Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 125
Filter
1.
Reprod Biol Endocrinol ; 22(1): 80, 2024 Jul 12.
Article in English | MEDLINE | ID: mdl-38997724

ABSTRACT

BACKGROUND: In recent years, with benefits from the continuous improvement of clinical technology and the advantage of fertility preservation, the application of embryo cryopreservation has been growing rapidly worldwide. However, amidst this growth, concerns about its safety persist. Numerous studies have highlighted the elevated risk of perinatal complications linked to frozen embryo transfer (FET), such as large for gestational age (LGA) and hypertensive disorders during pregnancy. Thus, it is imperative to explore the potential risk of embryo cryopreservation and its related mechanisms. METHODS: Given the strict ethical constraints on clinical samples, we employed mouse models in this study. Three experimental groups were established: the naturally conceived (NC) group, the fresh embryo transfer (Fresh-ET) group, and the FET group. Blastocyst formation rates and implantation rates were calculated post-embryo cryopreservation. The impact of FET on fetal growth was evaluated upon fetal and placental weight. Placental RNA-seq was conducted, encompassing comprehensive analyses of various comparisons (Fresh-ET vs. NC, FET vs. NC, and FET vs. Fresh-ET). RESULTS: Reduced rates of blastocyst formation and implantation were observed post-embryo cryopreservation. Fresh-ET resulted in a significant decrease in fetal weight compared to NC group, whereas FET reversed this decline. RNA-seq analysis indicated that the majority of the expression changes in FET were inherited from Fresh-ET, and alterations solely attributed to embryo cryopreservation were moderate. Unexpectedly, certain genes that showed alterations in Fresh-ET tended to be restored in FET. Further analysis suggested that this regression may underlie the improvement of fetal growth restriction in FET. The expression of imprinted genes was disrupted in both FET and Fresh-ET groups. CONCLUSION: Based on our experimental data on mouse models, the impact of embryo cryopreservation is less pronounced than other in vitro manipulations in Fresh-ET. However, the impairment of the embryonic developmental potential and the gene alterations in placenta still suggested it to be a risky operation.


Subject(s)
Cryopreservation , Embryo Transfer , Placenta , Cryopreservation/methods , Female , Pregnancy , Animals , Mice , Embryo Transfer/methods , Placenta/metabolism , Embryo, Mammalian , Embryo Implantation/genetics , Fetal Development/genetics , Blastocyst/metabolism
2.
Ann Noninvasive Electrocardiol ; 29(3): e13114, 2024 May.
Article in English | MEDLINE | ID: mdl-38563240

ABSTRACT

OBJECTIVE: To assess electrocardiogram (ECG) for risk stratification in inferior ST-elevation myocardial infarction (STEMI) patients within 24 h. METHODS: Three hundred thirty-four patients were divided into four ECG-based groups: Group A: R V1 <0.3 mV with ST-segment elevation (ST↑) V7-V9, Group B: R V1 <0.3 mV without ST↑ V7-V9, Group C: R V1 ≥0.3 mV with ST↑ V7-V9, and Group D: R V1 ≥0.3 mV without ST↑ V7-V9. RESULTS: Group A demonstrated the longest QRS duration, followed by Groups B, C, and D. ECG signs for right ventricle (RV) infarction were more common in Groups A and B (p < .01). ST elevation in V6, indicative of left ventricle (LV) lateral injury, was more higher in Group C than in Group A, while the ∑ST↑ V3R + V4R + V5R, representing RV infarction, showed the opposite trend (p < .05). The estimated LV infarct size from ECG was similar between Groups A and C, yet Group A had higher creatine kinase MB isoform (CK-MB; p < .05). Cardiac troponin I (cTNI) was higher in Groups A and C than in B and D (p < .05 and p = .16, respectively). NT-proBNP decreased across groups (p = .20), with the highest left ventricular ejection fraction (LVEF) observed in Group D (p < .05). Group A notably demonstrated more cardiac dysfunction within 4 h post-onset. CONCLUSIONS: For inferior STEMI patients, concurrent R V1 <0.3 mV with ST↑ V7-V9 suggests prolonged ventricular activation and notable myocardial damage. RV infarction's dominance over LV lateral injury might explain these observations.


