Energy and nitrogen utilization of lactating dairy cattle fed increasing inclusion of a high-protein processed corn coproduct.

Advancing technologies of the corn dry-milling ethanol production process includes the mechanical separation of fiber-containing particles from a portion of plant- and yeast-based nitrogenous particles. The resulting high-protein processed corn coproduct (HPCoP) contains approximately 52% crude protein (CP), 36% neutral detergent fiber (NDF), 6.4% total fatty acids (TFA). The objective of this experiment was to examine the effects of replacing nonenzymatically browned soybean meal with the HPCoP on dry matter intake (DMI), energy and N utilization, and milk production of lactating Jersey cows. Twelve multiparous Jersey cows were used in a triplicated 4 × 4 Latin square design consisting of four 28-d periods. Cows were blocked by milk yield and assigned randomly to 1 of 4 treatment diets that contained HPCoP (dry matter [DM] basis) at (1) 0%; (2) 2.6%; (3) 5.4%; and (4) 8.0%. Diets were formulated to be isonitrogenous and thus replace nonenzymatically browned soybean meal with HPCoP in the concentrate mix, while forage inclusion remained the same across diets. Increasing the concentration of HPCoP had no effect on DMI (mean ± SE; 19.9 ± 0.62 kg/d), but tended to linearly increase milk yield (27.8, 28.5, 29.8, and 29.0 ± 1.00 kg/d). Although no difference was observed in the concentration of milk protein with increasing inclusion of HPCoP (3.40% ± 0.057%), the concentration of fat linearly increased with the inclusion of HPCoP (5.05%, 5.19%, 5.15%, 5.47% ± 0.18%). No differences were observed in the digestibility of DM, NDF, CP, TFA, and gross energy averaging 66.6% ± 0.68%, 49.0% ± 1.03%, 66.1% ± 0.82%, 73.6% ± 1.73%, 66.3% ± 0.72%, respectively, with increasing HPCoP inclusion. The concentration of dietary gross energy linearly increased with increasing concentrations of HPCoP (4.25, 4.26, 4.28, and 4.31 ± 0.01 Mcal/kg), but no difference was observed in digestible energy and metabolizable energy (ME) across treatments averaging 2.83 ± 0.033 and 2.53 ± 0.043 Mcal/kg, respectively. Concentration of dietary net energy for lactation (NEL) tended to increase with increasing HPCoP (1.61, 1.72, 1.74, 1.72 ± 0.054 Mcal/kg) with the ratio of NEL:ME increasing linearly with increasing HPCoP inclusion (0.648, 0.676, 0.687, 0.677 ± 0.0124). Results of this study suggest that inclusion of the HPCoP can replace nonenzymatically browned soybean meal and support normal milk production.

Evaluation of the effects of pine-sourced biochar on cattle performance and methane and carbon dioxide production from growing and finishing steers.

A feedlot growing (77-d) and finishing (111-d) experiment was conducted to evaluate the effects of feeding biochar on steer performance, methane and carbon dioxide emissions, and carcass characteristics. Two treatments were evaluated, a control diet without biochar and the same diet with biochar included at 0.8% of dietary DM (growing) or 1.0% of dietary DM (finishing). The growing diet consisted of 40% corn silage, 40% wheat straw, 15% modified distillers grains plus solubles, and 5% supplement, with 0.8% biochar replacing fine ground corn in supplement. The finishing diet consisted of 55% high-moisture corn (HMC), 35% Sweet Bran, 5% wheat straw, and 5% supplement, with biochar replacing 1.0% HMC and added as an ingredient. Biochar was sourced from ponderosa pine wood waste (High Plains Biochar, Laramie, WY) and was 83% C with 426 m2/g surface area for both experiments. Crossbred steers were utilized in the growing (n = 160; initial BW = 363 kg; SD = 16 kg) and finishing (n = 128; initial; BW = 480 kg; SD = 17 kg) experiments, blocked by BW, and assigned randomly to 16 pens. Pens were assigned randomly to one of two treatments (biochar vs. control) with eight replications per treatment. Four pen replications per treatment were paired within BW block and rotated randomly through an emissions barn with two chambers (each treatment was evaluated simultaneously and for two rotations) to capture average weekly emissions of CH4 and CO2. Pen was the experimental unit and chamber was included as a fixed effect for emissions data. There were no statistical differences (P ≥ 0.23) in performance outcomes between treatments for the growing experiment. Dry matter intake (DMI; P < 0.01) and average daily gain (ADG; P = 0.02) were 2.2% and 5.9% lower for biochar-fed steers in the finishing experiment, respectively, resulting in a lighter hot carcass weight (P = 0.10) and lower calculated USDA yield grade (P = 0.02). Emissions of CH4 and CO2 were not affected by biochar inclusion in the growing (P ≥ 0.22) or finishing experiment (P ≥ 0.60). Results from these experiments show no indication that feeding biochar, supplemented at 0.8% (growing), and 1.0% (finishing) of the diet DM, reduces methane emissions in growing or finishing cattle.

