Clinical characteristics of heavy alcohol consumption in young and middle-aged acute cerebral infarction: A 12-month follow-up study.

Objective: To investigate the clinical characteristics and prognosis of heavy alcohol consumption among young and middle-aged patients with acute cerebral infarction (ACI). Methods: A total of 263 young and middle-aged ACI patients were included in the study from June 2018 to December 2020 and classified into heavy drinkers and non-heavy drinkers. Multivariate logistic regression analysis was conducted to assess the association between ACI and heavy alcohol consumption, considering clinical characteristics and one-year post-discharge prognosis. Results: Among the patients, 78 were heavy drinkers. Heavy drinkers were more likely to consume alcohol 24 h before ACI onset (OR 4.03, 95 % CI 2.26-7.20), especially in the form of liquor (OR 3.83, 95 % CI 1.59-9.20), and had a higher risk of diastolic blood pressure ≥90 mmHg upon admission (OR 2.02, 95 % CI 1.12-3.64). In the one-year post-discharge prognosis, heavy drinkers had a greater likelihood of poor prognosis at 3 months (OR 2.31, 95 % CI 1.01-5.25), were less likely to quit drinking after discharge (OR 0.36, 95 % CI 0.19-0.66), and had a higher risk of recurrent cerebral infarction (OR 2.79, 95 % CI 1.14-6.84). Conclusions: Over the 12-month follow-up, young and middle-aged ACI patients with heavy alcohol consumption exhibited worse short-term prognosis. Controlling alcohol consumption levels may improve the prognosis of these patients.

Roles of Nucleolar Factor RCL1 in Itraconazole Resistance of Clinical Candida albicans Under Different Stress Conditions.

Purpose: RNA terminal phosphate cyclase like 1 (RCL1) undergoes overexpression during the immune response of Candida albicans following drug treatment. This study aims to investigate the expression levels of RCL1 in C. albicans under various stress conditions. Methods: Fifteen itraconazole (ITR)-resistant strains of clinical C. albicans, and one standard strain were employed for RCL1 sequencing, and mutations in RCL1 were analyzed. Subsequently, 14 out of the 15 ITR-resistant clinical strains and 14 clinical strains sensitive to ITR, fluconazole (FCA) as well as voriconazole (VRC) were cultured under diverse conditions. The expression of RCL1 ITR-resistant and sensitive C. albicans was then assessed using real-time quantitative PCR (RT-qPCR) assays. Results: Compared to the standard strain, three missense mutations (C6A, G10A, and A11T) were identified in the RCL1 gene of ITR-resistant C. albicans through successful forward sequencing. Additionally, using successful reverse sequencing, one synonymous mutation (C1T) and four missense mutations (C1T, A3T, A7G, and T8G) were found in the RCL1 gene of ITR-resistant C. albicans. RCL1 expression was significantly higher in ITR-resistant C. albicans than in sensitive strains under standard conditions (37°C, 0.03% CO2, pH 4.0). Low temperature (25°C) increased RCL1 expression in sensitive C. albicans while decreasing it in ITR-resistant strains. Elevated CO2 concentrations (5% CO2) had a negligible effect on RCL1 expression in sensitive C. albicans, but effectively reduced RCL1 level in ITR-resistant strains. Furthermore, a medium with a pH of 7 decreased the expression of RCL1 in both resistant and sensitive C. albicans. Conclusion: This study demonstrated that RCL1 mutations in ITR-resistant C. albicans, and variations in culture conditions significantly influence RCL1 expression in both ITR-resistant and sensitive C. albicans, thereby inducing alterations in the dimorphism of C. albicans.

Cerebral small vessel disease increases risk for epilepsy: a Mendelian randomization study.