Subject(s)
Inferior Wall Myocardial Infarction , Myocardial Infarction , ST Elevation Myocardial Infarction , Humans , Inferior Wall Myocardial Infarction/complications , Inferior Wall Myocardial Infarction/diagnosis , Electrocardiography , ST Elevation Myocardial Infarction/complications , ST Elevation Myocardial Infarction/diagnosis , Clinical Relevance , Stroke Volume , Ventricular Function, Left , Arrhythmias, Cardiac
3.
Zhongguo Gu Shang ; 37(3): 306-10, 2024 Mar 25.
Article in Chinese | MEDLINE | ID: mdl-38515420

ABSTRACT

OBJECTIVE: To explore characteristics of clinical and imaging findings in patients with fat embolism syndrome. METHODS: From January 2021 to October 2022,clinical manifestations of 13 patients with fat embolism due to fracture or orthopaedic surgery were retrospectively analyzed,including 11 males and 2 females,aged from 17 to 60 years old. Mental and respiratory abnormalities and changes in vital signs occurred after admission or after surgery,and patient's chest and brain imaging results were abnormal. The patient's mental and respiratory abnormalities,vital signs,chest and brain imaging results were continuously monitored. RESULTS: The main clinical manifestations of fat embolism syndrome were abnormal pulmonary respiration in 13 patients,abnormal central nervous function in 7 patients,and spotted rash in 2 patients. Chest CT showed diffuse distribution of ground glass shadows in 13 patients,and severe symptoms were "snowstorm". Nine patients with ground glass fusion consolidation,5 patients with multiple nodules and 4 patients accompanied by bilateral pleural effusion. Head CT findings of 5 patients were negative,and head MRI findings of 1 patient showed multiple T1WI low signal,T2WI high signal shadow,DWI high signal shadow,and "starry sky sign" in basal ganglia,radiative crown,hemioval center,thalamus,frontal parietal cortex and subcortex. CONCLUSION: Fat embolism syndrome has a high mortality rate. Clinical manifestations of respiratory system and nervous system are not specific,and the skin spot rash has a characteristic manifestation. The "blizzard" sign is the specific manifestation of chest X-ray and CT examination of fat embolism,and the "starry sky" sign is the typical manifestation of diffusion-weighted sequence of brain MRI examination of fat embolism.


Subject(s)
Embolism, Fat , Exanthema , Male , Female , Humans , Adolescent , Young Adult , Adult , Middle Aged , Retrospective Studies , Magnetic Resonance Imaging , Brain , Embolism, Fat/diagnostic imaging , Embolism, Fat/etiology
4.
Phytopathology ; 114(3): 618-629, 2024 Mar.
Article in English | MEDLINE | ID: mdl-37889191

ABSTRACT

The dynamic of plant-parasitic nematode populations in soil is closely related to soil microorganisms. Fungi from Heterodera zeae cysts were isolated to explore the phenomenon of decline in the H. zeae population in the soil. Phylogenetic study of partial ITS, BenA, CaM, and RPB2 gene sequences, in addition to morphological investigations, was utilized to identify a nematode-destroying fungus. The nematicidal activity of a novel strain GX1 against H. zeae was assessed in vitro and in the greenhouse. Our findings revealed that strain GX1 is a new species of Talaromyces, named Talaromyces cystophila. It has a strong parasitic and lethal effect on H. zeae cysts, with 91.11% parasitism on cysts at 3 days after treatment. The contents of second-stage juveniles (J2s) and eggs inside the cysts were degraded and formed dense vacuoles, and the damaged eggs could not hatch normally. The spore suspension exhibited high nematophagous activity against nematodes, and fermentation filtrate exhibited marked inhibition of egg hatching and nematicidal activities on J2s. The hatching inhibition rates of eggs exposed to 1 × 108 CFU/ml spore suspensions or 20% 1-week fermentation filtrate (1-WF) for 15 days were 98.56 and 100%, respectively. The mortality of J2s exposed to 1 × 108 CFU/ml spore suspension reached 100% at 24 h; exposure to 50% 2-WF was 98.65 and 100% at 24 and 48 h, respectively. Greenhouse experiments revealed that the spore suspension and fermentation broth considerably decreased H. zeae reproduction by 56.17 to 78.76%. T. cystophila is a potential biocontrol strain with nematophagous and nematicidal activity that deserves attention and application.