Phylosystemics: Merging Phylogenomics, Systems Biology, and Ecology to Study Evolution.

We define phylosystemics, a multidisciplinary strategy uniting short timescale interaction studies from systems biologists and ecologists with the longer timescale studies familiar to evolutionary biologists, taking advantage of methods from network sciences. Phylosystemics superimposes evolutionary information on entities/edges forming interaction networks produced by systems biology and ecology. At the molecular level, phylosystemics could provide evidence to infer and to time the evolution of molecular processes within a single branch of a phylogeny, in particular between the first and last common ancestors of a group arising during a major evolutionary transition. At the ecosystemic level, phylosystemics could culminate with the development of multilayer temporal networks encompassing biotic and abiotic interactions, whose analyses could unravel ecological interactions with evolutionary consequences.

Side effects of powdered sodium carbonate (washing or 'Lectric' soda) used as an oral emetic agent in five dogs.

CASE SERIES: The administration of emetic agents in dogs for the purpose of gastric decontamination is not without risk, although the incidence of adverse effects is unknown and likely under-reported. This case series describes gastrointestinal and respiratory side effects observed in five dogs that were administered powdered sodium carbonate to induce emesis. CLINICAL SIGNIFICANCE: The safety of inducing emesis in dogs using powdered sodium carbonate is discussed.

Use of indirect calorimetry to evaluate utilization of energy in lactating Jersey dairy cattle consuming common coproducts.

The use of coproducts as an alternative feed source is a common practice when formulating dairy rations. A study using 12 multiparous (79 ± 16 d in milk; mean ± standard deviation) lactating Jersey cows was conducted over 5 mo to evaluate the effects of dried distillers grains with solubles (DDGS) or canola meal on milk and gas production. A replicated 4 × 4 Latin square design was used to compare 4 dietary treatments. Treatments comprised a control (CON) containing no coproducts, a treatment diet containing 10% (dry matter basis) low-fat DDGS (LFDG), a treatment diet containing 10% high-fat DDGS (HFDG), and a 10% canola meal (CM) treatment. The crude fat content of the LFDG, HFDG, and CM treatments was 6.05 ± 0.379, 10.0 ± 0.134, and 3.46 ± 0.085%, respectively. Coproducts were included in partial replacement for corn and soybean meal. Indirect headbox-style calorimeters were used to estimate heat production. Dry matter intake and milk yield were similar between all treatments, averaging 17.4 ± 0.56 kg/d and 24.0 ± 0.80 kg, respectively. Milk urea N was affected by treatment and was highest in CON (20.6 mg/dL; 18.0, 19.9, and 18.1 ± 0.62 mg/dL in LFDG, CM, and HFDG, respectively). Heat production per unit of metabolic body weight tended to be affected by treatment and was lowest for CON, and diets containing coproducts were not different (192, 200, 215, and 204 ± 5.91 kcal/kg of metabolic body weight for CON, LFDG, CM, and HFDG, respectively). The concentration of metabolizable energy was affected by dietary treatment; specifically, HFDG did not differ from CON but was greater than LFDG and CM (2.58, 2.46, 2.29, and 2.27 ± 0.09 Mcal/kg for HFDG, CON, LFDG, and CM, respectively). The concentration of net energy balance (milk plus tissue) tended to be affected by dietary treatment; HFDG did not differ from either CON or LFDG, but it was higher than CM (1.38, 1.36, 1.14, and 1.06 ± 0.11 Mcal/kg for HFDG, CON, LFDG, and CM, respectively). Results of this study indicate that milk production and dry matter intake were not affected by feeding common coproducts and that differences may result in whole-animal energy use; fat content of DDGS is a major factor affecting this.

Transporter gene acquisition and innovation in the evolution of Microsporidia intracellular parasites.

