Metagenomic sequencing reveals viral diversity of mosquitoes from Shandong Province, China.

Mosquitoes carry a large number of known and unknown viruses, some of which could cause serious diseases in humans or animals. Metagenomic sequencing for mosquito viromes is crucial for understanding the evolutionary history of viruses and preventing emerging mosquito-borne diseases. We collected 1,598 mosquitoes belonging to four species from five counties in Shandong Province, China in 2021. They were grouped by species and sampling locations and subjected to metagenomic next-generation sequencing for the analysis of the viromes. A total of 233,317,352 sequencing reads were classified into 30 viral families and an unclassified group. Comparative analysis showed that mosquitoes in Shandong Province generally possessed host-specific virome. We detected mosquito-borne viruses including Japanese encephalitis virus, Getah virus, and Kadipiro virus in Culex tritaeniorhynchus and Anopheles sinensis samples. Phylogenetic analysis showed that these pathogenic viruses may have existed in mosquitoes in Shandong Province for a long time. Meanwhile, we identified 22 novel viruses belonging to seven families and the genus Negevirus. Our study comprehensively described the viromes of several common mosquito species in Shandong Province, China, and demonstrated the major role of host species in shaping mosquito viromes. Furthermore, the metagenomic data provided valuable epidemiological information on multiple mosquito-borne viruses, highlighting the potential risk of infection transmission. IMPORTANCE: Mosquitoes are known as the source of various pathogens for humans and animals. Culex tritaeniorhynchus, Armigeres subalbatus, and Anopheles sinensis have been found to transmit the Getah virus, which has recently caused increasing infections in China. Cx. tritaeniorhynchus and Culex pipiens are the main vectors of Japanese encephalitis virus and have caused epidemics of Japanese encephalitis in China in past decades. These mosquitoes are widely present in Shandong Province, China, leading to a great threat to public health and the breeding industry. This study provided a comprehensive insight into the viromes of several common mosquito species in Shandong Province, China. The metagenomic sequencing data revealed the risks of multiple pathogenic mosquito-borne viruses, including Japanese encephalitis virus, Getah virus, and Kadipiro virus, which are of great importance for preventing emerging viral epidemics.

Environmental Surveillance of Human Astroviruses in Jinan City of China, 2020-2021.

Human astroviruses (HAstVs) are a significant etiological agent of acute gastroenteritis in children. In order to investigate the circulation of HAstVs during the COVID-19 pandemic, a 2-year environmental surveillance was conducted in Jinan between 2020 and 2021. A total of 24 sewage samples were collected and concentrated. Real-time PCR indicated a positive rate of 83.3%, 79.2% (19/24), and 62.5% for classic, MLB, and VA types of HAstV in sewage samples, respectively, with genomic copies ranging from 6.4 × 103 to 3.7 × 107, 3.2 × 104 to 2.2 × 106, and 1.2 × 104 to 1.6 × 107 l-1. Next-generation sequencing (NGS) analysis on complete ORF2 amplicons from each sewage concentrate revealed the presence of 11 HAstV types, including HAstV-1, -2, -4, -5, MLB1, and VA1 to VA6, as well as non-human animal astroviruses. The most abundant HAstV types were HAstV-1, -4, and -5, which accounted for 70.3%, 12.6%, and 9.1% of total HAstV reads, respectively. Phylogenetic analysis revealed that the sequences obtained in this study were segregated into multiple transmission lineages, yet exhibited less genetic divergence among themselves than with foreign strains. These findings provide insight into the genotype diversity and genetic characterization of HAstVs during the COVID-19 pandemic, and highlight the effectiveness of utilizing NGS approaches to investigate sewage HAstVs.

Detection and diversity of human enteroviruses from domestic sewage in Weishan Lake region, eastern China, 2018-2019.

