Viral Loads in Congenital Cytomegalovirus Infection From a Highly Immune Population.

Among newborns with congenital cytomegalovirus (CMV) infection from China, there was no difference in CMV viral load in saliva specimens dried and stored at room temperature compared with those kept wet and stored cold, even after longer storage time for the former than the later (74 vs 58 days, P = .02).

Characterization of Vibrio cholerae isolates from 1976 to 2013 in Shandong Province, China

Abstract Cholera continues to be a serious public health issue in developing countries. We analyzed the epidemiological data of cholera from 1976 to 2013 in Shandong Province, an eastern coastal area of China. A total of 250 Vibrio cholerae isolates were selected for PCR analysis of virulence genes and pulsed-field gel electrophoresis (PFGE). The analysis of the virulence genes showed that the positive rates for tcpA and tcpI were the highest among strains from the southwest region, which had the highest incidence rate of cholera. Low positive rates for tcpA, tcpI and ctxAB among isolates from after 2000 may be an influencing factor contributing to the contemporary decline in cholera incidence rates. Spatiotemporal serotype shifts (Ogawa, Inaba, Ogawa, Inaba and O139) generally correlated with the variations in the PFGE patterns (PIV, PIIIc, PIa, PIIIb, PIIIa, PIb, and PII). O1 strains from different years or regions also had similar PFGE patterns, while O139 strains exclusively formed one cluster and differed from all other O1 strains. These data indicate that V. cholerae isolates in Shandong Province have continually undergone spatiotemporal changes. The serotype switching between Ogawa and Inaba originated from indigenous strains, while the emergence of serogroup O139 appeared to be unrelated to endemic V. cholerae O1 strains.

Cohort study on maternal cytomegalovirus seroprevalence and prevalence and clinical manifestations of congenital infection in China.

Congenital cytomegalovirus (CMV) infection is the leading viral cause of birth defects and developmental disabilities in developed countries. However, CMV seroprevalence and burden of congenital CMV infection are not well defined in China.Cohort of newborns from 5 birthing hospitals in 2 counties of Shandong Province, China, were enrolled from March 2011 to August 2013. Dried blood spots (DBS) and saliva were collected within 4 days after birth for IgG testing for maternal seroprevalence and real-time PCR testing for congenital CMV infection, respectively.Among 5020 newborns tested for CMV IgG, 4827 were seropositive, resulting in CMV maternal seroprevalence of 96.2% (95% confidence interval [CI]:95.6%-96.7%). Of the 10,933 newborns screened for congenital CMV infection, 75 had CMV detected, resulting in an overall prevalence of 0.7% (95% CI: 0.5%-0.9%), with prevalences of 0.4% (14/3995), 0.6% (66/10,857), and 0.7% (52/7761) for DBS, wet saliva, and dried saliva specimens screened, respectively. Prevalence of congenital CMV infection decreased with increasing maternal age (0.9%, 0.6%, and 0.3% among newborns delivered from mothers aged 16-25, 26-35, and >35 years, respectively; P = 0.03), and was higher among preterm infants than full term infants (1.3% vs 0.6%, P = 0.04), infants with intrauterine growth restriction (IUGR) than those without (1.8% vs 0.7%, P = 0.03), and twins or triplets than singleton pregnancies (2.8% vs 0.7%, P = 0.04). None of the 75 newborns exhibited symptomatic congenital CMV infection, and there was no difference in clinical characteristics and newborn hearing screening results between infants with and without congenital CMV infection at birth.Congenital CMV infection prevalence was lower and the clinical manifestations were milder in this relatively developed region of China compared to populations from other countries with similarly high maternal seroprevalence. Follow-up on children with congenital CMV infection will clarify the burden of disabilities from congenital CMV infection in China.

Characterization of Vibrio cholerae isolates from 1976 to 2013 in Shandong Province, China.

