Zingerone attenuates Ti particle-induced inflammatory osteolysis by suppressing the NF-κB signaling pathway in osteoclasts.

Aseptic loosening caused by inflammatory osteolysis is one of the most frequent and serious long-term complications after total joint arthroplasty (TJA). Development of a new therapeutic drug is required due to the lack of effective therapy and serious adverse effects. This study aimed to explore the pharmacological properties of zingerone (ZO) in attenuating osteoclast-mediated periprosthetic osteolysis and how ZO modulates osteoclastogenesis. The nontoxic concentration of ZO was clarified by the CCK-8 method. Then, we explored the efficacy of ZO on suppressing osteoclast differentiation, F-actin ring formation, bone resorption, and NF-κB luciferase activity in vitro as well as osteoprotection in vivo. Polymerase chain reaction and western blotting were applied to detect the underlying mechanisms involved in osteoclastogenesis. ZO showed an obvious inhibitory effect on osteoclastogenesis and bone resorption in a dose-dependent manner by mainly suppressing the activation of NF-κB signaling pathways. Furthermore, ZO administration successfully attenuated titanium (Ti) particle-stimulated periprosthetic osteolysis and osteoporosis by regulating osteoclast formation. Our findings demonstrated the pharmacological properties of ZO in inhibiting osteoclast formation and function by downregulation of NF-κB signaling activation. As a result, these findings could be expected to provide a novel reagent for regulating inflammatory osteolysis caused by prosthetic loosening.

lncRNA-associated ceRNA network revealing the potential regulatory roles of ferroptosis and immune infiltration in Alzheimer's disease.

Background: Alzheimer's disease (AD) is the most common form of dementia characterized by a prominent cognitive deterioration of sufficient magnitude to impair daily living. Increasing studies indicate that non-coding RNAs (ncRNAs) are involved in ferroptosis and AD progression. However, the role of ferroptosis-related ncRNAs in AD remains unexplored. Methods: We obtained the intersection of differentially expressed genes in GSE5281 (brain tissue expression profile of patients with AD) from the GEO database and ferroptosis-related genes (FRGs) from the ferrDb database. Least absolute shrinkage and selection operator model along with weighted gene co-expression network analysis screened for FRGs highly associated with AD. Results: A total of five FRGs were identified and further validated in GSE29378 (area under the curve = 0.877, 95% confidence interval = 0.794-0.960). A competing endogenous RNA (ceRNA) network of ferroptosis-related hub genes (EPT1, KLHL24, LRRFIP1, CXCL2 and CD44) was subsequently constructed to explore the regulatory mechanism between hub genes, lncRNAs and miRNAs. Finally, CIBERSORT algorithms were used to unravel the immune cell infiltration landscape in AD and normal samples. M1 macrophages and mast cells were more infiltrated whereas memory B cells were less infiltrated in AD samples than in normal samples. Spearman's correlation analysis revealed that LRRFIP1 was positively correlated with M1 macrophages (r = -0.340, P < 0.001) whereas ferroptosis-related lncRNAs were negatively correlated with immune cells, wherein miR7-3HG correlated with M1 macrophages and NIFK-AS1, EMX2OS and VAC14-AS1 correlated with memory B cells (|r| > 0.3, P < 0.001). Conclusion: We constructed a novel ferroptosis-related signature model including mRNAs, miRNAs and lncRNAs, and characterized its association with immune infiltration in AD. The model provides novel ideas for the pathologic mechanism elucidation and targeted therapy development of AD.

Urinary protein biomarkers based on LC-MS/MS analysis to discriminate vascular dementia from Alzheimer's disease in Han Chinese population.

Objective: This study aimed to identify the potential urine biomarkers of vascular dementia (VD) and unravel the disease-associated mechanisms by applying Liquid chromatography tandem-mass spectrometry (LC-MS/MS). Methods: LC-MS/MS proteomic analysis was applied to urine samples from 3 groups, including 14 patients with VD, 9 patients with AD, and 21 normal controls (NC). By searching the MS data by Proteome Discoverer software, analyzing the protein abundances qualitatively and quantitatively, comparing between groups, combining bioinformatics analysis using Gene Ontology (GO) and pathway crosstalk analysis using Kyoto Encyclopedia of Genes and Genomes (KEGG), and literature searching, the differentially expressed proteins (DEPs) of VD can be comprehensively determined at last and were further quantified by receiver operating characteristic (ROC) curve methods. Results: The proteomic findings showed quantitative changes in patients with VD compared to patients with NC and AD groups; among 4,699 identified urine proteins, 939 and 1,147 proteins displayed quantitative changes unique to VD vs. NC and AD, respectively, including 484 overlapped common DEPs. Then, 10 unique proteins named in KEGG database (including PLOD3, SDCBP, SRC, GPRC5B, TSG101/STP22/VPS23, THY1/CD90, PLCD, CDH16, NARS/asnS, AGRN) were confirmed by a ROC curve method. Conclusion: Our results suggested that urine proteins enable detection of VD from AD and VC, which may provide an opportunity for intervention.

