, including grapevine, but the underlying mechanism is unknown. Here we present the high-resolution cryo electron microscopy structure of the GFLV-Nb23 complex, which provides the basis for molecular recognition by the Nb. The structure reveals a composite binding site bridging over three domains of one capsid protein (CP) monomer. The structure provides a precise mapping of the Nb23 epitope on the GFLV capsid in which the antigen loop is accommodated through an induced-fit mechanism. Moreover, we uncover and characterize several resistance-breaking GFLV isolates with amino acids mapping within this epitope, including C-terminal extensions of the CP, which would sterically interfere with Nb binding. Escape variants with such extended CP fail to be transmitted by nematodes linking Nb-mediated resistance to vector transmission. Together, these data provide insights into the molecular mechanism of Nb23-mediated recognition of GFLV and of virus resistance loss.

Anti-NKG2D single domain-based antibodies for the modulation of anti-tumor immune response.

The natural killer group 2 member D (NKG2D) receptor is a C-type lectin-like activating receptor mainly expressed by cytotoxic immune cells including NK, CD8+ T, γδ T and NKT cells and in some pathological conditions by a subset of CD4+ T cells. It binds a variety of ligands (NKG2DL) whose expressions is finely regulated by stress-related conditions. The NKG2DL/NKG2D axis plays a central and complex role in the regulation of immune responses against diverse cellular threats such as oncogene-mediated transformations or infections. We generated a panel of seven highly specific anti-human NKG2D single-domain antibodies targeting various epitopes. These single-domain antibodies were integrated into bivalent and bispecific antibodies using a versatile plug-and-play Fab-like format. Depending on the context, these Fab-like antibodies exhibited activating or inhibitory effects on the immune response mediated by the NKG2DL/NKG2D axis. In solution, the bivalent anti-NKG2D antibodies that compete with NKG2DL potently blocked the activation of NK cells seeded on immobilized MICA, thus constituting antagonizing candidates. Bispecific anti-NKG2DxHER2 antibodies that concomitantly engage HER2 on tumor cells and NKG2D on NK cells elicited cytotoxicity of unstimulated NK in a tumor-specific manner, regardless of their apparent affinities and epitopes. Importantly, the bispecific antibodies that do not compete with ligands binding retained their full cytotoxic activity in the presence of ligands, a valuable property to circumvent immunosuppressive effects induced by soluble ligands in the microenvironment.

Detection of Multiple Variants of Grapevine Fanleaf Virus in Single Xiphinema index Nematodes.

Grapevine fanleaf virus (GFLV) is responsible for a widespread disease in vineyards worldwide. Its genome is composed of two single-stranded positive-sense RNAs, which both show a high genetic diversity. The virus is transmitted from grapevine to grapevine by the ectoparasitic nematode Xiphinema index. Grapevines in diseased vineyards are often infected by multiple genetic variants of GFLV but no information is available on the molecular composition of virus variants retained in X. index following nematodes feeding on roots. In this work, aviruliferous X. index were fed on three naturally GFLV-infected grapevines for which the virome was characterized by RNAseq. Six RNA-1 and four RNA-2 molecules were assembled segregating into four and three distinct phylogenetic clades of RNA-1 and RNA-2, respectively. After 19 months of rearing, single and pools of 30 X. index tested positive for GFLV. Additionally, either pooled or single X. index carried multiple variants of the two GFLV genomic RNAs. However, the full viral genetic diversity found in the leaves of infected grapevines was not detected in viruliferous nematodes, indicating a genetic bottleneck. Our results provide new insights into the complexity of GFLV populations and the putative role of X. index as reservoirs of virus diversity.

From a Movement-Deficient Grapevine Fanleaf Virus to the Identification of a New Viral Determinant of Nematode Transmission.

Grapevine fanleaf virus (GFLV) and arabis mosaic virus (ArMV) are nepoviruses responsible for grapevine degeneration. They are specifically transmitted from grapevine to grapevine by two distinct ectoparasitic dagger nematodes of the genus Xiphinema. GFLV and ArMV move from cell to cell as virions through tubules formed into plasmodesmata by the self-assembly of the viral movement protein. Five surface-exposed regions in the coat protein called R1 to R5, which differ between the two viruses, were previously defined and exchanged to test their involvement in virus transmission, leading to the identification of region R2 as a transmission determinant. Region R4 (amino acids 258 to 264) could not be tested in transmission due to its requirement for plant systemic infection. Here, we present a fine-tuning mutagenesis of the GFLV coat protein in and around region R4 that restored the virus movement and allowed its evaluation in transmission. We show that residues T258, M260, D261, and R301 play a crucial role in virus transmission, thus representing a new viral determinant of nematode transmission.