AIMS: Next generation sequencing (NGS) technology has been widely used in monitoring and identifying microbiomes in sewage. We aimed to evaluate the ability of NGS analysis in directly detecting enterovirus (EV) in sewage and to understand the diversity of EVs circulated in the residents in Weishan Lake region. METHODS AND RESULTS: Fourteen sewage samples were collected in Jining, Shandong Province, China from 2018 to 2019 and were parallelly investigated by the P1 amplicon-based NGS method and cell culture method. The results showed that 20 different serotypes belonging to species Enterovirus A (EV-A) (n = 5), EV-B (n = 13), and EV-C (n = 2) were identified by NGS in the sewage concentrates, which exceeded the number of types detected by cell culture method (n = 9). Echovirus 11 (E11), Coxsackievirus (CV) B5 and CVA9 were the most detected types in those sewage concentrates. Phylogenetic analysis revealed that E11 sequences obtained in this study belonged to genogroup D5 and had close genetic relationship with clinical sequences. CONCLUSIONS: Various EV serotypes circulated in populations near Weishan Lake. The combination of NGS technology into environmental surveillance will greatly contribute to improving our knowledge about EV circulation patterns in the population.

Importation and circulation of rubella virus lineages 1E-L2 and 2B-L2c between 2018 and 2021 in China: Virus evolution and spatial-temporal transmission characteristics.

To better understand the importation and circulation patterns of rubella virus lineages 1E-L2 and 2B-L2c circulating in China since 2018, 3,312 viral strains collected from 27 out of 31 provinces in China between 2018 and 2021 were sequenced and analyzed with the representative international strains of lineages 1E-L2 and 2B-L2c based on genotyping region. Time-scale phylogenetic analysis revealed that the global lineages 1E-L2 and 2B-L2c presented distinct evolutionary patterns. Lineage 1E-L2 circulated in relatively limited geographical areas (mainly Asia) and showed geographical and temporal clustering, while lineage 2B-L2c strains circulated widely throughout the world and exhibited a complicated topology with several independently evolved branches. Furthermore, both lineages showed extensive international transmission activities, and phylogeographic inference provided evidence that lineage 1E-L2 strains circulating in China possibly originated from Japan, while the source of lineage 2B-L2c isolated since 2018 is still unclear. After importation into China in 2018, the spread of lineage 1E-L2 presented a three-stage transmission pattern from southern to northern China, whereas lineage 2B-L2c spread from a single point in western China to all the other four regions. These two transmission patterns allowed both imported lineages to spread rapidly across China during the 2018-9 rubella epidemic and eventually established endemic circulations. This study provides critical scientific data for rubella control and elimination in China and worldwide.

Evolutionary phylogeography reveals novel genotypes of coxsackievirus A24 variant and updates the spatiotemporal dynamics in the population with acute hemorrhagic conjunctivitis.

OBJECTIVES: The coxsackievirus A24 variant (CVA24v) has raised a remarkable concern because of its main etiological role in acute hemorrhagic conjunctivitis. METHODS: We conducted a retrospective study to summarize CVA24v isolated from acute hemorrhagic conjunctivitis outbreaks and acute flaccid paralysis surveillance in Shandong province, China during 1988-2020. Phylogenetic and phylogeographic methods based on the VP1 coding region were used to determine the CVA24v origin, spatiotemporal dynamics, and evolution. Also, the positive selection sites in the VP1 gene were identified and exhibited in the tertiary structure. RESULTS: The global CVA24vs were classified into eight genotypes (GⅠ-GⅧ). Here, 12 CVA24v isolates were detected, of which five strains were typed as two novel genotypes (GⅦ and GⅧ) and reported first in the world. The time to the most recent common ancestor of the global CVA24v was estimated around March 1965 and evolved with 5.573 × 10-3 substitutions/site/year. Four residues under positive selection were detected, and residue 146T might be adapted in the CVA24v pandemic. Phylogeographic analysis indicated that China was the main source sink for CVA24v dispersion in a long-lasting global pattern. CONCLUSION: Our study updated the epidemiological characteristics of CVA24v and enabled a better understanding of the molecular mechanism underlying different genotypes. The results provided new insights into the CVA24v origin, spatiotemporal dynamics, and possibly, the determinants of viral tropism and pathogenicity.