Ferroptosis: Underlying mechanism and the crosstalk with other modes of neuronal death after intracerebral hemorrhage.

Intracerebral hemorrhage (ICH) is a serious cerebrovascular disease with high rates of morbidity, mortality, and disability. Optimal treatment of ICH is a major clinical challenge, as the underlying mechanisms remain unclear. Ferroptosis, a newly identified form of non-apoptotic programmed cell death, is characterized by the iron-induced accumulation of lipid reactive oxygen species (ROS), leading to intracellular oxidative stress. Lipid ROS causes damage to nucleic acids, proteins, and cell membranes, eventually resulting in ferroptosis. In the past 10 years, ferroptosis has resulted in plenty of discoveries and breakthroughs in cancer, neurodegeneration, and other diseases. Some studies have also reported that ferroptosis does occur after ICH in vitro and in vivo and contribute to neuronal death. However, the studies on ferroptosis following ICH are still in the preliminary stage. In this review, we will summarize the current evidence on the mechanism underlying ferroptosis after ICH. And review the traditional modes of neuronal death to identify the crosstalk with ferroptosis in ICH, including apoptosis, necroptosis, and autophagy. Additionally, we also aim to explore the promising therapeutic application of ferroptosis in cell death-based ICH.

Long noncoding RNA MALAT1 inhibition attenuates sepsis-induced acute lung injury through modulating the miR-129-5p/PAX6/ZEB2 axis.

This research aimed to investigate the role of the long noncoding RNA metastasis-associated lung adenocarcinoma transcript 1 (MALAT1)/microRNA-129-5p (miR-129-5p)/paired box gene 6 (PAX6) axis in sepsis-induced acute lung injury (ALI). MLE-12 cells and C57BL/6 mice were induced by LPS to establish lung injury in in vitro and in vivo models. Cell viability and apoptosis were measured by cell counting kit-8 assay and TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) staining, respectively. Levels of inflammatory cytokines in cell supernatants and bronchoalveolar lavage fluid (BALF) were detected by ELISA. Lung injury was evaluated by lung wet weight-to-dry weight ratio and hematoxylin-eosin staining. MALAT1, PAX6, and zinc finger E-box-binding homeobox 2 (ZEB2) expression was elevated and miR-129-5p expression was reduced in the serum of patients with sepsis-induced ALI, LPS-induced MLE-12 cells, and lung tissues of ALI mice. MALAT1 interference delayed the LPS-induced cell proliferation decrease, apoptosis increase, and inflammatory factor increase. miR-129-5p inhibition could reverse the delaying effect of MALAT1 interference on LPS-induced lung cell injury. PAX6 overexpression (oe) reversed the inhibitory effect of miR-129-5p oe on LPS-induced lung cell injury. Downregulating MALAT1 reduced pulmonary edema, inflammatory cytokine levels, lung injury, and apoptosis in ALI mice. Moreover, miR-129-5p suppression or PAX6 oe reversed the delaying effect of MALAT1 interference on sepsis-induced ALI. MALAT1 aggravates sepsis-induced ALI via the miR-129-5p/PAX6/ZEB2 axis.

Non-coding RNAs: The Neuroinflammatory Regulators in Neurodegenerative Diseases.

As a common indication of nervous system diseases, neuroinflammation has attracted more and more attention, especially in the process of a variety of neurodegenerative diseases, such as Alzheimer's disease and Parkinson's disease. Two types of non-coding RNAs (ncRNAs) are widely involved in the process of neuroinflammation in neurodegenerative diseases, namely long non-coding RNAs (lncRNAs) and microRNAs (miRNAs). However, no research has systematically summarized that lncRNAs and miRNAs regulate neurodegenerative diseases through neuroinflammatory mechanisms. In this study, we summarize four main mechanisms of lncRNAs and miRNAs involved in neuroinflammation in neurodegenerative diseases, including the imbalance between proinflammatory and neuroprotective cells in microglia and astrocytes, NLRP3 inflammasome, oxidative stress, and mitochondrial dysfunction, and inflammatory mediators. We hope to clarify the regulatory mechanism of lncRNAs and miRNAs in neurodegenerative diseases and provide new insights into the etiological treatment of neurodegenerative diseases from the perspective of neuroinflammation.

