Complete genome characterization of chilli veinal mottle virus associated with mosaic and mottling disease of tomato and development of LAMP assay for quick detection.

Chilli veinal mottle virus (ChiVMV) is a potyvirus known to cause havoc in many solanaceous crops. Samples from tomato plants exhibiting typical mosaic and mottling symptoms in two locations from farmers' fields were collected and tested using DAC ELISA for the presence of ChiVMV and other viruses known to infect tomato. ChiVMV Gauribidanur isolate from infected tomato was mechanically inoculated to Datura metel, Nicotiana tabacum, Nicotiana benthamiana, Nicotiana glutinosa, chilli, and tomato plants which exhibited systemic mosaic and mottling symptoms 10 days post-inoculation. This results were further confirmed by RT-PCR and DAC ELISA using CP gene-specific primers and ChiVMV antisera, respectively. Transmission electron microscopy revealed the presence of long filamentous particles (800 × 11 nm) resembling viruses in the Potyviridae family. The complete genome of ChiVMV comprised 9716 nucleotides except for poly A tail, with a predicted open reading frame spanning 9270 nucleotides encoding polyproteins of 3089 amino acids. Comparative analysis revealed that ChiVMV-tomato isolates reported across the world shared maximum nucleotide identity (93-96.7%) with chilli isolates from India and Pakistan. These results were well supported by sequence demarcation analysis. Further, the Neibhor-Net network analysis of the complete genome of ChiVMV-tomato, along with other host isolates, formed a reticular network phylogenetic tree suggesting recombination events. Subsequently, RDP5 detected intra-specific recombination breakpoints at the positions 1656-5666 nucleotides with major parent ChiVMV (MN508960) Uravakonda and minor parent ChiVMV (MN508956) with a significant average p value of 1.905 × 10-22. The LAMP assay using ChiVMV-specific primers resulted in ladder-like amplified products on electrophoresed gel and a distinct red colour pattern with hydroxy naphthalene blue, indicating a positive reaction for the presence of ChiVMV in infected tomato samples. To validate LAMP-designed primers, RNA extracted from ChiVMV-infected tomato, chilli, datura, and tobacco samples were subjected to LAMP assay and it accurately detected the presence of ChiVMV in infected plant samples. Overall, this study provides holistic information of ChiVMV infecting tomato, spanning diagnosis, transmission, genetic characterization, and detection of recombination events, which collectively contribute to effective disease management, crop protection, and informed decision-making in agricultural practices.

Genome sequencing of cucumber mosaic virus (CMV) isolates infecting chilli and its interaction with host ferredoxin protein of different host for causing mosaic symptoms.

Chilli (Capsicum annuum L.) is an important vegetable crop grown in the Indian sub-continent and is prone to viral infections under field conditions. During the field survey, leaf samples from chilli plants showing typical symptoms of disease caused by cucumber mosaic virus (CMV) such as mild mosaic, mottling and leaf distortion were collected. DAC-ELISA analysis confirmed the presence of CMV in 71 out of 100 samples, indicating its widespread prevalence in the region. Five CMV isolates, named Gu1, Gu2, BA, Ho, and Sal were mechanically inoculated onto cucumber and Nicotiana glutinosa plants to study their virulence. Inoculated plants expressed the characteristic symptoms of CMV such as chlorotic spots followed by mild mosaic and leaf distortion. Complete genomes of the five CMV isolates were amplified, cloned, and sequenced, revealing RNA1, RNA2, and RNA3 sequences with 3358, 3045, and 2220 nucleotides, respectively. Phylogenetic analysis classified the isolates as belonging to the CMV-IB subgroup, distinguishing them from subgroup IA and II CMV isolates. Recombination analysis showed intra and interspecific recombination in all the three RNA segments of these isolates. In silico protein-protein docking approach was used to decipher the mechanism behind the production of mosaic symptoms during the CMV-host interaction in 13 host plants. Analysis revealed that the production of mosaic symptoms could be due to the interaction between the coat protein (CP) of CMV and chloroplast ferredoxin proteins. Further, in silico prediction was validated in 13 host plants of CMV by mechanical sap inoculation. Twelve host plants produced systemic symptoms viz., chlorotic spot, chlorotic ringspot, chlorotic local lesion, mosaic and mild mosaic and one host plant, Solanum lycopersicum produced mosaic followed by shoestring symptoms. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-023-03777-8.

Exploring the diversity of virulence genes in the Magnaporthe population infecting millets and rice in India.

Blast pathogen, Magnaporthe spp., that infects ancient millet crops such pearl millet, finger millet, foxtail millet, barnyard millet, and rice was isolated from different locations of blast hotspots in India using single spore isolation technique and 136 pure isolates were established. Numerous growth characteristics were captured via morphogenesis analysis. Among the 10 investigated virulent genes, we could amplify MPS1 (TTK Protein Kinase) and Mlc (Myosin Regulatory Light Chain edc4) in majority of tested isolates, regardless of the crop and region where they were collected, indicating that these may be crucial for their virulence. Additionally, among the four avirulence (Avr) genes studied, Avr-Pizt had the highest frequency of occurrence, followed by Avr-Pia. It is noteworthy to mention that Avr-Pik was present in the least number of isolates (9) and was completely absent from the blast isolates from finger millet, foxtail millet, and barnyard millet. A comparison at the molecular level between virulent and avirulent isolates indicated observably large variation both across (44%) and within (56%) them. The 136 Magnaporthe spp isolates were divided into four groups using molecular markers. Regardless of their geographic distribution, host plants, or tissues affected, the data indicate that the prevalence of numerous pathotypes and virulence factors at the field level, which may lead to a high degree of pathogenic variation. This research could be used for the strategic deployment of resistant genes to develop blast disease-resistant cultivars in rice, pearl millet, finger millet, foxtail millet, and barnyard millet.