Subject(s)
Cysts , Talaromyces , Tylenchida , Tylenchoidea , Animals , Zea mays , Talaromyces/metabolism , Phylogeny , Plant Diseases/prevention & control , Plant Diseases/parasitology , Antinematodal Agents/pharmacology , Soil
5.
Nat Commun ; 14(1): 6991, 2023 11 01.
Article in English | MEDLINE | ID: mdl-37914684

ABSTRACT

Follicle-stimulating hormone (FSH) is involved in mammalian reproduction via binding to FSH receptor (FSHR). However, several studies have found that FSH and FSHR play important roles in extragonadal tissue. Here, we identified the expression of FSHR in human and mouse pancreatic islet ß-cells. Blocking FSH signaling by Fshr knock-out led to impaired glucose tolerance owing to decreased insulin secretion, while high FSH levels caused insufficient insulin secretion as well. In vitro, we found that FSH orchestrated glucose-stimulated insulin secretion (GSIS) in a bell curve manner. Mechanistically, FSH primarily activates Gαs via FSHR, promoting the cAMP/protein kinase A (PKA) and calcium pathways to stimulate GSIS, whereas high FSH levels could activate Gαi to inhibit the cAMP/PKA pathway and the amplified effect on GSIS. Our results reveal the role of FSH in regulating pancreatic islet insulin secretion and provide avenues for future clinical investigation and therapeutic strategies for postmenopausal diabetes.


Subject(s)
Follicle Stimulating Hormone , Islets of Langerhans , Mice , Animals , Humans , Follicle Stimulating Hormone/pharmacology , Follicle Stimulating Hormone/metabolism , Insulin Secretion , Glucose/pharmacology , Glucose/metabolism , Receptors, FSH/genetics , Receptors, FSH/metabolism , Islets of Langerhans/metabolism , Signal Transduction , Insulin/metabolism , Cyclic AMP-Dependent Protein Kinases/metabolism , Mammals/metabolism
6.
Nat Prod Res ; : 1-5, 2023 Sep 26.
Article in English | MEDLINE | ID: mdl-37752711

ABSTRACT

Two new C-glucofuranosyl flavones apigenin 6-C-ß-glucofuranoside (1) and apigenin 6-C-α-glucofuranoside (2) together with four known compounds (3-6) were isolated from the flowers of Gypsophila oldhamiana. Their structures were elucidated on the basis of extensive spectroscopic analyses. These compounds were evaluated for the cytotoxic activities against four human cancer cell lines and did not exhibit any significant bioactivities (IC50 values > 10 µM).

7.
Plant Dis ; 2023 Aug 14.
Article in English | MEDLINE | ID: mdl-37578359

ABSTRACT

Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67″ N; 108°40'43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 µm, stylet lengths = 15.1 ± 0.9 µm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 µm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 µm, stylet lengths = 14.7 ± 0.5 µm, DGO = 3.5 ± 0.4 µm, tail lengths averaged = 43.6 ± 9.7 µm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.

8.
DNA Cell Biol ; 42(7): 399-410, 2023 Jul.
Article in English | MEDLINE | ID: mdl-37347924

ABSTRACT

Circular RNAs (circRNAs) are generally formed by the back-splicing of precursor mRNA. Increasing evidence implicates the important role of circRNAs in cardiovascular diseases. However, the role of circ-insulin-like growth factor 1 receptor (circIGF1R) in cardiomyocyte (CM) proliferation remains unclear. Here, we investigated the potential role of the circIGF1R in the proliferation of CMs. We found that circIGF1R expression in heart tissues and primary CMs from adult mice was significantly lower than that in neonatal mice at postnatal 1 day (p1). Increased circIGF1R expression was detected in the injured neonatal heart at 0.5 and 1 days post-resection. circIGF1R knockdown significantly decreased the proliferation of primary CMs. Combined prediction software, luciferase reporter gene analysis, and quantitative real time-PCR (qPCR) revealed that circIGF1R interacted with miR-362-5p. A significant increase in miR-362-5p expression was detected in the adult heart compared with that in the neonatal heart. Further, heart injury significantly decreased the expression of miR-362-5p in neonatal mice. Treatment with miR-362-5p mimics significantly suppressed the proliferation of primary CMs, whereas knockdown of miR-362-5p promoted the CMs proliferation. Meanwhile, miR-362-5p silencing can rescue the proliferation inhibition of CMs induced by circIGF1R knockdown. Target prediction and qPCR validation revealed that miR-362-5p significantly inhibited the expression of Phf3 in primary CMs. In addition, decreased Phf3 expression was detected in adult hearts compared with neonatal hearts. Consistently, increased Phf3 expression was detected in injured neonatal hearts compared with that in sham hearts. Knockdown of Phf3 markedly repressed CMs proliferation. Taken together, these findings suggest that circIGF1R might contribute to cardiomyocyte proliferation by promoting Pfh3 expression by sponging miR-362-5p and provide an important experimental basis for the regulation of heart regeneration.