BACKGROUND: Despite previous research suggesting a potential association between cerebral small vessel disease (CSVD) and epilepsy, the precise causality and directionality between cerebral small vessel disease (CSVD) and epilepsy remain incompletely understood. We aimed to investigate the causal link between CSVD and epilepsy. METHOD: A bidirectional two-sample Mendelian randomization (MR) analysis was performed to evaluate the causal relationship between CSVD and epilepsy. The analysis included five dimensions of CSVD, namely small vessel ischemic stroke (SVS), intracerebral hemorrhage (ICH), white matter damage (including white matter hyperintensity [WMH], fractional anisotropy, and mean diffusivity), lacunar stroke, and cerebral microbleeds. We also incorporated epilepsy encompassing both focal epilepsy and generalized epilepsy. Inverse variance weighted (IVW) was used as the primary estimate while other four MR techniques were used to validate the results. Pleiotropic effects were controlled by adjusting vascular risk factors through multivariable MR. RESULT: The study found a significant association between SVS (odds ratio [OR] 1.117, PFDR = 0.022), fractional anisotropy (OR 0.961, PFDR = 0.005), mean diffusivity (OR 1.036, PFDR = 0.004), and lacunar stroke (OR 1.127, PFDR = 0.007) with an increased risk of epilepsy. The aforementioned correlations primarily occurred in focal epilepsy rather than generalized epilepsy on subgroup analysis and retained their significance in the multivariable MR analysis. CONCLUSION: Our study demonstrated that genetic susceptibility to CSVD independently elevates the risk of epilepsy, especially focal epilepsy. Diffusion tensor imaging may help screen patients at high risk for epilepsy in CSVD. Improved management of CSVD may be a significant approach in reducing the overall prevalence of epilepsy.

Analysis of 21 Patients With Alcoholic Marchiafava-Bignami Disease in Chongqing, China.

OBJECTIVE: This study aimed to investigate the characteristics and prognosis of patients with alcoholic Marchiafava-Bignami disease (MBD), a rare neurological disorder commonly associated with chronic alcoholism, in Chongqing, China. METHODS: We conducted a retrospective analysis of clinical data from 21 alcoholic MBD patients treated at the First Affiliated Hospital of Chongqing University between 2012 and 2022. RESULTS: The study included 21 patients with alcoholic MBD who had a mean age of 59 ± 9.86 years and an average drinking history of 35.48 ± 8.65 years. Acute onset was observed in 14 (66.7%) patients. The primary clinical signs observed were psychiatric disorders (66.7%), altered consciousness (61.9%), cognitive disorders (61.9%), and seizures (42.9%). Magnetic resonance imaging revealed long T1 and long T2 signal changes in the corpus callosum, with lesions predominantly found in the genu (76.2%) and splenium (71.4%) of the corpus callosum. The poor prognosis group demonstrated an increased incidence of altered consciousness (100% vs 50%, P = 0.044), pyramidal signs (80% vs 18.8%, P = 0.011), and pneumonia (100% vs 31.3%, P = 0.007). Patients with a longer drinking history (45.0 ± 10.0 years vs 32.69 ± 5.99 years, p = 0.008) and a lower thiamine dose (p = 0.035) had a poorer prognosis at 1 year. CONCLUSIONS: This study identified altered consciousness, pyramidal signs, and pneumonia as predictors of a poor prognosis in patients with alcoholic MBD. A longer duration of alcohol consumption and inadequate thiamine supplementation were associated with a poorer prognosis.

Clinical and antibodies analysis of anti-GQ1b antibody syndrome: a case series of 15 patients.

OBJECTIVES: To investigate the clinical manifestations, immunity, laboratory test, treatment and prognosis of patients with anti-GQ1b antibody syndrome in Chongqing, China. METHODS: We reviewed 15 patients with positive anti-ganglioside antibodies in the First Affiliated Hospital of Chongqing Medical University from 2016 to 2019. RESULTS: Fifteen patients were included in the study (mean age, 54.4 years; age range, 27 to 80 years; 9 men (60%)). Ten patients presented with a history of preinfection, including flu-like syndrome (n = 6, 60%), upper respiratory tract infection (URTI) (n = 3, 30%), and digestive tract infection (GI) (n = 1, 10%). The most common manifestation was ophthalmoplegia (n = 13, 86.67%), followed by weakness (n = 12, 80%), ataxia (n = 11, 73.3%), paresthesia (n = 8, 53.33%) and hypersomnolence (n = 5, 33.33%). All 15 patients underwent antibody testing. Eight patients (53.33%, 7 men (87.5%)) of whom only have positive immunoglobulin G (IgG) against anti-GQ1b antibody while seven (46.67%, 2 men (28.57%)) were positive for multiple anti-ganglioside antibodies apart from anti-GQ1b antibodies. Nine patients (60%) received intravenous immunoglobulin (IVIG) therapy, four (26.67%) received plasma exchange (PE) and two (13.33%) received steroid therapy. Three patients were lost to follow-up at 6 months, 1 patient (6.67%) had persistent back numbness, and the other 11 patients (73.33%) had fully recovered. CONCLUSION: The clinical subtype of anti-GQ1b antibody syndrome correlates with the type of anti-ganglioside antibody. Patients who test positive for only anti-GQ1b antibody are more likely to be men. Most patients exhibit a unidirectional course with a good prognosis, but anti-GQ1b antibody syndrome is also associated with a risk of recurrence.