Cholera continues to be a serious public health issue in developing countries. We analyzed the epidemiological data of cholera from 1976 to 2013 in Shandong Province, an eastern coastal area of China. A total of 250 Vibrio cholerae isolates were selected for PCR analysis of virulence genes and pulsed-field gel electrophoresis (PFGE). The analysis of the virulence genes showed that the positive rates for tcpA and tcpI were the highest among strains from the southwest region, which had the highest incidence rate of cholera. Low positive rates for tcpA, tcpI and ctxAB among isolates from after 2000 may be an influencing factor contributing to the contemporary decline in cholera incidence rates. Spatiotemporal serotype shifts (Ogawa, Inaba, Ogawa, Inaba and O139) generally correlated with the variations in the PFGE patterns (PIV, PIIIc, PIa, PIIIb, PIIIa, PIb, and PII). O1 strains from different years or regions also had similar PFGE patterns, while O139 strains exclusively formed one cluster and differed from all other O1 strains. These data indicate that V. cholerae isolates in Shandong Province have continually undergone spatiotemporal changes. The serotype switching between Ogawa and Inaba originated from indigenous strains, while the emergence of serogroup O139 appeared to be unrelated to endemic V. cholerae O1 strains.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

[Isolation and characterization of a human enterovirus 74 isolated in Shandong Province, China].

Human Enterovirus HEV 74 is a new member of species Human enterovirus B (HEV-B). To understand its evolution and restructuring characteristics, we report the complete genome sequence of a HEV74 strain 05293/SD/CHN/2005(abbreviated as 05293) isolated from an acute flaccid paralysis (AFP) case in Shangdong Province, China, 2005. Analysis of the complete genomic sequence of 05293 showed that its genome was collinear with that of previously described 2 HEV74 strains, except for insertions and deletions at the 5'NTR and the 3 NTR regions. The complete genome sequence of strain 05293 displayed 80. 8% nucleotide and 96% amino acid identity to the prototype strain USA/CA75-10213, and 80. 6% and 95. 9% to another isolated strain Rikaze-136. The P1, P2 and P3 coding regions of strain 05293 displayed 81. 5%, 80. 0%, 79. 7% nucleotide and 95. 9%, 96. 0%, 96.2% amino acid identity to the prototype strain USA/CA75-10213, and 81. 9%, 78. 8%, 79. 5% and 95. 9%, 96. 1%, 95. 7% to strain Rikaze-136, respectively. The phylogenetic tree and Simplot analysis on 05293 and HEV-B genome sequences were performed, and the result indicated frequent recombination within HEV-B.

[Advances in the structure and function of pandemic A/H1N1/2009 influenza virus HA protein].

Since March 2009, pandemic A/H1N1/2009 influenza virus has been spreading throughout many countries including China. The emerged virus caused great harm to human health and social economy. Hemagglutinin (HA) is the most important viral surface glycoprotein, mainly possessing three kinds of functions: (1) binding to host cell receptor, (2) triggering the fusion between viral envelop and target cell membrane, (3) stimulating the body to generate the neutralizing antibody. Advances in the structure, primary function, evolution and antigenicity of pandemic A/H1N1/2009 influenza virus HA protein are reviewed in this paper.

Bisexual behavior and infection with HIV and syphilis among men who have sex with men along the east coast of China.

This study examined the correlates of bisexual behavior and infection with HIV/syphilis among men who have sex with men only (MSM-only) and those who have sex with both men and women (MSMW) in Shandong, China. Cross-sectional surveys probed sociodemographic information, sexual and drug use behaviors, knowledge, and use of prevention services; blood samples were tested for HIV/syphilis status. Of 2996 participants, 39.5% acknowledged being MSMW; 60.5% being MSM-only; 2.5% were HIV-infected with similar rates for MSMW (2.5%) and MSM-only (2.6%); 5.5% syphilis-infected with comparable rates for MSMW (5.6%) and MSM-only (5.5%). In multivariable models, MSMW were more likely than MSM-only to be older, local residents, recruited from outdoor cruising area, drug users, and less likely to have used a condom during last anal sex with a male partner. HIV-infected MSMW were more likely to have syphilis and other sexually transmitted diseases (STDs) and less likely to have received peer education. HIV-infected MSM-only were more likely to be older, nonlocal residents, and have syphilis and other STDs. MSMW with syphilis were more likely to be recruited from Jinan, Qingdao, and Zibo (versus Yantai), infected with HIV, and less likely to have received lubricant promotion. MSM-only with syphilis were more likely to be recruited from Jinan and Qingdao (versus Yantai), drug users, infected with HIV, and have had sex with male partners in the past 6 months. High prevalence of bisexual behavior and HIV/other STDs with common unprotected sex and multiple sexual partners among Shandong's gay community revealed in this study highlighted the importance of bisexuals as a potential epidemiologic bridge. Further research is needed to investigate the impact of bisexual behaviors on population transmission.