The acquisition of genes by horizontal transfer can impart entirely new biological functions and provide an important route to major evolutionary innovation. Here we have used ancient gene reconstruction and functional assays to investigate the impact of a single horizontally transferred nucleotide transporter into the common ancestor of the Microsporidia, a major radiation of intracellular parasites of animals and humans. We show that this transporter provided early microsporidians with the ability to steal host ATP and to become energy parasites. Gene duplication enabled the diversification of nucleotide transporter function to transport new substrates, including GTP and NAD+, and to evolve the proton-energized net import of nucleotides for nucleic acid biosynthesis, growth and replication. These innovations have allowed the loss of pathways for mitochondrial and cytosolic energy generation and nucleotide biosynthesis that are otherwise essential for free-living eukaryotes, resulting in the highly unusual and reduced cells and genomes of contemporary Microsporidia.

Impact of microbial efficiency to predict MP supply when estimating protein requirements of growing beef cattle from performance.

Data from 16 trials were compiled to calculate microbial CP (MCP) production and MP requirements of growing cattle on high-forage diets. All cattle were individually fed diets with 28% to 72% corn cobs in addition to either alfalfa, corn silage, or sorghum silage at 18% to 60% of the diet (DM basis). The remainder of the diet consisted of protein supplement. Source of protein within the supplement varied and included urea, blood meal, corn gluten meal, dry distillers grains, feather meal, meat and bone meal, poultry by-product meal, soybean meal, and wet distillers grains. All trials included a urea-only treatment. Intake of all cattle within an experiment was held constant, as a percentage of BW, established by the urea-supplemented group. In each trial the base diet (forage and urea supplement) was MP deficient. Treatments consisted of increasing amounts of test protein replacing the urea supplement. As protein in the diet increased, ADG plateaued. Among experiments, ADG ranged from 0.11 to 0.73 kg. Three methods of calculating microbial efficiency were used to determine MP supply. Gain was then regressed against calculated MP supply to determine MP requirement for maintenance and gain. Method 1 (based on a constant 13% microbial efficiency as used by the beef NRC model) predicted an MP maintenance requirement of 3.8 g/kg BW and 385 g MP/kg gain. Method 2 calculated microbial efficiency using low-quality forage diets and predicted MP requirements of 3.2 g/kg BW for maintenance and 448 g/kg for gain. Method 3 (based on an equation predicting MCP yield from TDN intake, proposed by the Beef Cattle Nutrient Requirements Model [BCNRM]) predicted MP requirements of 3.1 g/kg BW for maintenance and 342 g/kg for gain. The factorial method of calculating MP maintenance requirements accounts for scurf, endogenous urinary, and metabolic fecal protein losses and averaged 4.2 g/kg BW. Cattle performance data demonstrate formulating diets to meet the beef NRC model recommended MP maintenance requirement (3.8 g/kg S) works well when using 13% microbial efficiency. Therefore, a change in how microbial efficiency is calculated necessitates a change in the proposed MP maintenance requirement to not oversupply or undersupply RUP. Using the 2016 BCNRM to predict MCP production and formulate diets to meet MP requirements also requires changing the MP maintenance requirement to 3.1 g/kg BW.

Case Study: Supplementation of cow-calf pairs grazing smooth bromegrass pastures with ethanol by-products and low-quality forages.

Multiparous, lactating, crossbred (Simmental × Angus) beef cows with spring-born calves at side (n = 16 per year; 4 per pasture) were used each of 3 yr to evaluate supplementing modified distillers grains plus solubles mixed with low-quality forage on cow and calf performance while grazing. Cow-calf pairs were assigned randomly to treatment with 2 replications (pasture) per year for 3 yr. Treatments were (1) recommended stocking rate of 9.46 animal-unit month/ha with no supplementation (CON) or (2) double the recommended stocking rate (18.9 animal-unit month/ha) and supplemented with a 30:70 modified distillers grains plus solubles:cornstalks (DM) mixture (SUPP). To replace 50% of grazed forage DMI, SUPP pairs were fed an average of 1.13% of BW (DM) over the grazing season. Pairs grazed adjacent smooth bromegrass pastures for 130 d during the summer. Gain was not different (P = 0.19) between SUPP and CON cows (0.28 vs. 0.19 kg/d, respectively). Ending cow BW was not affected (P = 0.46) by treatment. Similarly, calf gain was not affected (P = 0.31) by supplementation. In studies where confined cow-calf pairs were fed average-quality (IVDMD = 52.9%) forage, DMI was 2.58% of pair BW. Based on these data, CON and SUPP pairs consumed 18.6 and 19.1 kg of DM, respectively, of total feed per pair daily. The SUPP pairs consumed 7.1 kg of DM/pair daily of the supplement, replacing approximately 35% of grazed forage intake. These data suggest mixtures of ethanol co-products and low-quality forages can be supplemented to replace grazed forage intake of cattle, allowing for increased stocking rate without affecting animal performance.