Linear porokeratosis of the foot with dermoscopic manifestations: A case report.

BACKGROUND: Porokeratosis (PK) is a common autosomal dominant chronic progressive dyskeratosis with various clinical manifestations. Based on clinical manifestations, porokeratosis can be classified as porokeratosis of mibelli, disseminated superficial porokeratosis, disseminated superficial actinic porokeratosis, linear porokeratosis (LP), porokeratosis palmaris et plantaris disseminata, porokeratosis punctata, popular PK, hyperkeratosis PK, inflammatory PK, verrucous PK, and mixed types. We report a case of LP in a child and describe its dermoscopic findings. CASE SUMMARY: Linear porokeratosis is a rare PK. The patient presented with unilateral keratinizing maculopapular rash of the foot in childhood. The patient underwent skin pathology and dermoscopy, and was treated with liquid nitrogen freezing and topical drugs. CONCLUSION: From this case we take-away that LP is a rare disease, by the dermoscopic we can identify it.

Cotreatment with Aspirin and Azole Drugs Increases Sensitivity of Candida albicans in vitro.

PURPOSE: This study aimed to investigate the effects of aspirin (acetyl salicylic acid [ASA]) combined with fluconazole (FCA), itraconazole (ITR), or voriconazole (VRC) on Candida albicans under planktonic and biofilm conditions. METHODS: A total of 39 clinical C. albicans strains were used to perform the in vitro drug sensitivity assay under different conditions using the M27-A4 broth microdilution method. The minimal inhibitory concentrations (MICs) and fractional inhibitory concentration index (FICI) values were calculated. C. albicans ZY23 was chosen for the further analyses. RESULTS: Under planktonic conditions, the half maximal MIC (MIC50) values of FCA, ITR, and VRC were 64-0.5 µg/mL, 32-0.0625 µg/mL, and 16-0.125 µg/mL, respectively, when applied, whereas in combination with ASA, the values decreased to 32-0.25 µg/mL, 8-0.0313 µg/mL, and 8-0.0313 µg/mL, respectively. Under biofilm conditions, FCA, ITR, or VRC alone showed MIC50 values of 128-8 µg/mL, 32-4 µg/mL, and 32-0.5 µg/mL, whereas in combination with ASA the values were decreased to 32-0.5 µg/mL, 16-0.5 µg/mL, and 8-0.0625 µg/mL, respectively. Analysis of the FICI showed that the sensitization rate of ASA to FCA, ITR, and FCA under planktonic conditions was 43.59%, whereas the sensitization rates of ASP to FCA, ITR, and FCA under biofilm conditions were 46.15%, 46.15%, and 48.72%, respectively. Additionally, the time-growth and time-kill curves of C. albicans ZY23 further verified the synergistic effects of ASA on azole drugs. CONCLUSION: ASA may act as an enhancer of the inhibitory effects of azole drugs on the growth of clinical C. albicans under planktonic and biofilm conditions.

The effects of secreted aspartyl proteinase inhibitor ritonavir on azoles-resistant strains of Candida albicans as well as regulatory role of SAP2 and ERG11.

BACKGROUND: Candida albicans, the main human fungal pathogen, can cause fungal infection and seriously affect people's health and life. This study aimed to investigate the effects of ritonavir (RIT) on C. albicans and the correlation between SAP2 as well as ERG11 and drug resistance. RESULTS: Secreted aspartyl proteinases (Saps) activities and pathogenicity of C. albicans with different drug resistance were measured. M27-A4 broth microdilution method was used to analyze the drug sensitivity of RIT combined with fluconazole (FCA) on C. albicans. After that, SAP2 and ERG11 mutations were examined by polymerase chain reaction (PCR) and sequencing, and quantitative real-time PCR was utilized to determine the expression of the two genes. By analyzing pz values, the Saps activity of cross-resistant strains was the highest, followed by voriconazole (VRC)-resistant strains, FCA-resistant strains, itraconazole (ITR)-resistant strains, and sensitive strains. The pathogenicity of C. albicans in descending order was as follows: cross-resistant strains, VRC-resistant strains, ITR-resistant strains, FCA-resistant strains, and sensitive strains. With the increase of RIT concentrations, the Saps activity was gradually inhibited. Drug sensitivity results showed that there was no synergistic effect between RIT and FCA. Additionally, no gene mutation sites were found in SAP2 sequencing, and 17 synonymous mutations and 6 missense mutations occurred in ERG11 sequencing. Finally, the expression of SAP2 and ERG11 was significantly higher in the resistant strains compared with the sensitive strains, and there was a positive liner correlation between SAP2 and ERG11 messenger RNA expression (r = .6655, p < .001). CONCLUSION: These findings may help to improve our understanding of azole-resistant mechanisms of C. albicans and provide a novel direction for clinical therapeutics of C. albicans infection.