Subject(s)
Cardiovascular Diseases , MicroRNAs , Animals , Mice , Myocytes, Cardiac , RNA, Circular/genetics , Cell Proliferation/genetics , MicroRNAs/genetics , Cell Line, Tumor
9.
Microbiol Spectr ; 11(3): e0482022, 2023 06 15.
Article in English | MEDLINE | ID: mdl-37070984

ABSTRACT

The assessment of factors that can promote the transmission of antibiotic resistance genes (ARGs) across bacteria in the gastrointestinal tract is in great demand to understand the occurrence of infections related to antibiotic-resistant bacteria (ARB) in humans. However, whether acid-resistant enteric bacteria can promote ARG transmission in gastric fluid under high-pH conditions remains unknown. This study assessed the effects of simulated gastric fluid (SGF) at different pH levels on the RP4 plasmid-mediated conjugative transfer of ARGs. Moreover, transcriptomic analysis, measurement of reactive oxygen species (ROS) levels, assessment of cell membrane permeability, and real-time quantitative assessment of the expression of key genes were performed to identify the underlying mechanisms. The frequency of conjugative transfer was the highest in SGF at pH 4.5. Antidepressant consumption and certain dietary factors further negatively impacted this situation, with 5.66-fold and 4.26-fold increases in the conjugative transfer frequency being noted upon the addition of sertraline and 10% glucose, respectively, compared with that in the control group without any additives. The induction of ROS generation, the activation of cellular antioxidant systems, increases in cell membrane permeability, and the promotion of adhesive pilus formation were factors potentially contributing to the increased transfer frequency. These findings indicate that conjugative transfer could be enhanced under certain circumstances in SGF at elevated pH levels, thereby facilitating ARG transmission in the gastrointestinal tract. IMPORTANCE The low pH of gastric acid kills unwanted microorganisms, in turn affecting their inhabitation in the intestine. Hence, studies on the factors that influence antibiotic resistance gene (ARG) propagation in the gastrointestinal tract and on the underlying mechanisms are limited. In this study, we constructed a conjugative transfer model in the presence of simulated gastric fluid (SGF) and found that SGF could promote the dissemination of ARGs under high-pH conditions. Furthermore, antidepressant consumption and certain dietary factors could negatively impact this situation. Transcriptomic analysis and a reactive oxygen species assay revealed the overproduction of reactive oxygen species as a potential mechanism by which SGF could promote conjugative transfer. This finding can help provide a comprehensive understanding of the bloom of antibiotic-resistant bacteria in the body and create awareness regarding the risk of ARG transmission due to certain diseases or an improper diet and the subsequent decrease in gastric acid levels.


Subject(s)
Angiotensin Receptor Antagonists , Genes, MDR , Humans , Reactive Oxygen Species , Angiotensin Receptor Antagonists/pharmacology , Gastric Acid , Angiotensin-Converting Enzyme Inhibitors/pharmacology , Bacteria/genetics , Anti-Bacterial Agents/pharmacology , Intestines , Hydrogen-Ion Concentration , Gene Transfer, Horizontal , Genes, Bacterial , Plasmids
10.
Environ Res ; 215(Pt 1): 114327, 2022 12.
Article in English | MEDLINE | ID: mdl-36100099

ABSTRACT

Harmful red tides in China have caused paralytic shellfish toxins (PSTs) pollution and led to severe socioeconomic effects in shellfish aquaculture. Although shellfish can survive harmful algal blooms, the effects on their Condition Index (CI) have been underestimated. This study sought to evaluate the effects of the profiles and levels of paralytic shellfish toxins on variations in the CI in bivalves under natural blooming conditions. We observed clear soft tissue lesions to varying degrees except in Mytilus galloprovincialis after toxin exposure. Among the five species of shellfish exposed in situ, only M. galloprovincialis accumulated PSTs content above the maximum permitted level (800 µg STX di-HCl eq./kg). The highest toxin content in all sample tissues was observed in Patinopecten yessoensis. Significant interspecies differences in PSTs accumulation among the five bivalve species were observed in the hepatopancreas. A total of nine PSTs components and four new C-11 hydroxyl metabolites (so-called M-toxins) toxins were detected, and detoxification diversity was observed among bivalves. We observed a higher proportion of M-toxin in early stages, and the proportions changed only slightly over time in M. galloprovincialis and Magallana gigas, thus accounting for the significantly higher metabolism rate. Notably, the CI in M. gigas and Argopecten irradians was positively correlated with lowest toxin accumulation of PSTs content, but significantly inhibited. In conclusion, our results revealed a significant inhibitory effect on the CI in shellfish, in a species specific manner, with distinct levels of inhibition correlated with different toxin metabolites. Our study revealed the toxin content of different bivalves exposed to a natural red tide environment and the consequent effects on growth, thus building a foundation for research on the mechanisms underlying the effects of PSTs on growth. These data establish the ecological and economic significance of the effects of harmful algal blooms on bivalves.