Using Sweet Bran instead of forage during grain adaptation in finishing feedlot cattle.

Two trials evaluated adapting cattle to a finishing diet using wet corn gluten feed compared with traditional methods using forage. A 33-d grain adaptation metabolism trial (Exp. 1) compared decreasing wet corn gluten feed (Sweet Bran; Corn Milling unit, Cargill Corn Milling, Blair, NE) while increasing corn inclusion (SB) and a traditional grain adaptation system decreasing alfalfa hay while increasing corn with no Sweet Bran inclusion (CON). Ruminal pH, intake characteristics, and 24-h in situ digestibility were evaluated using 8 ruminally fistulated steers (291 kg BW [SD 19]). Steers (4/treatment) were adapted to finishing diets across 4 periods consisting of 5, 7, 7, and 7 d and then fed a finishing diet for 7 d. No period × adaptation diet interactions were observed ( ≥ 0.12). Average ruminal pH decreased ( < 0.01) whereas time and area below a pH of 5.6 increased ( ≤ 0.02) for the SB adaptation system compared with the CON adaptation system. Cattle adapted using SB had greater DMI than cattle adapted using CON ( < 0.01). As steers were adapted to finishing diets, DMI increased ( = 0.01), average ruminal pH decreased ( = 0.05), and time and area below a pH of 5.6 increased ( ≤ 0.04) for both treatments. Ruminal pH for CON steers decreased from 6.59 to 6.12 across periods as corn replaced alfalfa hay whereas ruminal pH decreased from 6.00 to 5.79 for SB steers. Steers adapted using SB had greater ( ≤ 0.05) in situ digestion of adaptation diets than steers adapted using CON for adaptation periods 3, 4, and 5. The SB diets were more digestible than the CON diets when incubated in either CON- or SB-fed steers for adaptation periods 1 and 2 ( < 0.01). Experiment 2 used 240 finishing steers (273 kg BW [SD 14]) to determine performance impacts of using Sweet Bran instead of forage to adapt cattle to finishing diets. Steers were fed either decreasing Sweet Bran inclusion while increasing corn (SB) or decreasing alfalfa hay inclusion while increasing corn (CON). Treatments were applied only during grain adaptation (26 d) and all steers were finished on a common diet containing 35% Sweet Bran for an additional 147 d. Steers adapted using SB had greater ( ≤ 0.01) final BW, ADG, G:F, and HCW compared with steers adapted using CON, even though treatments differed only the first 26 d. Grain adaptation treatment had no effect ( ≥ 0.13) on carcass quality. These results indicate that Sweet Bran can be used to adapt cattle to finishing diets instead of forage and improves ADG and G:F while decreasing the forage needs of feedlots.

Effects of roughage source and inclusion in beef finishing diets containing corn wet distillers' grains plus solubles.

Two experiments were conducted to determine the effects of roughage source and inclusion in diets containing wet distillers' grains plus solubles (WDGS) on finishing cattle performance and ruminal metabolism. In Exp. 1, 385 crossbred steer calves (initial BW = 346 kg [SD 29]) were used in a finishing trial. A control diet with no roughage inclusion was compared with 6 diets containing either alfalfa hay (ALF), corn silage (CSIL), or corn stalks (CSTK) at 2 inclusions as a 3 × 2 factorial. Alfalfa hay was included at 4 (low) or 8% (standard) of diet DM. Diets containing CSIL or CSTK were formulated to provide total dietary NDF equal to the low and standard ALF inclusion diets. The final diets contained 6.13 and 12.26% CSIL or 3.04 and 6.08% CSTK (DM basis). All diets contained 30% WDGS and a 1:1 mixture of dry-rolled and high-moisture corn (DM basis). Cattle fed no roughage had reduced ( < 0.01) DMI and tended ( ≤ 0.10) to have the lowest final BW and ADG compared with cattle fed roughage. There were no differences ( ≥ 0.11) in DMI, ADG, or G:F due to roughage source. Cattle fed a standard inclusion of roughage had greater ( ≤ 0.04) DMI and ADG compared with cattle fed diets with low inclusion, regardless of roughage source. Feed efficiency tended to be different among treatments ( = 0.09), with cattle fed no roughage having greater G:F than all treatments ( ≤ 0.06) except cattle fed the low level of CSTK, which had a similar G:F ( = 0.48). Feed efficiency was not affected by source of roughage ( = 0.23) or inclusion of roughage ( = 0.49). In Exp. 2, 6 ruminally fistulated steers (347 kg BW [SD 25]) were used in a 6 × 6 Latin square design. Treatments were arranged as a 2 × 3 factorial with ALF or CSTK included at zero, low, or standard levels similar to Exp. 1. Apparent total tract digestibility (%) of DM, OM, and NDF decreased linearly ( ≤ 0.07) due to increasing roughage inclusion. Average, maximum, and minimum ruminal pH increased linearly ( ≤ 0.09) as roughage inclusion was increased. Based on the results of this study, low levels of CSTK improved cattle performance relative to low inclusions of ALF or CSIL. Diets with standard inclusions of ALF, CSIL, or CSTK had similar performance. Roughage sources can be exchanged to provide equal NDF in finishing diets containing 30% WDGS without negatively impacting finishing cattle. Based on ADG, eliminating roughages when 30% WDGS was included in finishing diets was not beneficial.