Rubella virus genotypes in the People's Republic of China between 1979 and 2007: a shift in endemic viruses during the 2001 Rubella Epidemic.

The incidence of rubella cases in China from 1991 to 2007 was reviewed, and the nucleotide sequences from 123 rubella viruses collected during 1999 to 2007 and 4 viral sequences previously reported from 1979 to 1984 were phylogenetically analyzed. Rubella vaccination was not included in national immunization programs in China before 2007. Changes in endemic viruses were compared with incidences of rubella epidemics. The results showed that rubella epidemics occur approximately every 6 to 8 years (1993/1994, 2001, and 2007), and a shift of disease burden to susceptible young adults was observed. The Chinese rubella virus sequences were categorized into 5 of the 13 rubella virus genotypes, 1a, 1E, 1F, 2A, and 2B; cocirculations of these different genotypes were found in China. In Anhui province, a shift in the predominant genotype from 1F and 2B to 1E coincided with the 2001 rubella epidemic. This shift may have occurred throughout China during 2001 to 2007. This study investigated the genotype distribution of rubella viruses in China over a 28-year period to establish an important genetic baseline in China during its prevaccination era.

Comparison of four methods using throat swabs to confirm rubella virus infection.

Laboratory tests are essential for confirming sporadic cases and outbreaks of rubella. Detection of rubella virus is often necessary to confirm rubella cases and to identify specimens to be used to characterize wild-type rubella viruses. The sensitivities of four methods for detecting rubella virus infection using throat swabs, which had been collected in Henan and Anhui provinces in China, were evaluated. The methods used were reverse transcription (RT)-PCR followed by Southern hybridization using RNA extracted directly from clinical specimens, virus growth in tissue culture followed by virus detection by RT-PCR, low-background immunofluorescence in infected tissue culture cells using monoclonal antibodies to the structural proteins of rubella virus, and a replicon-based method of detecting infectious virus. Among these four methods, direct RT-PCR followed by hybridization was the most sensitive method; the replicon-based method was the least difficult to perform.

Molecular epidemiology of measles viruses in China, 1995-2003.

This report describes the genetic characterization of 297 wild-type measles viruses that were isolated in 24 provinces of China between 1995 and 2003. Phylogenetic analysis of the N gene sequences showed that all of the isolates belonged to genotype H1 except 3 isolates, which were genotype A. The nucleotide sequence and predicted amino acid homologies of the 294-genotype H1 strains were 94.7%-100% and 93.3%-100%, respectively. The genotype H1 isolates were divided into 2 clusters, which differed by approximately 2.9% at the nucleotide level. Viruses from both clusters were distributed throughout China with no apparent geographic restriction and multiple co-circulating lineages were present in many provinces. Even though other measles genotypes have been detected in countries that border China, this report shows that genotype H1 is widely distributed throughout the country and that China has a single, endemic genotype. This important baseline data will help to monitor the progress of measles control in China.

[Epidemiological analysis of cases with rash and fever illness after measles vaccine inoculation during 1999 to 2002 in Shandong province, China].

OBJECTIVE: To study the incidence of cases with rash and fever illness (RFIs) after measles vaccine (MV) inoculation. METHODS: During 1999 to 2002, 150 RFIs cases reported by the special measles surveillance system in Shandong province, China, were investigated and analyzed epidemiologically. RESULTS: 7 674 690 ml MV were distributed during 1999 to 2002 and the annual average incidence of RFIs cases after MV inoculation was 0.20/10 000 ml (0.2 ml per dose). There was significant difference of incidences each year (chi(2) = 10.13, P < 0.05). All RFIs cases were sporadically distributed without epidemiological links. Clinical symptoms showed that 88.67% of the 150 RFIs cases having > 38.5 degrees C fever and 75.33% of all cases appeared typical rash after 4 to 11 days (the medium was 8 days) after MV inoculation. The order of rash onset among RFIs cases was consistent with that of regular measles cases caused by wild virus. 68.67% of the RFIs cases had first MV inoculation and 94.71% were 8 to 12 month-olds. IgM sera antibody test from RFIs cases were rubella negative and 45.65% positive for measles. CONCLUSION: RFIs due to allergic reaction or measles vaccine virus infection might occur after MV inoculation. There seemed to be a correlation between RFIs incidence and the doses of MV. Measles virus genotype analysis needs to be carried out to confirm if the onset of some RFIs cases is aetiologically associated to MV vaccine virus infection.