Subject(s)
Dinoflagellida , Mytilus , Animals , Harmful Algal Bloom , Marine Toxins/toxicity , Mytilus/metabolism , Pectinidae
11.
Environ Pollut ; 313: 120241, 2022 Nov 15.
Article in English | MEDLINE | ID: mdl-36152713

ABSTRACT

In the last 5 years, paralytic shellfish toxins (PSTs) have been recurrently detected in mollusks farmed in the mussel culture area of Qinhuangdao city, along with the occurrence of toxic outbreaks linked to dinoflagellate species of the Alexandrium genus. To understand the formation mechanism and variation of these events, continuous and comprehensive PSTs monitoring was carried out between 2017 and 2020. Through the analysis of both phytoplankton and cysts via light microscopy and quantitative polymerase chain reaction, it was shown that Alexandrium catenella was responsible for the production of PSTs, which consisted mainly of gonyautoxins 1,4 (GTX1/4, 87%) and GTX2/3 (13%). During bloom events in 2019, mussels accumulated the highest PSTs value (929 µg STX di-HCl eq·kg-1) in conjunction with the peak of cell abundances, and toxin profiles were consistent with high distributions of GTX1/4, GTX2/3, and Neosaxitoxin. Toxin metabolites vary in different substances and mainly transferred to a stable proportion of α-epimer: ß-epimers 3:1. The environmental drivers of Alexandrium blooms included the continuous rise of water temperature (>4 °C) and calm weather with low wind speed and no significant precipitation. By comparing toxin profiles and method sensitivity, it was found that dissolved toxins in seawater are more useful for early warning. These results have important implications for the effective monitoring and management of paralytic shellfish poisoning outbreaks.


Subject(s)
Bivalvia , Dinoflagellida , Shellfish Poisoning , Animals , Dinoflagellida/metabolism , Seawater , Water/metabolism
12.
Insects ; 13(9)2022 Sep 16.
Article in English | MEDLINE | ID: mdl-36135547

ABSTRACT

The Colorado potato beetle (CPB), Leptinotarsa decemlineata (Say), is the most notorious insect pest of potato globally. Injudicious use of insecticides for management of this pest has resulted in resistance to all major groups of insecticides along with many human, animal health, and environmental concerns. Additionally, the input cost of insecticide development/discovery is markedly increasing because each year thousands of chemicals are produced and tested for their insecticidal properties, requiring billions of dollars. For the management of resistance in insect pests, synergists can play a pivotal role by reducing the application dose of most insecticides. These eco-friendly synergists can be classified into two types: plant-based synergists and RNAi-based synergists. The use of plant-based and RNAi-based synergists in resistance management of insect pests can give promising results with lesser environmental side effects. This review summarizes the resistance status of CPB and discusses the potential advantage of plant-based and RNAi-based synergists for CPB resistance management. It will motivate researchers to further investigate the techniques of using plant- and RNAi-based synergists in combination with insecticides.

13.
Int J Biol Macromol ; 220: 721-732, 2022 Nov 01.
Article in English | MEDLINE | ID: mdl-35981683

ABSTRACT

Tup1, a conserved transcriptional repressor, plays a critical role in the growth and development of fungi. Here, we identified a BsTup1 gene from the plant pathogenic fungus Bipolaris sorokiniana. The expression of BsTup1 showed a more than three-fold increase during the conidial stage compared with mycelium stage. Deletion of BsTup1 led to decrease hyphal growth and defect in conidia formation. A significant difference was detected in osmotic, oxidative, or cell wall stress responses between the WT and ΔBsTup1 strains. Pathogenicity assays showed that virulence of the ΔBsTup1 mutant was dramatically decreased on wheat and barely leaves. Moreover, it was observed that hyphal tips of the mutants could not form appressorium-like structures on the inner epidermis of onion and barley coleoptile. Yeast two-hybrid assays indicated that BsTup1 could interact with the BsSsn6. RNAseq revealed significant transcriptional changes in the ΔBsTup1 mutant with 2369 genes down-regulated and 2962 genes up-regulated. In these genes, we found that a subset of genes involved in fungal growth, sporulation, cell wall integrity, osmotic stress, oxidation stress, and pathogenicity, which were misregulated in the ΔBsTup1 mutant. These data revealed that BsTup1 has multiple functions in fungal growth, development, stress response and pathogenesis in B. sorokiniana.