The Identity of a Single Residue of the RNA-Dependent RNA Polymerase of Grapevine Fanleaf Virus Modulates Vein Clearing in Nicotiana benthamiana.

The mechanisms underlying host plant symptom development upon infection by viruses of the genus Nepovirus in the family Secoviridae, including grapevine fanleaf virus (GFLV), are poorly understood. In the systemic host Nicotiana benthamiana, GFLV strain GHu produces characteristic symptoms of vein clearing in apical leaves, unlike other GFLV strains such as F13, which cause an asymptomatic infection. In this study, we expanded on earlier findings and used reverse genetics to identify residue 802 (lysine, K) of the GFLV-GHu RNA1-encoded RNA-dependent RNA polymerase (1EPol) as a modulator of vein-clearing symptom development in N. benthamiana. Mutations to this site abolished (K to G, A, or Q) or attenuated (K to N or P) symptom expression. Noteworthy, residue 802 is necessary but not sufficient for vein clearing, as GFLV-F13 RNA1 carrying K802 remained asymptomatic in N. benthamiana. No correlation was found between symptom expression and RNA1 accumulation, as shown by reverse transcription-quantitative polymerase chain reaction. Additionally, the involvement of RNA silencing of vein clearing was ruled out by virus-induced gene silencing experiments and structure predictions for protein 1EPol suggested that residue 802 is flanked by strongly predicted stable secondary structures, including a conserved motif of unknown function (805LLKT/AHLK/RT/ALR814). Together, these results reveal the protein nature of the GFLV-GHu symptom determinant in N. benthamiana and provide a solid basis for probing and determining the virus-host proteome network for symptoms of vein clearing.

Comparison of Serological and Molecular Methods With High-Throughput Sequencing for the Detection and Quantification of Grapevine Fanleaf Virus in Vineyard Samples.

Grapevine fanleaf virus (GFLV) is the main causal agent of fanleaf degeneration, the most damaging viral disease of grapevine. GFLV is included in most grapevine certification programs that rely on robust diagnostic tools such as biological indexing, serological methods, and molecular techniques, for the identification of clean stocks. The emergence of high throughput sequencing (HTS) offers new opportunities for detecting GFLV and other viruses in grapevine accessions of interest. Here, two HTS-based methods, i.e., RNAseq and smallRNAseq (focusing on the 21 to 27 nt) were explored for their potential to characterize the virome of grapevine samples from two 30-year-old GFLV-infected vineyards in the Champagne region of France. smallrnaseq was optimal for the detection of a wide range of viral species within a sample and RNAseq was the method of choice for full-length viral genome assembly. The implementation of a protocol to discriminate between low GFLV titer and in silico contamination (intra-lane contamination due to index misassignment) during data processing was critical for data analyses. Furthermore, we compared the performance of semi-quantitative DAS-ELISA (double antibody enzyme-linked immunosorbent assay), RT-qPCR (Reverse transcription-quantitative polymerase chain reaction), Immuno capture (IC)-RT-PCR, northern blot for viral small interfering RNA (vsiRNA) detection and RNAseq for the detection and quantification of GFLV. While detection limits were variable among methods, as expected, GFLV diagnosis was consistently achieved with all of these diagnostic methods. Together, this work highlights the robustness of DAS-ELISA, the current method routinely used in the French grapevine certification program, for the detection of GFLV and offers perspectives on the potential of HTS as an approach of high interest for certification.

Grapevine virus T diversity as revealed by full-length genome sequences assembled from high-throughput sequence data.

RNASeq or double-stranded RNA based approaches allowed the reconstruction of a total of 9 full-length or near full-length genomes of the recently discovered grapevine virus T (GVT). In addition, datamining of publicly available grapevine RNASeq transcriptome data allowed the reconstruction of a further 14 GVT genomes from five grapevine sources. Together with four GVT sequences available in Genbank, these novel sequences were used to analyse GVT diversity. GVT shows a very limited amount of indels variation but a high level of nucleotide and aminoacid polymorphism. This level is comparable to that shown in the closely related grapevine rupestris stem pitting-associated virus (GRSPaV). Further analyses showed that GVT mostly evolves under conservative selection pressure and that recombination has contributed to its evolutionary history. Phylogenetic analyses allow to identify at least seven clearly separated groups of GVT isolates. Analysis of the only reported PCR GVT-specific detection primer pair indicates that it is likely to fail to amplify some GVT isolates. Taken together these results point at the distinctiveness of GVT but also at the many points it shares with GRSPaV. They constitute the first pan-genomic analysis of the diversity of this novel virus.