Detection of multiple human astroviruses in sewage by next generation sequencing.

Human astrovirus (HAstV) composes of classic HAstV serotypes 1-8 and recently discovered novel HAstV-MLB and HAstV-VA strains. A number of studies have demonstrated that wastewater analysis is an effective approach to understand the prevalence and diversity of enteric viruses in local population. However, a comprehensive analysis of classic and novel HAstVs in sewage is still lacking. In this study, sewage samples were collected monthly from Jinan, China during 2018-2019. Quantification of HAstV genomes was performed by real-time quantitative PCR. Different from previous studies which focused on partial ORF1b or ORF2 gene, complete ORF2 region of HAstV was amplified from sewage concentrates, and amplicons were subjected to next generation sequencing (NGS) and genetic analysis. This methodology allowed detection of 18 astroviruses, of which 7 (HAstV-1, -2, -4, -5, VA1, VA2, and VA3) were detected in all sewage samples. A new strain VA6 mapped to the HMO clade was identified in 20.8% of samples, with 82.4%-83.3% nucleotide identities to the closest strain VA5. The viral load of classic, MLB and VA clades in sewage samples ranged from 3.7 × 104 to 4.6 × 107, 3.4 × 104 to 3.9 × 106, and 3.3 × 104 to 4.1 × 106 copies per liter, respectively. Phylogenetic analysis based on complete ORF2 region reflected local HAstVs within each genotype constituted multiple co-circulating lineages. Existence of several new lineages composed exclusively or predominantly of Chinese sequences was observed as well. These results demonstrate sewage contains astroviruses with considerable high diversities. NGS based environmental surveillance greatly improves the understanding of HAstV circulation and should be encouraged.

Comparative study on molecular epidemiology of measles H1 outbreak and sporadic cases in Shandong Province, 2013-2019.

BACKGROUND: Measles caused by measles virus (MeV) is a highly contagious viral disease which has also been associated with complications including pneumonia, myocarditis, encephalitis, and subacute sclerosing panencephalitis. The current study isolated 33 strains belonging to 2 groups, outbreak and sporadic strains, in 13 cities of Shandong province, China from 2013 to 2019. Comparison of genetic characterization among 15 outbreak strains and 18 sporadic strains was performed by analyzing nucleotide sequences of the C-terminal region of N protein gene (N-450). RESULTS: All 33 stains belonged to genotype H1. The outbreak strains and sporadic strains distributed crossly in phylogenetic tree. Sequences alignment revealed some interesting G to A transversion which changed the amino acids on genomic sites 1317, 1422, and 1543. The nucleotide and amino acid similarities among outbreak isolates were 98-100% (0-10 nucleotide variations) and 97.7-100%, respectively; They were 97.3-100% and 96.6-100%, respectively for sporadic isolates. Evolutionary genetics analysis revealed that the mean evolution rates of outbreak and sporadic isolates were 1.26 N 10- 3 and 1.48 N 10- 3 substitutions per site per year separately, which were similar with corresponding data before 2012. Local transmission analysis suggested that there were three transmission chains in this study, two of them originated from Japan. Outbreak cases and sporadic cases emerged alternatively and were reciprocal causation on the transmission chains. CONCLUSIONS: Our study investigated the phylogeny and evolutional genetics of MeV during a 7-year surveillance, and compared epidemic and genetic characteristics of outbreak strains and sporadic strains. These results underscore the importance of evolutionary study alongside with sporadic cases in discovering and tracing possible outbreaks, especially in the stage of measles elimination.

Genetic diversity and molecular epidemiological characterization of group A rotaviruses in raw sewage in Jinan by next generation sequencing.

