Human adenovirus among hospitalized children with respiratory tract infections in Beijing, China, 2017-2018.

BACKGROUND: Human adenoviruses (HAdVs) cause a wide range of diseases. However, the genotype diversity and epidemiological information relating to HAdVs among hospitalized children with respiratory tract infections (RTIs) is limited. Here, we describe the epidemiology and genotype distribution of HAdVs associated with RTIs in Beijing, China. METHODS: Nasopharyngeal aspirates (NPA) were collected from hospitalized children with RTIs from April 2017 to March 2018. HAdVs were detected by a TaqMan-based quantitative real-time polymerase chain reaction (qPCR) assay, and the hexon gene was used for phylogenetic analysis. Epidemiological data were analyzed using statistical product and service solutions (SPSS) 21.0 software. RESULTS: HAdV was detected in 72 (5.64%) of the 1276 NPA specimens, with most (86.11%, 62/72) HAdV-positives cases detected among children < 6 years of age. HAdV-B3 (56.06%, 37/66) and HAdV-C2 (19.70%, 13/66) were the most frequent. Of the 72 HAdV-infected cases, 27 (37.50%) were co-infected with other respiratory viruses, most commonly parainfluenza virus (12.50%, 9/72) and rhinovirus (9.72%, 7/72). The log number of viral load ranged from 3.30 to 9.14 copies per mL of NPA, with no significant difference between the HAdV mono- and co-infection groups. The main clinical symptoms in the HAdV-infected patients were fever and cough, and 62 (86.11%, 62/72) were diagnosed with pneumonia. Additionally, HAdVs were detected throughout the year with a higher prevalence in summer. CONCLUSIONS: HAdV prevalence is related to age and season. HAdV-B and HAdV-C circulated simultaneously among the hospitalized children with RTIs in Beijing, and HAdV-B type 3 and HAdV-C type 2 were the most frequent.

Quantitative detection of human Malawi polyomavirus in nasopharyngeal aspirates, sera, and feces in Beijing, China, using real-time TaqMan-based PCR.

BACKGROUND: Human Malawi polyomavirus (MWPyV) was discovered in 2012, but its prevalence and clinical characteristics are largely unknown. METHODS: We used real-time TaqMan-based PCR to detect MWPyV in the feces (n = 174) of children with diarrhea, nasopharyngeal aspirates (n = 887) from children with respiratory infections, and sera (n = 200) from healthy adults, and analyzed its clinical characteristics statistically. All the MWPyV-positive specimens were also screened for other common respiratory viruses. RESULTS: Sixteen specimens were positive for MWPyV, including 13 (1.47%) respiratory samples and three (1.7%) fecal samples. The samples were all co-infected with other respiratory viruses, most commonly with influenza viruses (69.2%) and human coronaviruses (30.7%). The MWPyV-positive children were diagnosed with bronchopneumonia or viral diarrhea. They ranged in age from 12 days to 9 years, and the most frequent symptoms were cough and fever. CONCLUSIONS: Real-time PCR is an effective tool for the detection of MWPyV in different types of samples. MWPyV infection mainly occurs in young children, and fecal-oral transmission is a possible route of its transmission.

Human polyomavirus type six in respiratory samples from hospitalized children with respiratory tract infections in Beijing, China.

BACKGROUND: HPyV6 is a novel human polyomavirus (HPyV), and neither its natural history nor its prevalence in human disease is well known. Therefore, the epidemiology and phylogenetic status of HPyV6 must be systematically characterized. METHODS: The VP1 gene of HPyV6 was detected with an established TaqMan real-time PCR from nasopharyngeal aspirate specimens collected from hospitalized children with respiratory tract infections. The HPyV6-positive specimens were screened for other common respiratory viruses with real-time PCR assays. RESULTS: The prevalence of HPyV6 was 1.7 % (15/887), and children ≤ 5 years of age accounted for 80 % (12/15) of cases. All 15 HPyV6-positive patients were coinfected with other respiratory viruses, of which influenza virus A (IFVA) (8/15, 53.3 %) and respiratory syncytial virus (7/15, 46.7 %) were most common. All 15 HPyV6-positive patients were diagnosed with lower respiratory tract infections, and their viral loads ranged from 1.38 to 182.42 copies/µl nasopharyngeal aspirate specimen. The most common symptoms were cough (100 %) and fever (86.7 %). The complete 4926-bp genome (BJ376 strain, GenBank accession number KM387421) was amplified and showed 100 % identity to HPyV6 strain 607a. CONCLUSIONS: The prevalence of HPyV6 was 1.7 % in nasopharyngeal aspirate specimens from hospitalized children with respiratory tract infections, as analyzed by real-time PCR. Because the coinfection rate was high and the viral load low, it was not possible to establish a correlation between HPyV6 and respiratory diseases.