Virulence of "white-gray-opaque" tri-stable transformation in clinical Candida albicans in vitro and in vivo.

The study aimed to induce the white-opaque-gray tri-stable transformation in clinical C. albicans and to explore their potential pathogenicity. Sixty-four clinical strains were used to induce the white, opaque and gray cells of C. albicans. Secreted aspartyl proteinases (Sap) activity of the three phenotypes was then measured, and a vulvovaginal candidiasis (VVC) animal model was constructed. Of the 64 clinical strains, only 3 strains successfully underwent white-gray-opaque tri-stable transformation, and the three strains all belonged to MTL homozygous strains. Pz values in white, opaque and gray phenotypes were 0.834 ± 0.012, 0.707 ± 0.036, and 0.628 ± 0.002, respectively, which indicated that the cells with gray phenotype had higher Sap activity. After inoculation of different fungal suspension, the fungal colony count in descending order was as follows: gray phenotype, opaque phenotype and white phenotype. After treated with fluconazole for 3 days or 10 days, the fungal colony counts were significantly decreased compared with that before treatment (P < 0.05). The Sap activity and pathogenicity of gray cells in C. albicans were the strongest, followed by opaque cells and white cells. Additionally, white, gray and opaque phenotypic cells were all susceptible to fluconazole.

Aspirin and verapamil increase the sensitivity of Candida albicans to caspofungin under planktonic and biofilm conditions.

OBJECTIVES: This study aimed to investigate the effects of caspofungin (CAS) combined with aspirin (ASP) or verapamil (VPL) on the sensitivity of Candida albicans under planktonic and biofilm conditions. METHODS: A total of 39 C. albicans clinical strains were used to construct biofilms. Sensitivity to ASP or VPL combined with CAS was analysed by broth microdilution. MIC50 values were obtained and the fractional inhibitory concentration index (FICI) was calculated. Subsequently, C. albicans ZY22 was selected for time-growth curve analysis and strains ZY15 and ZY22 were used for time-kill curve analysis. RESULTS: Under planktonic condition the MIC50 of CAS was 0.0313-8 µg/mL following treatment with CAS alone, whereas it decreased to 0.0313-4 µg/mL following CAS combined with ASP or VPL. Under biofilm condition the MIC50 of CAS was 0.125-16 µg/mL following treatment with CAS alone, whereas it decreased to 0.0625-16 µg/mL or 0.0625-8 µg/mL following CAS combined with ASP or VPL. FICI results showed synergistic interactions between CAS and ASP under planktonic and biofilm conditions in 17 and 16 strains, respectively. However, synergistic interactions between CAS and VPL under planktonic and biofilm conditions were observed in 19 and 23 strains, respectively. Additionally, 8000 µg/mL ASP or 8 µg/mL VPL combined with CAS had better inhibitory effects on C. albicans. CONCLUSION: ASP and VPL may be a sensitiser for CAS, and the antifungal effects of CAS may be sensitised by 8000 µg/mL ASP or 8 µg/mL VPL against C. albicans under planktonic and biofilm conditions.

Cryo-EM structure of the calcium homeostasis modulator 1 channel.