FORAGES AND PASTURES SYMPOSIUM: Optimizing the use of fibrous residues in beef and dairy diets.

Increased corn prices over the past decade have altered land use away from traditional forage in favor of corn. Accordingly, beef and dairy producers have had to adopt nontraditional forage resources into their production systems, many of which have become available as a result of increased corn production. Corn residues have become more available due to increases in corn hectares and yield. The individual plant components (i.e., husk, leaf, and stem) vary in fiber digestibility (NDF digestibility estimates = 40.5, 31.4, and 0.6% ± 0.8 for husk, leaf, and stalk, respectively). Stocking cattle to consume 3.6 kg forage/25.5 kg of grain allows cattle to graze selectively; selection of husks and leaves improves cattle performance. Byproducts of the wet and dry milling industries can be supplemented to calves grazing corn residues to provide protein and energy. Optimal gains were observed when these byproducts were supplemented at approximately 2.5 kg/d to 250-kg growing calves. Gestating beef cows do not require supplemental inputs when grazing corn residue, if stocked appropriately. Alkaline treatment of crop residues improves their feeding value. Concentrations of up to 20% harvested corn residue treated with calcium oxide can be included in finishing diets with an average of 1.3% reduction in G:F when diets contain 40% wet or modified distillers grains. Conversely, when untreated corn residues are included in similar finishing diets, G:F is reduced by 13.4%. Calcium oxide-treated residues included in beef growing diets increases DMI and ADG without significant improvements in G:F. Calcium oxide treatment of corn residues has been evaluated in dairy diets by replacing corn or corn silage with variable results. Efficient use of nontraditional fiber sources, such as corn milling byproducts and corn residue, are critical to the future viability of ruminant animal production.

Impacts of a limit-feeding procedure on variation and accuracy of cattle weights.

Cattle weights can be highly variable and are influenced by many factors, including time of weighing, ambient temperature, feed intake, and cattle handling. A protocol of limit feeding has been in use since the 1980s that was designed to reduce variation in gut fill due to differences in intakes. Cattle are penned and fed a 50% hay, 50% wet corn gluten feed or grain diet (DM basis) at an estimated 2% of BW for at least 5 d, after which weights are taken on 2 consecutive d and averaged for a limit-fed BW (LFW). For this analysis, full-fed weights (FFW) also were taken before the limit-feeding period while cattle had ad libitum intakes. Data from 18 experiments were used to analyze differences within 2-d LFW and between LFW and FFW. For 10 of the 18 experiments, FFW also were measured on 2 consecutive d. Cattle included in this summary were grazing cornstalks, smooth bromegrass pasture, Bermuda grass pasture, fescue pasture, native range, or in a dry lot on a 70% forage diet. The largest differences between FFW and LFW for individual cattle were -39 to +44 kg over all 18 experiments. Differences between 2 consecutive d of LFW were -23 to +24 kg for all 18 experiments. Differences between 2 d of FFW were -14 to +34 kg in the 10 experiments measuring FFW on 2 consecutive d. There was not a clear relationship between FFW and LFW; each weighing scenario had unique environmental conditions that led to different relationships. Differences in both beginning and ending BW were compounded when calculating ADG. Average daily gain was calculated for 15 of the experiments on the basis of either LFW or FFW. Differences between LFW and FFW ADG were -0.29 to +0.31 kg/d. The maximum ADG based on FFW was 1.62 kg/d. This large ADG, on a forage based diet, was likely due to changes in gut fill rather than tissue gain. These data suggest that handling cattle in a similar manner when weighing is more important than limiting intakes to decrease variance between weights. However, limiting intake before collection of beginning and ending BW better estimates empty body weight of cattle, allowing for a more accurate determination of actual body tissue weight gain. Measuring weights accurately becomes especially crucial when evaluating multiple components within a system (e.g., cornstalks to pasture to feedlot). Feeding a standard diet between these components of the system minimizes differences in gut fill due to treatment and allows for a more accurate determination of each component's contribution to the total system.