Subject(s)
Bipolaris , Hordeum , Fungal Proteins/genetics , Fungal Proteins/metabolism , Hordeum/genetics , Hordeum/metabolism , Plant Diseases/microbiology , Spores, Fungal/genetics , Virulence/genetics
14.
Biol Reprod ; 107(1): 148-156, 2022 07 25.
Article in English | MEDLINE | ID: mdl-35774031

ABSTRACT

The prevalence of gestational diabetes mellitus (GDM) is increasing rapidly. In addition to the metabolic disease risks, GDM might increase the risks of cryptorchidism in children. However, its mechanism involved in abnormalities of the male reproductive system is still unclear. The purpose of this study was to study the effects of GDM on the development of mouse fetal Leydig cells (FLCs) and Sertoli cells (SCs). Pregnant mice were treated on gestational days 6.5 and 12.5 with streptozotocin (100 mg/kg) or vehicle (sodium citrate buffer). Leydig cell and SC development and functions were evaluated by investigating serum testosterone levels, cell number and distribution, genes, and protein expression. GDM decreased serum testosterone levels, the anogenital distance, and the level of desert hedgehog in SCs of testes of male offspring. FLC number was also decreased in testes of GDM offspring by delaying the commitment of stem Leydig cells into the Leydig cell lineage. RNA-seq showed that FOXL2, RSPO1/ß-catenin signaling was activated and Gsk3ß signaling was inhibited in GDM offspring testis. In conclusion, GDM disrupted reproductive tract and testis development in mouse male offspring via altering genes related to development.


Subject(s)
Diabetes, Gestational , Testis , Animals , Diabetes, Gestational/metabolism , Female , Fetal Development , Humans , Leydig Cells/metabolism , Male , Mice , Pregnancy , Sertoli Cells/metabolism , Testis/metabolism , Testosterone
15.
Chemosphere ; 307(Pt 1): 135653, 2022 Nov.
Article in English | MEDLINE | ID: mdl-35835246

ABSTRACT

The types and intensity of anthropogenic pressure in the same sea area may differ spatially and may change as time passes, but response of benthic biotic indices to different pressure is different, which makes it unreasonable to use the same benthic biotic indices in a large sea area. We provided a new way of thinking as to selecting benthic biotic indices according to pressure type. The study took six bays under eutrophication and sediment heavy metal pollution to different levels in Fujian coastal water, East China sea, as examples, analysed the response of five benthic biotic indices, namely AZTI marine biotic index (AMBI), multivariate AMBI (M-AMBI), Shannon-Wiener diversity index (H'), benthic opportunistic polychaetes amphipods (BOPA) and benthic polychaetes amphipods (BPA), to eutrophication factors and sediment heavy metal pollution factors firstly. The result indicated that AMBI well responded to dissolved inorganic nitrogen (DIN) and dissolved inorganic phosphorus (DIP); M-AMBI responded soundly in the range of DIN >0.131 mg L-1 and DIP >0.022 mg L-1 and responded universally to heavy metals; H' responded to only Hg and Cd; BOPA has response to eutrophication condition of DIN >0.242 mg L-1; BPA had response to DIN, Cu and As. Then, suitable indices were selected based on the four pressure scenarios in the study area. AMBI was selected in no pressure scenario; M-AMBI was chosen under only eutrophication pressure and under dual pressure; H' was preferred in only heavy metal pressure scenario (mainly Hg pollution). At last, the density plot of the distribution of the selected indices in the evaluation grades under different pressure scenarios proved the proposal of selecting benthic biotic indices according to pressure types feasible. This study can offer some new insights into rapidly choosing indices to evaluate the coastal benthic ecological quality status.