Calcium homeostasis modulator 1 (CALHM1) is a voltage-gated ATP release channel that plays an important role in neural gustatory signaling and the pathogenesis of Alzheimer's disease. Here, we present a cryo-electron microscopy structure of full-length Ca2+-free CALHM1 from Danio rerio at an overall resolution of 3.1 Å. Our structure reveals an octameric architecture with a wide pore diameter of ~20 Å, presumably representing the active conformation. The overall structure is substantially different from that of the isoform CALHM2, which forms both undecameric hemichannels and gap junctions. The N-terminal small helix folds back to the pore and forms an antiparallel interaction with transmembrane helix 1. Structural analysis revealed that the extracellular loop 1 region within the dimer interface may contribute to oligomeric assembly. A positive potential belt inside the pore was identified that may modulate ion permeation. Our structure offers insights into the assembly and gating mechanism of the CALHM1 channel.

Regulatory Role of ERG3 and Efg1 in Azoles-Resistant Strains of Candida albicans Isolated from Patients Diagnosed with Vulvovaginal Candidiasis.

Vulvovaginal candidiasis (VVC), caused by Candida albicans, affects women's health and life. We aimed to explore the correlation between ERG3 as well as Efg1 mutation/overexpression and azoles-resistance, and the correlation between ERG3 and Efg1 mRNA expression in C. albicans. First, C. albicans was isolated from clinical VVC patients. ERG3 and Efg1 mutations were detected by polymerase chain reaction (PCR) and sequencing, and the expression levels of these two genes were also identified by qRT-PCR. Correlations between mutation/overexpression of ERG3/Efg1 and azoles-resistance as well as ERG3 and Efg1 mRNA expression were analyzed. Based on the ERG3 sequencing, the results showed that there were 2 missense mutation sites, 1 nonsense mutation site, and 4 silent mutation sites, while 1 missense mutation sites, 1 nonsense mutation site, and 12 silent mutation sites were found in Efg1. Furthermore, the mRNA levels of ERG3 gene in the strains sensitive to FCA, ITR or VRC were higher than those in the strains resistant to FCA, ITR, VRC (P < 0.05). While for the mRNA levels of Efg1, susceptible strains were lower than resistant strains. Besides, there was a significant linear negative correlation between ERG3 and Efg1 mRNA expression (r = - 0.614, P < 0.001).

Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications.

The aim of the present study was to investigate the association between Mrr1, adenylyl cyclase-associated protein 1 (Cap1) and multi-drug resistance gene 1 (MDR1), and to assess the mutations in Mrr1 and Cap1 in azole-resistant Candida albicans strains. The study isolated 68 C. albicans strains from patients with vulvovaginal candidiasis. Drug susceptibility testing was conducted to characterize the resistance profile of these strains to fluconazole, itraconazole and voriconazole. Polymerase chain reaction (PCR) amplification was performed for Cap1 and Mrr1, and the PCR products were sequenced to identify any mutations. Reverse transcription-quantitative PCR was performed to measure Cap1, Mrr1 and MDR1 mRNA in C. albicans strains. The results of the present study indicated S381N, P311S and A390T missense mutations in Cap1 and T917M, T923I, N937K, E1020Q, F1032L and S1037L missense mutations in Mrr1 in azole-resistant C. albicans strains. Fluconazole-resistant strains had significantly elevated Cap1 and MDR1 mRNA levels compared with fluconazole-sensitive strains (P<0.01). The mRNA levels of Cap1, Mrr1 and MDR1 were significantly increased in the strains resistant to all three of fluconazole, itraconazole and voriconazole compared with strains sensitive to the three agents (P<0.001, P=0.037 and P<0.001, respectively). Cap1 expression was positively correlated with MDR1 expression in fluconazole-resistant strains (P<0.05). No significant correlation was observed between Cap1, Mrr1 and MDR1 in the strains resistant to fluconazole, itraconazole or voriconazole. The results of the present study suggested that fluconazole resistance may involve MDR1 overexpression mediated by Cap1 overexpression. Cross-resistance between fluconazole, itraconazole and voriconazole may be associated with mutations in Cap1 and Mrr1, rather than their overexpression. In addition, the present study also revealed two novel mutations in Mrr1; T917M and T923I. These findings may provide a basis for elucidating the molecular mechanisms of and improving therapeutic treatments to tackle azole resistance.

Screening of potential genes contributing to the macrocycle drug resistance of C. albicans via microarray analysis.