OBJECTIVE: To understand the genetic diversity and molecular epidemiology characteristics of group A Rotavirus (RVA) in domestic sewage through next generation sequencing (NGS), and to explore the feasibility and necessity of NGS method for RVA environmental surveillance. METHODS: In this study, two sewage samples from Jinan each quarter in 2019 were selected for concentration, RNA extraction, and then RT-PCR reaction. The amplified positive products were subjected to NGS. Finally, the results were analyzed for diversity and phylogeny. RESULTS: A total of 9 G-genotypes and 13 P-genotypes were detected. The Simpson diversity indices in autumn and winter were relatively high. Phylogenetic analysis showed that the dominant types G9 and P[8] were closely related to human-derived sequences. CONCLUSIONS: This study proves that environmental surveillance as a means to understand the prevalence of RVA in the population is not only feasible but necessary. NGS based environmental surveillance greatly improves our understanding on RVA genetic diversity, and should be encouraged as a sensitive surveillance tool.

Prevalence and Bayesian Phylogenetics of Enteroviruses Derived From Environmental Surveillance Around Polio Vaccine Switch Period in Shandong Province, China.

We present the results of environmental surveillance for poliovirus (PV) and non-poliovirus (NPEV) around the switch from trivalent to bivalent oral polio-vaccine (OPV) which occurred in China in May 2016. Sewage samples were collected in Jinan and Linyi city from 2015 to 2017. Enterovirus (EV) isolation, VP1 amplification, Sanger sequencing, and phylogenetic analyses were performed. Among105 sewage samples (36 in Jinan and 69 in Linyi), 101 were positive for EV, with 74.3% (78/105) PV-positive samples and 90.5% (95/105) NPEV-positive samples. A total of 893 EV isolates were obtained, including 326 (36.5%) PVs and 567 (63.5%) NPEVs. Echovirus (E) -11 was the most common serotype out of 18 detected NPEV types (120/567), followed by E-3 (75/567) and E-6 (74/567). PV2 vanished and PV3 came to be the ascendant PV type in sewage after May 2016. Eight PV isolates were judged as pre-vaccine-derived poliovirus (pre-VDPV) and no VDPV or wild PV isolates were monitored. Bayesian phylogenetics demonstrated global E-11 originated in 1876 and evolved with the estimated rate of 4.63 × 10-3 nucleotide substitutions per site per year (s/s/y). Multiple circulating clusters that originated at different times were coexisting in Shandong province. The most recently common ancestor of global coxsackievirus B5 could date back to 1867, at the evolutionary rate of 3.95 × 10-3 s/s/y. In conclusion, our study described the changes of PVs and NPEVs around the polio vaccine switch period and provided meaningful global molecular epidemiological data for further studies of EV-related diseases among the population.

Effect of Beta-Blocker Use on Exercise Heart Rate Gradient and Reclassification of Mortality Risk in Patients Referred for Exercise Testing.

Impairments in heart rate (HR) reserve and HR recovery are associated with mortality, and the combination of these two, termed exercise HR gradient (EHRG), is a better predictor than either alone. However, the confounding effect of beta-blockade on chronotropic impairment to exercise has not been fully explored; the aim of the present study was to evaluate the effect of beta blockade on EHRG. Participants were 2769 Veterans (58.7 ± 11.6 years) who underwent a maximal exercise test for clinical reasons. HR reserve and HR recovery were acquired and divided into quintiles and summed to provide an EHRG score. Net reclassification improvement (NRI) was performed to evaluate the impact of HR reserve, HR recovery and EHRG on all-cause mortality for patients with and without beta-blocker use. During a mean follow up of 10.9 ± 4.1 years, 657 patients died. Among patients without beta-blocker therapy, adding EHRG score to an established model including multiple baseline risk factors and exercise capacity resulted in an NRI of 14.3% (p <0.001). Adding HR recovery instead of EHRG score yielded an NRI of 11.5% (p <0.001), whereas HR reserve had no significant NRI among patients without beta-blocker therapy. In contrast, among participants on beta-blocker therapy, the addition of HR reserve, HR recovery, or EHRG score did not result in any significant reclassification. In conclusion, EHRG was superior to both HR reserve and HR recovery in predicting mortality and provides significant reclassification of risk but only among patients not taking beta-blockers.