Subject(s)
Amphipoda , Mercury , Animals , Cadmium , China , Ecosystem , Environmental Monitoring , Eutrophication , Invertebrates , Nitrogen , Phosphorus , Water
16.
NPJ Regen Med ; 7(1): 33, 2022 Jun 24.
Article in English | MEDLINE | ID: mdl-35750775

ABSTRACT

Upon injury, the liver is capable of substantial regeneration from the original tissue until an appropriate functional size. The underlying mechanisms controlling the liver regeneration processes are not well elucidated. Previous studies have proposed that the transcription factor FoxO3 is involved in various liver diseases, but its exact role in the regulation of liver regeneration remains largely unclear. To directly test the detailed role of FoxO3 in liver regeneration, both a constitutive Albumin-Cre driver line and adeno-associated virus serotype 8 (AAV8)-Tbg-Cre (AAV-Cre)-injected adult FoxO3fl/fl mice were subjected to 70% partial hepatectomy (PH). Our data demonstrate that FoxO3 deletion accelerates liver regeneration primarily by limiting polyploidization and promoting the proliferation of hepatocytes during liver regeneration. RNA-seq analysis indicates that FoxO3 deficiency greatly alters the expression of gene sets associated with cell proliferation and apoptosis during liver regeneration. Chromatin immunoprecipitation-PCR (ChIP-PCR) and luciferase reporter assays reveal that FoxO3 promotes the expression of Nox4 but suppresses the expression of Nr4a1 in hepatocytes. AAV8 virus-mediated overexpression of Nox4 and knockdown of Nr4a1 significantly suppressed hepatocyte proliferation and liver regeneration in FoxO3-deficient mice. We demonstrate that FoxO3 negatively controls hepatocyte proliferation through Nox4 upregulation and Nr4a1 downregulation, thereby ensuring appropriate functional regeneration of the liver. Our findings provide novel mechanistic insight into the therapeutic mechanisms of FoxO3 in liver damage and repair.

17.
Nat Prod Res ; 36(1): 237-245, 2022 Jan.
Article in English | MEDLINE | ID: mdl-32524880

ABSTRACT

A new chromone glycoside, 8-O-ß-D-Glucopyranosyl-2-methylchromone (1), together with eight known compounds (2-9) were isolated from the Tibetan medicine plant of Swertia punicea. All compounds of this plant were reported for the first time. The structures of these metabolites were elucidated by analysis of their HR-ESI-MS, 1D and 2D NMR spectroscopic data and comparison with data reported in the literature. In vitro test, all compounds were evaluated for their anti-inflammatory activity through the determination of nitric oxide production. Compounds 1-2 were evaluated for cytotoxic activities against three human cancer cell lines (HeLa, MDA-MB-231 and A375) by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) method. Furthermore, the chemotaxonomic significance of these compounds has also been described.


Subject(s)
Swertia , Chromones , Glycosides/pharmacology , Humans , Medicine, Tibetan Traditional , Molecular Structure
18.
Life (Basel) ; 11(11)2021 Nov 03.
Article in English | MEDLINE | ID: mdl-34833053

ABSTRACT

Plant parasitic nematodes (PPNs) are a pathogenic group that causes momentous crop yield loss by retarding plant growth and development through plant parasitization. In this study, the distribution of PPNs based on the main crops in Guangxi Province of China was investigated. A total of 425 samples of soil or roots from sugarcane, rice, maize, and soybean were collected in 68 counties, and a total of 48 order/family/genera of PPNs were identified, of which some genera were found in more than one crop. A total of 31 order/family/genera of PPNs were found in rice, among which Hirschmanniella was the most abundant, accounting for 79.23%, followed by Tylenchorhynchus (34.43%). Forty order/family/genera were observed in maize, of which the dominant genera were Pratylenchus and Tylenchorhynchus at 45.14% and 32.64%, respectively. In addition, 30 order/family/genera of PPNs were detected from sugarcane, and the percentages of Tylenchorhynchus and Helicotylenchus were 70.42% and 39.44%, respectively. The main crop of Eastern ecological regions was rice, with a high frequency of Hirschmanniella. The greatest frequency of Pratylenchus was found in the Western eco-region, which had a large area of maize. In the Northern eco-region, rice and maize were popular, with abundant Hirschmanniella and Helicotylenchus. In the Central eco-region, Pratylenchus was detected on the main crop of sugarcane. Hirschmanniella (72.94%) was dominant in clay, and Tylenchorhynchus (54.17%) showed the highest frequency in loam. The distribution of PPNs varied with different altitudes. The diversity of this phenomenon was closely related to host plants. These results could improve understanding of the distribution of PPNs and provide important information for controlling PPNs.