The aim of the present study was to investigate the potential genes involved in drug resistance of Candida albicans (C. albicans) by performing microarray analysis. The gene expression profile of GSE65396 was downloaded from the Gene Expression Omnibus, including a control, 15­min and 45­min macrocyclic compound RF59­treated group with three repeats for each. Following preprocessing using RAM, the differentially expressed genes (DEGs) were screened using the Limma package. Subsequently, the Kyoto Encyclopedia of Genes and Genomes pathways of these genes were analyzed using the Database for Annotation, Visualization and Integrated Discovery. Based on interactions estimated by the Search Tool for Retrieval of Interacting Gene, the protein­protein interaction (PPI) network was visualized using Cytoscape. Subnetwork analysis was performed using ReactomeFI. A total of 154 upregulated and 27 downregulated DEGs were identified in the 15­min treated group, compared with the control, and 235 upregulated and 233 downregulated DEGs were identified in the 45­min treated group, compared with the control. The upregulated DEGs were significantly enriched in the ribosome pathway. Based on the PPI network, PRP5, RCL1, NOP13, NOP4 and MRT4 were the top five nodes in the 15­min treated comparison. GIS2, URA3, NOP58, ELP3 and PLP7 were the top five nodes in the 45­min treated comparison, and its subnetwork was significantly enriched in the ribosome pathway. The macrocyclic compound RF59 had a notable effect on the ribosome and its associated pathways of C. albicans. RCL1, NOP4, MRT4, GIS2 and NOP58 may be important in RF59­resistance.

Mutations and/or Overexpressions of ERG4 and ERG11 Genes in Clinical Azoles-Resistant Isolates of Candida albicans.

OBJECTIVE: We aimed to investigate whether mutations and/or overexpressions of ERG4 and ERG11 genes were involved in drug resistance to azoles in Candida albicans. METHODS: Totally, 34 clinical isolates of C. albicans were included in this study. Antimicrobial susceptibility tests, including 5-fluorocytosine (5-FC), amphotericin B (AMB), fluconazole (FCA), itraconazole (ITR), and voriconazole (VRC), were performed by broth microdilution method. Mutations in the ERG4 and ERG11 genes sequence were detected. The messenger RNA (mRNA) levels of ERG4 and ERG11 were measured by quantitative real-time polymerase chain reaction. The correlation of the expression levels of ERG4 with ERG11 genes in susceptible isolates and resistant isolates was analyzed by Pearson's correlation analysis. RESULTS: Among 34 C. albicans isolates, 52.94%, 70.59%, and 50.00% isolates were resistant to FCA, ITR, and VRC, respectively. Sequencing results revealed that only 2 silent mutations were found in ERG4 gene, while 10 amino acid substitutions, including 6 reported previously and 4 new identified, were frequently found in ERG11 gene. The mRNA levels of ERG4 and ERG11 genes were significantly elevated in resistant compared with susceptible C. albicans isolates. Furthermore, the mRNA level of ERG4 was positively correlated with ERG11 in susceptible but not resistant C. albicans isolates. CONCLUSIONS: The resistance to azoles may be associated with the mutations in ERG11 but not ERG4 gene in C. albicans isolates. In addition, overexpressed ERG4 and ERG11 genes are found in resistant C. albicans isolates, and the mRNA levels of ERG4 may be irrelevant to ERG11 in resistant C. albicans isolates.

Candida albicans triggers the expression of inflammatory genes in human umbilical vein endothelial cells.

The aim of the present study was to investigate the pathogenesis of Candida albicans in human umbilical vein endothelial cells (HUVECs) and to screen for aberrantly expressed genes during the process of infection. GSE7355 (accession no.) was downloaded from the National Center of Biotechnology Information Gene Expression Omnibus database and used to identify the differentially-expressed genes (DEGs) between the two groups, which included 4 samples from an untreated HUVEC control group, and 4 samples from HUVECs exposed to C. albicans. Subsequently, the gene ontology (GO) function package was used to perform GO and pathway enrichment analysis, prior to the extraction of DEG correlations in the Kyoto Encyclopedia of Genes and Genomes. A protein-protein interaction (PPI) network was constructed using the String database. In total, 77 DEGs were identified, including 69 upregulated and 8 downregulated DEGs in the C. albicans-infected HUVEC samples. DEGs were significantly enriched in response to external stimuli and chemokine activity. In addition, DEG FBJ murine osteosarcoma viral oncogene homolog (FOS) and interleukin (IL)-6 were significantly enriched in the Toll-like receptor signaling pathway. Nuclear factor κ light polypeptide gene enhancer in B cells 2 (NFKB2) was significantly enriched in the mitogen-activated protein kinase signaling pathway. In the interaction network of DEGs, according data included in the KEGG database, FOS and NFKB2 had higher connectivity degrees. Notably, FOS, IL-6 and intercellular adhesion molecule 1 were demonstrated to have higher connectivity degrees in the PPI network. FOS, IL-6 and NFKB2 may be important genes for C. albicans infection in HUVECs, and these genes may act as therapeutic targets to treat patients infected with C. albicans.