High-Throughput Sequencing and the Viromic Study of Grapevine Leaves: From the Detection of Grapevine-Infecting Viruses to the Description of a New Environmental Tymovirales Member.

In the past decade, high-throughput sequencing (HTS) has had a major impact on virus diversity studies as well as on diagnosis, providing an unbiased and more comprehensive view of the virome of a wide range of organisms. Rather than the serological and molecular-based methods, with their more "reductionist" view focusing on one or a few known agents, HTS-based approaches are able to give a "holistic snapshot" of the complex phytobiome of a sample of interest. In grapevine for example, HTS is powerful enough to allow for the assembly of complete genomes of the various viral species or variants infecting a sample of known or novel virus species. In the present study, a total RNAseq-based approach was used to determine the full genome sequences of various grapevine fanleaf virus (GFLV) isolates and to analyze the eventual presence of other viral agents. From four RNAseq datasets, a few complete grapevine-infecting virus and viroid genomes were de-novo assembled: (a) three GFLV genomes, 11 grapevine rupestris stem-pitting associated virus (GRSPaV) and six viroids. In addition, a novel viral genome was detected in all four datasets, consisting of a single-stranded, positive-sense RNA molecule of 6033 nucleotides. This genome displays an organization similar to Tymoviridae family members in the Tymovirales order. Nonetheless, the new virus shows enough differences to be considered as a new species defining a new genus. Detection of this new agent in the original grapevines proved very erratic and was only consistent at the end of the growing season. This virus was never detected in the spring period, raising the possibility that it might not be a grapevine-infecting virus, but rather a virus infecting a grapevine-associated organism that may be transiently present on grapevine samples at some periods of the year. Indeed, the Tymoviridae family comprises isometric viruses infecting a wide range of hosts in different kingdoms (Plantae, Fungi, and Animalia). The present work highlights the fact that even though HTS technologies produce invaluable data for the description of the sanitary status of a plant, in-depth biological studies are necessary before assigning a new virus to a particular host in such metagenomic approaches.

A genome-wide diversity study of grapevine rupestris stem pitting-associated virus.

Over the last decade, many scientific disciplines have been impacted by the dawn of new sequencing techniques (HTS: high throughput sequencing). Plant pathology and more specifically virology have been greatly transformed by this 'metagenomics' paradigm shift. Such tools significantly facilitate disease diagnostics with tremendous sensitivity, providing invaluable information such as an exhaustive list of viruses being present in a sample as well as their relative concentration. In addition, many new plant viruses have been discovered. Using RNAseq technology, in silico reconstruction of complete viral genome sequences is easily attainable. This step is of importance for taxonomy, population structure analyses, phylogeography and viral evolution studies. Here, after assembling 81 new near-complete genome sequences of grapevine rupestris stem pitting-associated virus (GRSPaV), we performed a genome-wide diversity study of this ubiquitous virus of grapevine worldwide.

Optimal systemic grapevine fanleaf virus infection in Nicotiana benthamiana following agroinoculation.

One of the greatest hindrances to the study of grapevine fanleaf virus (GFLV) is the dearth of robust protocols for reliable, scalable, and cost-effective inoculation of host plants, especially methods which allow for rapid and targeted manipulation of the virus genome. Agroinoculation fulfills these requirements: it is a relatively rapid, inexpensive, and reliable method for establishing infections, and enables genetic manipulation of viral sequences by modifying plasmids. We designed a system of binary plasmids based on the two genomic RNAs [RNA1 (1) and RNA2 (2)] of GFLV strains F13 (F) and GHu (G) and optimized parameters to maximize systemic infection frequency in Nicotiana benthamiana via agroinoculation. The genomic make-up of the inoculum (G1-G2 and reassortant F1-G2), the identity of the co-infiltrated silencing suppressor (grapevine leafroll associated virus 2 p24), and temperature at which plants were maintained (25 °C) significantly increased systemic infection, while high optical densities of infiltration cultures (OD600nm of 1.0 or 2.0) increased the consistency of systemic infection frequency in N. benthamiana. In contrast, acetosyringone in the bacterial culture media, regardless of concentration, had no effect. Plasmids in this system are amenable to rapid and reliable manipulation by one-step site-directed mutagenesis, as shown by the creation of infectious RNA1 chimeras of the GFLV-F13 and GHu strains. The GFLV agroinoculation plasmids described here, together with the optimized protocol for bacterial culturing and plant maintenance, provide a robust system for the establishment of systemic GFLV infection in N. benthamiana and the rapid generation of GFLV mutants, granting a much-needed tool for investigations into GFLV-host interactions.