Molecular characterization of novel bipartite begomovirus associated with enation leaf disease of Garden croton (Codiaeum variegatum L.).

Garden croton (Codiaeum variegatum L.) plants showing typical begomovirus symptoms of vein twisting, enation and curling were collected from different gardens at Varanasi, Uttar Pradesh state of India ranged from 20 to 30%. All the 10 ten (CR1-CR10) infected samples of garden croton resulted in expected amplicon of 1.2 Kb in PCR specific to begomoviruses. No amplification was obtained for betasatellite and alphasatellite specific primers. The complete genome sequence of DNA-A and DNA-B for two isolates (CR1 and CR2) was obtained through rolling cycle amplification (RCA) and comparisons were made with other begomoviruses using Sequence Demarcation Tool (SDT) which revealed that, DNA-A of two isolates, CR1 (Acc.No.: MW816855) and CR2 (Acc.No.: MW816856) showed maximum nucleotide (nt) identity of 85.7-85.9% with Tomato leaf curl Karnataka virus, which is below the threshold percentage of begomovirus species demarcation, hence considered as novel begomovirus and proposed the name Garden croton enation leaf curl virus (CroELCuV) [IN: Varanasi: Croton: 18]. Further, DNA-B these isolates shared maximum nt identity of 91.0-92.2% (DNA-B) with Tomato leaf curl New Delhi virus. Recombination and GC plot analysis showed that the recombination occured at in low GC content regions of DNA-A and DNA-B of the CroELCuV and are derived from the previously reported several begomoviruses. This is the first record of novel bipartite begomovirus associated with vein twisting, enation and leaf curling of disease of garden garden croton in India and world. Supplementary Information: The online version contains supplementary material available at 10.1007/s13337-022-00772-0.

First Confirmed Report of Leaf Blight on Browntop Millet Caused by Bipolaris setariae in Southern Peninsular India.

Browntop millet (Brachiaria ramosa (L.) Stapf), which is native to the United States, was recently introduced into India as one of the small millet crop. In September 2018, leaf blight symptoms were observed on cv. Dundu Korale on the adaxial side of the leaves in a field at Bangalore, India (13.0784oN, 77.5793oE). Initial lesions were brown with small yellow halo that ranged from 1 to 5 mm and eventually enlarged exhibiting light brown centers. Afterwards, spots coalesced and leaves were blighted. About 75% of the plants were infected in the field of 0.5 ha. Samples of symptomatic and asymptomatic leaves were collected, and nine isolates were recovered from culture on potato dextrose agar (PDA). Single conidial isolation was performed. Colonies were grey to olive green with regular margins at 7 days when cultured on PDA at 27 ± 1oC and 16 h light and 8 h dark cycles. Conidiophores were single or in clusters from 4.92 to 6.04 µm in width. Conidia were fusoid, cylindrical to slightly curved ranging from 38.50 to 130 µm in length and from 8.30 to 17 µm in width, with 4 to 10 distosepta (n =100). Hilum was flat to inconspicuous or slightly protruded. Based on the morphology, the pathogen was identified as a Bipolaris species according to the genus standard descriptions of Helminthosporium (Alcorn 1988). Misra and Prakash (1972) reported that Helminthosporium setariae causing leaf spot on browntop millet in India, but they did not provide any morphological or molecular evidence of identification. For molecular identification, the genomic DNA of isolate BTMH3 was extracted and the internal transcribed spacer region (ITS) and glyceraldehyde-3-phosphate dehydrogenase gene (GPD) were amplified using the pairs of primers ITS1/ITS4 (White et al. 1990) and GPD1/GPD2 (Berbee et al. 1999), respectively. BLAST analysis of ITS (MT750301; 562 matching base pairs) and GPD (MT896702; 562 matching base pairs) sequences showed 99.82% of identity with sequences of Bipolaris setariae (Sawada) Shoemaker type strain CBS 141.31 (ITS: EF452444 and GPD: EF513206). Pathogenicity was proved by spraying 10 healthy 20-day-old browntop millet plants with conidial suspension (106 conidia/ml). Control plants were sprayed with distilled water. Plants were covered with transparent polythene bags in a greenhouse at 28 ± 2oC and high relative humidity of 90%. Symptoms were observed at five days post inoculation. The pathogen was re-isolated from infected areas using the same protocol as before, whereas the control plants were symptomless. The re-isolated pathogen was confirmed as B. setariae based on morphological characters and PCR assay. To the best of our knowledge, this is the first report of leaf blight on browntop millet caused by B. setariae in the southern peninsular region of India. Disease specimen was deposited in Herbarium Cryptogamae Indiae Orientalis (HCIO), New Delhi, India with accession number 52209. Grain yield losses caused by leaf blight on browntop millet remain to be determined, however our findings indicate that cultivar cv. Dundu Korale is susceptible to B. setariae.

First report of Sclerotium rolfsii causing collar rot on Berseem (Trifolium alexandrinum) in India.

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52' 749.20″, E78º 55' 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.