[Study on HLA nucleotide sequence matching in epitope positions among recipient-donor pairs for allogenic hematopoietic stem-cell transplantation].

OBJECTIVE: To analyze the human leukocyte antigens(HLA)-A, -B, -Cw, -DRB1 and DQB1 nucleotide sequences between patients waiting for allogenic hematopoietic stem-cell transplantation (HSCT) and donors in Chinese population, and to establish strategy for maximizing optimal donor selection. METHODS: HLA high-resolution typing in a total of 537 recipient-donor pairs was determined by sequence based typing (SBT) method. The nucleotide BLAST tool was used to compare the nucleotide sequences among recipient-donor pairs. RESULTS: Only 16.20% (88/537) of recipient-donor pairs were found to fully match for nucleotide sequences of all HLA-A,-B,-Cw, -DRB1 and -DQB1 loci. Mismatch rate in single locus were 8.38% in HLA-A, 0.74% in HLA-B, 12.29% in HLA-C, 2.42% in HLA-DRB1, and 2.79% in HLA-DQB1, respectively. Mismatch rate in two or multiple HLA loci was 42.65%. Nonpermissive allele mismatch combinations (A 02:01-A 02:06, A 02:06-A 02:07, Cw 03:04-Cw 15:02, Cw 03:03-Cw 04:01, Cw 03:04-Cw 14:02, Cw 03:03-Cw 08:01, DRB1 04:03:01-DRB1 04:05) were detected in single mismatch HLA locus of recipient-donor pairs, mismatches of B 07:05:01-B 07:06, Cw 07:01:01-Cw 07:06 combinations outside of epitope positions were detected in two recipient-donor pairs. CONCLUSION: Our data suggested that attention should be paid in comparing nucleotide sequences between recipient and donor, and in distinguishing nucleotide sequence mismatches within and outside of the epitope positions. These results could serve as guidelines for donor selection.

[Recombination of HLA haplotypes in Guangdong Han nationality].

OBJECTIVE: To analyze the human leukocyte antigen complex class I (-A, -B & -C) and class II (-DRB1 & -DQB1) linked haplotypes of Guangdong Han nationality and to study the recombination events of five classical loci in the inheritance of HLA haplotypes. METHODS: A total of 939 peripheral blood samples were collected from 198 families in Guangdong Han nationality who came to our center for HLA typing from 2000 August to 2009 December. HLA-(A, B & DRB1) and HLA-(C & DQB1) alleles were typed by low-resolution polymerase chain reaction-sequence specific oligonucleotide probes (PCR-SSO) and PCR-sequence specific primers (PCR-SSP) methods respectively. Then the recombination sites were analyzed by familial study. The samples of 52 individuals from the families with exchange recombination were analyzed by the sequence-based typing (SBT) to judge whether the recombination was interallelic or interlocus exchange. RESULTS: Among 543 offspring individuals of 198 families in Guangdong Han nationality, 9 individuals with HLA-A-C-B-DRB1-DQB1 linked haplotypes had a recombination rate of 1.657%. Among 9 HLA haplotypes recombined families, 3 of them were found to have a crossover between HLA-A and -Cw loci and 6 of them a crossover between HLA-B and -DRB1 loci. Four of these recombination events occurred in the most common haplotypes A*3303-Cw*0302-B*5801-DRB1*0301-DQB1*0201 of Guangdong Han nationality. Among 9 cases of recombination, 5 of them were formed by a crossover between maternal chromosomes and 4 cases a crossover between paternal chromosomes. Three individuals with an exchange between A/Cw loci were all females. Among 6 cases with an exchange between B/DRB1 loci, 5 of them were males and 1 case was female. CONCLUSION: During the inheritance, recombination of HLA linked haplotype mainly occurred between A/Cw loci and B/DRB1 loci, the recombination is related to the haplotype-specificity and sex-specificity.

[Cloning and sequencing HLA-A and -B genomic DNA and analyzing polymorphism in regulatory regions in Chinese Han individuals].