19.
Ecotoxicol Environ Saf ; 225: 112738, 2021 Dec 01.
Article in English | MEDLINE | ID: mdl-34481352

ABSTRACT

Arsenic is a significant food safety and environmental concern due to its mutagenic and carcinogenic effect on living organism. Soybean (Glycine max [L.] Merrill) is a global staple crop grown intensively in arsenic-contaminated regions of the world (e.g., Southern Province of China). Therefore, the objective of this study was to investigate whether Se-NPs and/or ZnO-NPs could be used as an eco-friendly and efficient amendment to reduce arsenic uptake and toxicity in soybean. Ten-days-old seedling, grown in vermiculite, were transferred to hydroponic media and further grown till V2 growth stage appeared. AsV (25 µM Na2HAsO4) stressed plants were treated with ZnONP (25 µM ZnO) and SeNP (25 µM Se) separately and in combination, which were grown for another 10 d. The result demonstrated that arsenic-treated soybean plants displayed a reduction in photosynthetic efficiency, increased proline and glycine betaine accumulation in tissues, and altered antioxidant activity compared to an untreated control. The application of zinc oxide and selenium nanoparticles, both independently and in tandem, reduced arsenic stress in root and shoot tissues and rescued plant health. This was reflected through increased levels of reduced glutathione content, ascorbic acid, and various photosynthesis- and antioxidant-relevant enzymes. In addition, nanoparticle-treated soybean plants displayed higher expression of defense- and detoxification-related genes compared to controls. Cellular toxicants (i.e., oxidized glutathione, reactive oxygen species, and malondialdehyde) were reduced upon nanoparticle treatment. These data collectively suggest that selenium and zinc oxide nanoparticles may be a solution to ameliorate arsenic toxicity in agricultural soils and crop plants.


Subject(s)
Nanoparticles , Zinc Oxide , Antioxidants , Nanoparticles/toxicity , Photosynthesis , Plant Roots , Seedlings , Glycine max , Zinc Oxide/toxicity
20.
Int J Gen Med ; 14: 3485-3496, 2021.
Article in English | MEDLINE | ID: mdl-34290523

ABSTRACT

BACKGROUND: Topoisomerase 2-alpha (TOP2A) has been identified as a hub gene that played an important role in the initiation and progression of thyroid carcinoma (THCA). However, the exact function of TOP2A in papillary thyroid cancer (PTC) remained elusive. The current study aimed to evaluate the TOP2A expression, prognosis significance and key signaling pathways involved in PTC. METHODS: We firstly evaluated the expression of TOP2A in PTC via UALCAN, cBioportal, HPA and LinkdedOmics databases. Genetic alteration of TOP2A in PTC was then explored in cBioportal. Prognostic impacts of TOP2A expression on disease-free survival (DFS) of PTC patients were subsequently evaluated using Kaplan-Meier plotter and Gepia databases. Taking gender, age, cancer stage, T, N and M stages into consideration, we compared survival difference between TOP2A high and low expression groups. KEGG pathway analysis in WebGestalt and GSEA analysis were further performed to reveal the potential TOP2A-associated signaling pathways involved in PTC. Finally, the upstream microRNAs of TOP2A were assessed using DIANA, TargetScan, miRDB and miRWALK database, followed by mechanism exploration of upstream microRNAs. RESULTS: 1) The mRNA and protein of TOP2A were highly expressed in PTC tissue compared with normal thyroid tissue. TOP2A expression was associated with patient's age, N stage and cancer stage (all P<0.05). TOP2A protein was mainly localized to nucleoplasm. 2) Most of samples occurred the missense substitution, and mutation site was located at K1199E. Nucleotide mutations were mainly presented as G>A (35.29%). 3) TOP2A high expression significantly influenced the DFS of PTC patients (P=0.015). Restricted survival analysis showed that TOP2A high expression caused poorer DFS of female patients (P=0.003) and those with age <60 years old (P=0.002), early clinical stage (P=0.012), N0 stage (P=0.002) or M0 stage (P=0.040). 4) Pathway analysis suggested that TOP2A positively participated in the cell cycle, oocyte meiosis and p53 signaling pathways (all P<0.05) involved in thyroid cancer. CONCLUSION: The expression of TOP2A was higher in PTC tissue, which resulted in a worse DFS of patients with PTC. TOP2A might act as an effective therapeutic target for PTC treatment.

SELECTION OF CITATIONS
SEARCH DETAIL