ERG11 mutations and upregulation in clinical itraconazole-resistant isolates of Candida krusei.

To better understand the association between the ERG11 gene and drug resistance in Candida krusei, C. krusei strains were isolated from patients from January 2010 to May 2013. Susceptibility to 5-fluorocytosine (5-FC), amphotericin B (AMB), voriconazole (VRC), fluconazole (FLC), and itraconazole (ITR) were tested by broth microdilution method. Mutations were detected using PCR amplification and gene sequencing. Expression levels of ERG11 were measured by real-time PCR and compared by a 2-tailed Student's t test between ITR-susceptible strains and ITR-resistant strains. In total, 15 C. krusei strains were obtained, of which 20.00%, 53.33%, and 40.00% were resistant to 5-FC, FLC, and ITR, respectively, whereas all isolates were susceptible to AMB and VRC. Three synonymous codon substitutions were found in ERG11, including T939C, T642C, and A756T. However, T939C was found in both resistant and susceptible C. krusei strains. The expression level of ERG11 was significantly higher in resistant C. krusei strains (1.34 ± 0.08) than in susceptible C. krusei strains (0.94 ± 0.14) (t = 3.74, p < 0.05). Our study demonstrates that point mutations (T642C and A756T) accompanied with the overexpression of ERG11 might be involved in the molecular mechanisms of drug resistance in C. krusei.

The correlation of virulence, pathogenicity, and itraconazole resistance with SAP activity in Candida albicans strains.

The relationship between SAP2 activity and drug resistance in Candida albicans was investigated by using itraconazole-resistant and itraconazole-sensitive C. albicans isolates. The precipitation zones were measured to analyze SAP2 activity. Mice were classified into itraconazole-resistant and -sensitive C. albicans isolate groups, and a control group, with their survival and mortality rate being observed over 30 days. The relative expression levels of CDR1, CDR2, MDR1, and SAP2 were measured using RT-PCR. It was found that the secreted aspartyl proteinase activity of itraconazole-resistant C. albicans strains was significantly higher than that of itraconazole-sensitive C. albicans strains (P < 0.001). A significantly higher mortality rate was recorded for mice treated with itraconazole-resistant C. albicans than for mice treated with itraconazole-sensitive C. albicans. In regards to the CDR1, CDR2, and MDR1 genes, there was no significant difference between the 2 groups of mice. Positive correlations between SAP2 and MDR1 and between CDR1 and CDR2 were found. The high expression level of SAP2 may relate to the virulence, pathogenicity, and resistance of C. albicans.

Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

Fibronectin is a potential cerebrospinal fluid and serum epilepsy biomarker.

PURPOSE: Previous studies have demonstrated that fibronectin (FN) levels are increased in brain tissues from patients and animals with epilepsy. This study aimed to assess FN levels in cerebrospinal fluid (CSF) and serum samples from patients with epilepsy. METHODS: Fibronectin levels were assessed in CSF and serum samples from 56 patients with epilepsy (27 and 29 individuals with intractable epilepsy and nonintractable epilepsy, respectively) and 25 healthy controls, using sandwich enzyme-linked immunosorbent assays (ELISA). RESULTS: CSF-FN levels were higher in patients with epilepsy (8.07 ± 1.51 mg/l versus 6.20 ± 1.18 mg/l, p<0.05) than in the control group. In addition, serum-FN levels in the group with epilepsy and in the control group were 236.96 ± 65.7 mg/l and 181.43 ± 72.82 mg/l, respectively, indicating a statistically significant difference (p=0.01). Interestingly, serum- and CSF-FN levels in individuals with epilepsy were not affected by antiepileptic drug and duration of epilepsy. Of note, the increase of CSF- and serum-FN levels was more pronounced in subjects with intractable epilepsy than in patients with nonintractable epilepsy. CONCLUSION: Serum- and CSF-FN levels constitute a potential clinical diagnostic biomarker for epilepsy and could also be used for differential diagnosis.