Ruminally undegradable protein content and digestibility for forages using the mobile bag in situ technique.

Four experiments were conducted to evaluate RUP content and digestibility for smooth bromegrass, subirrigated meadow, upland native range, and warm-season grasses. Samples were collected from esophageally cannulated cows or ruminally cannulated steers. Forages were ruminally incubated in in situ bags for durations of time based on 75% of total mean retention time, which was based on IVDMD and rate of passage calculations. One-half of the bags were duodenally incubated and excreted in the feces, and NDIN was analyzed on all bags for RUP calculations. Crude protein was numerically greater early in the growing cycle for grasses compared with later as grasses matured (P ≤ 0.32). The RUP was 13.3%, 13.3%, and 19.7% of CP for smooth bromegrass, subirrigated meadow, and upland native range, respectively. These values tended to be lower early in the growth cycle and increased (linear P ≤ 0.13) as forages matured for warm-season grasses and subirrigated meadows. Because both CP and RUP content change throughout the growing season, expressing RUP as a percentage of DM gives more consistent averages compared with RUP as a percentage of CP. Coefficient of variation values for RUP as a percentage of DM averaged 0.21 over all 4 experiments compared with 0.26 for RUP as a percentage of CP. Average RUP as a percentage of DM was 2.03%, 1.53%, and 1.94% for smooth bromegrass, subirrigated meadow, and upland native range, respectively. Total tract indigestible protein (TTIDP) linearly increased with maturity for subirrigated meadow samples (P < 0.01). A quadratic response (P ≤ 0.06) for TTIDP was observed in smooth bromegrass and warm-season grass samples. Digestibility of RUP varied considerably, ranging from 25% to 60%. Subirrigated meadow, native range, and smooth bromegrass samples tended to have linear decreases (P ≤ 0.11) in RUP digestibility throughout the growing season. The amount of digested RUP was fairly consistent across experiments and averages for smooth bromegrass, subirrigated meadow, and upland native range were 0.92%, 0.64%, and 0.49% of DM, respectively. Warm-season grasses in Exp. 2 had greater RUP (4.31% of DM) and amount of RUP digested (2.26% of DM), possibly because of cattle selecting for leadplant that contains more CP than the grasses. Forages can vary in CP, RUP, TTIDP, and RUP digestibility depending on the forage type, year, and time within year, but RUP digestibility is likely less than what previous sources have reported.

First Report of a New Disease of Onion in Georgia Caused by a Nonfluorescent Pseudomonas Species.