Complete genome characterization of three enterovirus C96 isolates in China.

Enterovirus C96 (EV-C96) is a newer member of the species Enterovirus C. In this study, we determined the complete genome sequences of three EV-C96 isolates, one recovered from domestic sewage in 2013 and the other two isolated during surveillance of acute flaccid paralysis cases in 1991 and 2009, respectively. The complete genome sequences of these isolates were 75.6-84.2% identical to each other, 75.1-81.8% identical to the prototype strain, and 75.0-91.5% identical to other previously reported strains. Phylogenetic analysis of VP1 sequences revealed a high degree of genetic divergence among currently available EV-C96 sequences in the GenBank database, with an overall mean p-distance of 0.176. It is interesting to note that the 1991 strain 127/SD/CHN/1991 is the earliest EV-C96 isolate so far. Although EV-C96 is not frequently isolated during enterovirus surveillance, its great genetic diversity and the above findings suggest that this serotype has been circulating in China for many years.

Analysis of enterovirus types in patients with symptoms of aseptic meningitis in 2014 in Shandong, China.

We reviewed the epidemiological and clinical characteristics of 927 aseptic meningitis patients in Shandong in 2014, and the phylogeny of predominant enterovirus (EV) types causing this disease was analyzed. A total of 209 patients that were positive for EV were identified by both cell culture and a reverse transcription-seminested PCR in cerebrospinal fluid samples. The positive patients were most likely to be children within 15 years of age, had symptoms such as fever, vomiting and nausea (P＜ .05). The 209 EV sequences belonged to 11 types, and coxsackievirus B5, echovirus types 6 and 30 were predominant types. VP1 analysis exhibited multiple lineages were co-circulating. The significance of the study could come from the fact that surveillance is important to monitor the prevalence of EV types in population, which shows enterovirus meningitis maintains an important public health problem in China.

Evolutionary phylogeography and transmission pattern of echovirus 14: an exploration of spatiotemporal dynamics based on the 26-year acute flaccid paralysis surveillance in Shandong, China.

BACKGROUND: Echovirus 14 (E-14) causes various clinical recognized syndromes, mostly with gastrointestinal syndrome and paralysis. The current study summarized the Shandong E-14 strains isolated from a 26-year acute flaccid paralysis (AFP) surveillance, and elucidated the characterization of phylogenetic and phylogeographic relationships of E-14 worldwide. RESULTS: As a predominant serotype circulating in AFP surveillance, phylogenetic analysis showed that E-14 exhibited both time and geographic subdivision worldwide. In order to know the evolutionary history and spatial temporal dynamics of E-14, evolutionary phylogeography was reconstructed using BEAST and SPREAD software based on the VP1 sequences. The time of the most recent common ancestor of E-14 was estimated around 85 years and evolved with 9.17 × 10-3 substitutions/site/year. Phylogeographic analysis suggested that two regional transmissions of E-14 were mainly detected, with one located between Europe and Africa countries and the other was in the Asia-Pacific region. CONCLUSIONS: Our study investigates the molecular evolution and phylogeographic of E-14, and brings new insight to the dispersal of E-14 worldwide. Regional transmission was mainly detected and Australia may be responsible for the spread of E-14 in recent years.

Continuous detection and genetic diversity of human rotavirus A in sewage in eastern China, 2013-2014.