In the present study, a high-resolute method for cloning and sequencing genomic full-length HLA-A and -B using 20 Chinese Han individuals was established. We detected 10 HLA-A allele sequences 4.2 kb in length and 6 HLA-B allele sequences 3.7 kb in length, and the sequences included all exons, all introns, 5'promoter, and 3'UTR of the two genes. All sixteen sequences have been submitted to GenBank and IMGT/HLA database. A*1153 is a novel allele, and the introns of B*151101 are firstly reported here. The 5'promoter and 3'UTR sequences of 5 HLA-A alleles and 2 HLA-B alleles are also firstly disclosed, and all other alleles have extended the genomic full length sequences released in IMGT/HLA database. The polymorphic structures of upper 5'promoter and downstream 3'UTR, which were uncovered in IMGT/HLA database, are firstly depicted in Chinese Han individuals. Twenty-six single nucleotide polymorphisms (SNPs) and one 3 bp-insertion/deletion (Indel) were located in the upper 5'promoter and 14 SNPs were located in the 3'UTR of HLA-A. In addition, five SNPs and one 1 bp-indel were located in the upper 5'promoter and 5 SNPs were located in the 3'UTR of HLA-B. Through analyzing the phylogenetic trees of 5'promoter, exons and 3'UTR of the two genes, we found that the evolution history of regulatory regions and exons is different between the two genes. The regulatory regions are tightly linked with exons in most of HLA-A alleles excluding A*24020101. On the contrary, recombinant events may occur frequently between regulatory regions and exons in most HLA-B alleles.

[Polymorphism of LW blood group gene in Chinese population].

In order to study the polymorphism of Landsteiner-Wiener (LW) blood group gene in Chinese population, peripheral blood samples anticoagulated with EDTA from 160 unrelated volunteer blood donors were randomly collected, and genomic DNA were extracted. 160 DNA samples were analyzed for exon 1 of LW gene by direct DNA sequencing, and detected for LWa/LWb allele by improved PCR-SSP genotyping. The results showed that all LW allele in 160 donors were LWa homozygous, and the LWa allele occurred commonly. In conclusion, LWa allele occurs with incidence of 100% of donors in this study, while LWb allele has not been found in Chinese population.

[Molecular genetic analysis of FUT1 and FUT2 gene in para-Bombay Chinese: a novel FUT1 allele is identified].

OBJECTIVE: Molecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay. METHODS: Seven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H. RESULTS: The FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status. CONCLUSION: A novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.

[Molecular genetic analysis of Diego blood group Dia and Dib in Chinese Han population].

OBJECTIVE: To study the molecular genetic background of Diego blood group in Chinese Han population. METHODS: A total of 2990 blood samples from unrelated blood donors were phenotyped for Dia and Dib by serological method. Twenty randomly selected samples of Di(a-b+) type and all of the samples of rare Di(a+b-) phenotype by screening were genotyped by PCR-SSP and direct DNA Sequencing. RESULTS: Of the 2990 samples identified by serological method, 2821 were Di(a-b+), 167 were Di(a+b+) and 2 were Di(a+b-). All of the 20 randomly-selected samples with Di(a-b+) phenotype were DI2DI2 homozygote by PCR-SSP genotyping, with nucleotide C at nt position 2561 in exon 19 by direct sequencing of the DI gene. The 2 samples of rare Di (a+b-) phenotype were both the DI1DI1 homozygote, with nucleotide T at nt position 2561 in exon 19. CONCLUSION: Our results indicate that the expression of Dia and Dib antigens in Chinese Han population most likely result from a single nucleotide T to C substitution at nucleotide position 2561 in exon 19 of the DI gene, which subsequently leads to an amino acid 854 change from Pro to Leu.

[Study of HLA polymorphism in the 6965 Han bone marrow registry donors].

OBJECTIVE: To analyze human leukocyte antigen (HLA) polymorphism and search for new alleles in Chinese Han population bone marrow registry donors. METHODS: DNA-based HLA genotyping methods were used including PCR-SSP, BST and molecular cloning. RESULTS: A total of 6965 unrelated donors, 4707 from South China origin and 2258 from north, were typed for HLA-A, B, and DRB1 loci. Seventy-two specificities of HLA alleles were identified. The HLA-A25, A34, A74, B41, B42, B53, B73 and B81 that were rarely reported in previously Chinese population studies were identified in this study. Estimation of gene frequency indicated that the blank gene frequency was less than 0.2% for HLA-A, 0.25% for HLA-B and 0.70% for HLA-DRB1 loci. Three novel alleles were identified and officially assigned by the World Health Organization (WHO) Nomenclature Committee as A*0253N, A*1114 and B*5610. CONCLUSION: Large-scale DNA-based HLA genotyping used in bone marrow registry donors is highly accurate and reliable for estimating gene frequency and searching for new alleles. The discrepancy of HLA gene distribution between South and North China Han population showed the necessity of setting the more regions in South and North China to screen the bone marrow registry donors for bone marrow transplant.