Since 2007, a new disease of onion (Allium cepa) called yellow bud has been a problem in Georgia. Emerging leaves display intense chlorosis and older leaves exhibit extensive leaf blight. Yield reductions can be severe due to stand loss and reduced bulb size. Symptomatic plants are also more prone to freeze damage. The suspected causal agent is a slow-growing, white bacterium isolated onto nutrient agar (NA) by streak isolation. The bacterium grew more vigorously on NA supplemented with 0.5% yeast extract (NA+). Six strains of the bacterium all had gram-negative, rod-shaped cells and were strict aerobes. The strains produced levan, were negative for oxidase, potato rot, and arginine dihydrolase, and produced a hypersensitive reaction in tobacco. These are all characteristics of Pseudomonas group Ia as outlined by Lelliott et al. (2) and differ from characteristics of known Pseudomonas pathogens of onion such as P. aeruginosa, P. marginalis, and P. viridiflava that belong to groups Va, IVa, and II, respectively. The yellow bud bacterial strains were also nonfluorescent on King's medium B and were ice nucleation active. Universal primers PA16SF and PA16SR (ATCCTGGCTCAGATTGAACG and TTCCCCTACGGTTACCTTGTT) were used to amplify the 16S rRNA gene. The resulting consensus nucleotide sequence (GenBank Accession No. JF939841) of the six isolates matched those strains of P. syringae pv. atropurpurea, P. syringae pv. maculicola, P. syringae pv. porri, and P. amygdali (96 to 98% similarity). Primers 1 and 2 (GGCGCTCCCTCGCACTT and GGTATTGGCGGGGGTGC) were used to amplify the coronafacate ligase (cfl) gene. The resulting consensus nucleotide sequence for the six isolates (GenBank Accession No. JF939842) matched the cfl gene from P. syringae pv. tomato, P. syringae pv. morsprunorum, P. syrinage pv. aesculi, and P. syringae pv. glycinea (97 to 99% similarity). Representative strains had 0.95 to 0.99% similarity to P. syringae pv. coronafaciens using Biolog (Biolog, Hayward, CA), and 0.72 to 0.96% similarity to P. syringaepv. tomato using fatty acid analysis (MIDI Inc., Newark, DE). For each of eight representative yellow bud strains, 10 greenhouse-grown onion seedlings of cv. Pegasus were inoculated on one leaf. Bacteria grown on NA+ were suspended in sterile tap water and adjusted to ~1 × 108 CFU/ml. With a hypodermic syringe and needle, 1.0 ml of inoculum was injected in to the hollow cavity of an emerging onion leaf. Chlorosis developed on inoculated leaves in 5 days and was identical to that observed with natural infections. All inoculated plants died within 14 days, confirming pathogenicity. Bacteria with characteristics described above were reisolated from symptomatic leaves. Ten control plants inoculated with sterile water remained asymptomatic. Based on the methods listed above, the yellow bud bacterium was identified as P. syringae, but pathovar designation or genomospecies (1) could not be determined because results varied among the different methods tested. The disease has been spreading throughout the Vidalia onion-growing region since it was first observed. There is significant potential for the disease to become more widespread since it also has been observed in direct-seeded, onion transplant beds. References: (1) J. P. Euzéby. List of Prokaryotic Names with Standing in Nomenclature-Genus Pseudomonas. Online publication. Retrieved from http://www.bacterio.cict.fr/p/pseudomonas.html , 2010. (2) R. A. Lelliott et al. J. Appl. Bact. 29:470, 1966.

Molecular Monitoring of Wild-Type and Genetically Engineered Colletotrichum coccodes Biocontrol Strains In Planta.

Two strains of Colletotrichum coccodes, the wild type (DAOM 183088) and T-20a, engineered with the necrosis- and ethylene-inducing peptide (NEP1) gene for hypervirulence on velvetleaf (Abutilon theophrasti, Medik.), were monitored in planta for the first 2 weeks after infection. Real-time quantitative polymerase chain reaction (QPCR) was used to assess the extent of colonization of both strains on velvetleaf using SYBR Green chemistry. Quantification of both strains was successful as soon as the conidia were sprayed on the leaves and up to 14 days after infection. The increase in fungal DNA amounts corroborated with the appearance of necrotic lesions on velvetleaf leaves infected with the wild-type strain. The wild-type C. coccodes was more efficient at infecting velvetleaf than the transgenic T-20a strain. In addition, detection of host DNA allowed us to quantitatively monitor the decrease in plant DNA amounts in response to wild-type strain infection. Expression of the NEP1 transgene by conventional retro-transcription (RT)-PCR was absent from T-20a growing on either V8 agar or in planta, suggesting that the gene may be silenced. The application of QPCR to monitor fungal growth was proven to detect the target organisms in planta prior to the appearance of symptoms.

Detection of the biocontrol agent Colletotrichum coccodes (183088) from the target weed velvetleaf and from soil by strain-specific PCR markers.