BACKGROUND: Rotavirus is the leading viral agent for pediatric gastroenteritis. However, the case-based surveillance for rotavirus is limited in China, and its circulation in the environment is not well investigated. METHODS: From 2013 to 2014, rotavirus was detected in raw sewage samples of Jinan and Linyi by quantitative PCR (qPCR) and conventional reverse transcription PCR (RT-PCR). After sequenced and genotyped, sequences analysis was conducted. RESULTS: A total of 46 sewage samples were collected monthly for the detection of rotavirus, and rotavirus was positive in 43 samples (93.5 %, 43/46). By quantitative assessment, the concentrations of rotavirus in raw sewage ranged from 4.1 × 10(3) to 1.3 × 10(6) genome copies (GC)/L in Jinan, and from 1.5 × 10(3) to 3.0 × 10(5) GC/L in Linyi. A total of 318 sequences of 5 G-genotypes and 318 sequences of 5 P-genotypes were obtained. G9 (91.8 %, 292/318) and P[8] (56.0 %, 178/318) were the most common G- and P-genotype, respectively. Multiple transmission lineages were recognized in these genotypes. Interestingly, an intragenic recombination event between two G9 lineages was observed. CONCLUSIONS: This study provided the first report of comprehensive environmental surveillance for rotavirus in China. The results suggest that the concentration of rotavirus in raw sewage was high, and multiple rotavirus transmission lineages continuously co-circulated in Shandong.

One-year Survey of human enteroviruses from sewage and the factors affecting virus adsorption to the suspended solids.

This study described the results of environmental enterovirus surveillance conducted in Shandong Province of China in 2013. Altogether 39 sewage samples were collected and 873 enterovirus isolates (including 334 polioviruses) belonging to 22 serotypes were obtained. Echovirus (E) -7, coxsackievirus (CV) -B5, E-11, E-6, and E-3 were the most commonly detected non-polio enterovirus serotypes, and phylogeny of E-7 and CV-B5 was described. The numbers of isolates of different serotypes from sewage supernatant were compared with those from the solids. Interestingly, dramatic divergence was observed between the supernatant and solids origin for the serotypes of E-3 and E-6, which were prone to the solids and supernatant, respectively. A following adsorption test with E-3 and E-6 added sewage specimens confirmed the different preference. Furthermore, the adsorption of Sabin poliovirus type 1 to the solids under different conditions was investigated, and the results showed that acid medium, cold temperature, and high solids concentration facilitated the viral adsorption to the solids, whereas change of virus titer did not influence the proportion of adsorption. These results highlighted the importance of combining the enterovirus isolates from the supernatant and solids together in environmental surveillance so as to better understand the local circulation of different serotypes.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Molecular characterization of coxsackievirus A21 in Shandong, China.

Coxsackievirus A21 (CV-A21) is a rarely detected serotype belonging to the species Enterovirus C (EV-C). In this study, we report the isolation and genetic characterization of CV-A21 in Shandong Province, China, during 1997 to 2013. A total of 13 strains were obtained from surveillance of cases of acute flaccid paralysis (AFP) (n = 9) and from environmental sewage (n = 4). Sequence comparison of the VP1 genes revealed high nucleotide sequence similarity (94.1 % to 99.8 % identity) among these Shandong strains during the period of 17 years and 75.8 % to 98.5 % sequence identity to foreign strains. Bayesian phylodynamic evolutionary analysis of Shandong and global CV-A21 VP1 sequences revealed that the inferred CV-A21 ancestral sequence dated back to 1750 (1643-1841) and evolved with 2.943 × 10(-3) substitutions per site per year. Alignment of the deduced VP1 amino acid sequences revealed changes that might alter the hydropathicity of the encoded protein. The complete genome of one strain from 2013 was sequenced and evidence of recombination was detected by similarity plot and bootscanning analyses. This study describes the complete genome characterization and molecular epidemiology of CV-A21 in China and gives further insight into CV-A21 evolution.

[Detection and Molecular Epidemiology of Norovirus, Rotavirus and Human Astrovirus in Domestic Sewage].