Diagnostic molecular markers, generated from random amplified polymorphic DNA (RAPD) and used in polymerase chain reaction (PCR), were developed to selectively recognize and detect the presence of a single strain of the biocontrol fungus Colletotrichum coccodes (183088) on the target weed species Abutilon theophrasti and from soil samples. Several isolates of C. coccodes, 15 species of Colletotrichum, a variety of heterogeneous organisms and various plant species were first screened by RAPD-PCR, and a strain specific marker was identified for C. coccodes (183088). No significant sequence similarity was found between this marker and any other sequences in the databases. The marker was converted into a sequence-characterised amplified region (SCAR), and specific primer sets (N5F/N5R, N5Fi/N5Ri) were designed for use in PCR detection assays. The primer sets N5F/N5R and N5Fi/N5Ri each amplified a single product of 617 and 380 bp, respectively, with DNA isolated from strain 183088. The specificity of the primers was confirmed by the absence of amplified products with DNA from other C. coccodes isolates, other species representing 15 phylogenetic groups of the genus Colletotrichum and 11 other organisms. The SCAR primers (N5F/N5R) were successfully used to detect strain 183088 from infected velvetleaf plants but not from seeded greenhouse soil substrate or from soil samples originating from deliberate-released field experiments. The sensitivity of the assay was substantially increased 1000-fold when nested primers (N5Fi/N5Ri) were used in a second PCR run. N5Fi/N5Ri selectively detected strain 183088 from seeded greenhouse soils as well as from deliberate-released field soil samples without any cross-amplification with other soil microorganisms. This rapid PCR assay allows an accurate detection of C. coccodes strain 183088 among a background of soil microorganisms and will be useful for monitoring the biocontrol when released into natural field soils.

Effect of Dew Period and Temperature on the Ability of Exserohilum monoceras to Cause Seedling Mortality of Echinochloa Species.

In greenhouse and controlled environment experiments, disease development and mortality of Echinochloa crus-galli, E. colona, and E. glabrescens caused by Exserohilum monoceras were affected by duration, frequency, and timing of dew period, as well as by dew-period temperature and post-dew temperature. When adequate dew was provided, 100% mortality occurred for all three Echinochloa spp. over the broad dew-period temperature range of 20 to 30°C. The effect of post-dew temperature on disease development varied with the initial dew period. The minimum dew period to achieve 100% mortality was 16 h for E. colona, 12 h for E. crus-galli, and 8 h for E. glabrescens. Increasing dew period enlarged the range of temperature for maximum efficacy, whereas the use of optimum dew-period temperature decreased the dew period requirement. Delaying the initiation of the dew period by 24 h did not adversely affect disease development. Increased disease development occurred for inoculated seedlings treated with repetitive dew periods of shorter duration than the optimal period. These findings characterize one of the epidemiological requirements, i.e., dew requirement, needed to assess the potential of E. monoceras for the control of Echinochloa spp. in rice.

Autotransfusion in the postoperative orthopedic patient.

Transfusion of autologous blood has become increasingly important as an alternative to the use of conventional allogeneic products. Some areas of autotransfusion, like predeposit and intraoperative salvage, are well standardized and generally recommended by physicians. In many orthopedic surgical procedures, the postoperative drainage constitutes a significant percentage of the total perioperative blood loss. Recently, reinfusion of this salvaged, unprocessed autologous blood has been widely advocated; however, reports on its quality are infrequent in the literature. This pilot study, based on sophisticated laboratory testing, describes an efficient method whereby postoperatively shed blood can be appropriately processed and returned to the patient as a relatively safe product.

Mass Culture of Subanguina picridis and Its Bioherbicidal Efficacy on Acroptilon repens.

A Russian knapweed (Acroptilon repens) shoot culture system, initiated from shoot tip culture, was used to generate a source of host plant tissue for the rearing of the nematode Subanguina picridis, a biocontrol agent for Russian knapweed. Young shoots growing on solid B5G medium in petri dishes developed galls on leaves, petioles, and shoot tips 7 days after release of 50 nematodes onto the surface of the medium. After 3 months of culturing, each petri dish yielded 7,000-10,000 nematodes. In vitro cultured Subanguina picridis were virulent on greenhouse-grown Russian knapweed plants. Galls were first found on seedlings 12 days after infestation; after 2 months, 90% of seedlings were galled on leaves, petioles, and shoot tips, with 1-6 galls per seedling. Three months after shoot emergence, 64% of vegetative shoots originating from root segments were also galled by the cultured nematodes. Similarly, vegetatively regenerated shoots of Russian knapweed were also susceptible to infestation by cultured nematodes.

Effects of Temperature, Shoot Age, and Medium on Gall Induction by Subanguina picridis in Vitro.

The influence of temperature, shoot age, and medium on gall induction by Subanguina picridis on Russian knapweed (Acroptilon repens) was examined in vitro. The optimal temperature for gall formation was 20 C. Gall induction was delayed as the temperature decreased, and decreased as shoot age increased. Bud primordia (0-day-old shoots and 5-day-old shoots) with an average length of 4.2 mm and 7.9 mm were the most suitable tissues for nematode development and gall formation. Gall formation was more effective on B5G medium than on MSG. Young shoots under slow growth were most suitable for mass rearing of S. picridis.