To assess the significance of environmental surveillance in the control and prevention of viral gastroenteritis, we analyzed the molecular characteristics of norovirus (NoV), rotavirus(RV),and human astrovirus (HAstV), sequences detected in domestic sewage. Environmental sewage monitoring sites were set up in three cities in Shandong, China. RNA was extracted from seven sewage samples collected each year from 2009 to 2015.RT-PCR detection of norovirus, rotavirus, and human astrovirus was performed. Positive PCR segments were cloned into a T-vector, transformed and sequenced, and genotyping and phylogenic analysis performed. A total of 210 viral sequences belonging to 6NoV I,4NoV II,3RV G,3RV P and 4HAstV were obtained.GI.2,GII.4,G9,P[8],and HAstV-1were the most frequently detected types. Phylogenetic analysis revealed multiple transmission chains in the genotypes of GI.3,GI.6,GII.4,G9,P[8],HAstV-1,and HAstV-4.The results showed not only that sewage contains dramatic information regarding gastroenteritis viruses, but also that environmental surveillance is an important approach in monitoring the regional circulation of specific viruses.

Environmental Surveillance of Genogroup I and II Noroviruses in Shandong Province, China in 2013.

Noroviruses are the most common cause of epidemic gastroenteritis. However, the case-based surveillance is limited in China. In this study, we analyzed the results of environmental surveillance conducted in two cities of Shandong Province, China from January to December in 2013. Twenty-four sewage samples were collected and concentrated via membrane absorption/elution method. After reverse transcription-PCR, cloning and sequencing on ORF2 region, norovirus nucleic acid was detected in all 24 sewage samples. A total of 403 norovirus sequences of 16 genotypes were detected, among which GII.3 (22.6%), GI.2 (17.1%), GI.5 (13.4%), GI.3 (11.9%), GII.4 (7.7%), and GII.6 (6.7%) were the 6 most common genotypes. Phylogenetic analysis revealed multiple lineages within most common genotypes, especially in GI.3, whereas all GII.4 sequences belonged to Sydney 2012 strain. Recombination events were observed in 5 GI and 4 GII sequences within or near the ORF1/ORF2 overlap. This is the first report on systematic environmental surveillance on norovirus in China. The data presented here reveal co-circulation and high genetic diversity of multiple norovirus genotypes in the two cities, and suggest continued environmental surveillance can provide valuable information on norovirus circulation in the population.

[Investigation of a Patient with Pre-vaccine-derived Poliovirus in Shandong Province, China].

To analyze the genetic characteristics of a polio-I highly variant vaccine recombinant virus in Shandong Province (China) in 2011 and to identify isolates from healthy contacts, two stool specimens from one patient with acute flaccid paralysis (AFP) and 40 stool specimens from his contacts were collected for virus isolation. The complete genome of poliovirus and VP1 coding region of the non-polio enterovirus were sequenced. Homologous comparison and phylogenetic analyses based on VP1 sequences were undertaken among coxsackievirus (CV) B1, CV-B3 isolates, and those in GenBank. One poliovirus (P1/11186), CV-A4 and CV-A8 were isolated from the AFP patient; one CV-A2, Echovirus 3 (E-3), E-12 and E-14, ten CV-B1, and five CV-B3 strains were isolated from his contacts. These results led us to believe that there may be a human enterovirus epidemic in this area, and that surveillance must be enhanced. P1/11186 was a type-1 vaccine-related poliovirus; it combined with type-2 and type-3 polioviruses in 2A and 3A regions, respectively. There were 25 nucleotide mutations with 9 amino-acid alterations in the entire genome. There were 8 nucleotide mutations with 5 amino-acid alterations in the VP1 region compared with the corresponding Sabin strains. Homology analyses suggested that the ten CV-B1 isolates had 97.0%-100% nucleotide and 98.9%-100% amino-acid identities with each other, as well as 92.6%-100% nucleotide and 99.2%-100% amino-acid identities among the five CV-B3 isolates. Phylogenetic analyses on the complete sequences of VP1 among CV-B1 and CV-B3 isolates showed that Shandong strains, together with strains from other provinces in China, had a close relationship and belonged to the same group.