Effect of oXiris-CVVH on the Clinical Outcomes of Patients with Septic Shock: An Inverse Probability of Treatment-Weighted Analysis.

BACKGROUND: Limited previous studies had proved that oXiris-continuous veno-venous hemofiltration (CVVH) could decrease endotoxins and inflammatory factors, thereby improving circulation's stability. However, conclusive data are lacking regarding the comparison between oXiris membrane (with the function of removing endotoxins and decreasing inflammatory factors) and AN69 filters (with the only function of decreasing inflammatory) on the mortality of patients with septic shock. The potential mechanisms of oXiris that might influence the mortality of septic shock patients remain unexplored. METHODS: This is a single-center, retrospective cohort study. The experimental group (30 patients with septic shock) was treated with oXiris-CVVH, and the control group (46 patients with septic shock) was treated with AN69 filter-CVVH. We employed the inverse probability of treatment-weighting method (IPTW), doubly robust estimation, and mediating effect analysis to analyze those clinical outcomes, with a special focus on the results of 28-day mortality, 72-h lactate, the need for norepinephrine (NE) in the next 72 h. RESULTS: A total of 76 patients with septic shock who received blood purification therapies were enrolled. After IPTW, differences in patient characteristics have been minimized. The 28-day mortality in the control group is higher than in the treatment group (73.3% vs. 47.3%, p < 0.001; median survival time: 10 vs. ≥28 days, log-rank p = 0.0366). And the 25% decrease and the 50% decrease in demand for NE in the next 72 h are different between the treatment and control groups (median time of 25% decrease in demand: 24 vs. >72 h, log-rank p = 0.0126; median time of 50% decrease in demand: 24 vs. >72 h, log-rank p = 0.0322). The 72-h lactic acid level and white blood cell (WBC) counts in the oXiris group are lower than in the control group. The 72-h lactate fully mediated the effects of oXiris on 28-day mortality after confounds adjustment. CONCLUSIONS: For septic shock patients, the use of oXiris-CVVH was associated with lower mortality and appeared to reduce lactate, NE dosage, PCT, and WBC counts, as compared to AN69-CVVH.

Electroacupuncture Promotes Autophagy by Regulating the AKT/mTOR Signaling Pathway in Temporal Lobe Epilepsy.

Temporal lobe epilepsy (TLE) is a complex neurological disease, and its occurrence and development are closely related to the autophagy signaling pathway. However, the mechanism by which electroacupuncture (EA) affects the regulation of autophagy has not been fully elucidated. TLE gene chip dataset GSE27166 and data from rats without epilepsy (n = 6) and rats with epilepsy (n = 6) were downloaded from Gene Expression Omnibus. The differentially expressed genes (DEGs) in the TLE and control groups were identified with the online tool GEO2R. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases were used to analyse the functional and pathway enrichment of genes in the most important modules. A rat model of TLE induced by lithium-pilocarpine treatment was established. EA treatment at DU20 and DU14 in TLE rats was performed for 2 weeks. Neuronal regeneration was determined using immunofluorescence staining. The protein levels of AKT/mTOR signaling pathway and autophagy markers were detected through western blotting and immunohistochemistry. This study identified 1837 DEGs, including 798 upregulated genes and 1039 downregulated genes. GO enrichment and KEGG analyses were performed on DEGs and revealed functional enrichment mainly in the mTOR signaling pathway and autophagy-animal. Furthermore, the number of mature neurons was significantly increased upon coexpressing BrdU/NeuN in TLE rats treated with EA. Western blotting and immunohistochemistry results showed significantly decreased levels of the phosphorylated-AKT and p-mTOR in the hippocampal CA3 and DG regions of TLE rats with EA treatment. And increased p-ULK1/ULK1, LC3-II/LC3-I and p62 levels in TLE rats with EA stimulation. Therefore, this study suggested that EA promoted autophagy in hippocampal neurons during the onset of epilepsy by regulating the AKT/mTOR signaling pathway to treat epilepsy.

The second DDOST-CDG patient with lactose intolerance, developmental delay, and situs inversus totalis.

Congenital disorders of glycosylation (CDGs) are inherited metabolic diseases affecting protein and lipid glycosylation. DDOST-CDG is a rare, newly identified type of CDGs, with only one case reported so far. In this study, we report a Chinese patient with a homozygous pathogenic variant in DDOST (c.1187G>A) and who presented with feeding difficulty, lactose intolerance, facial dysmorphism, failure to thrive, strabismus, high myopia, astigmatism, hypotonia, developmental delay and situs inversus totalis. Serum transferrin isoelectrofocusing demonstrated defective glycosylation in our patient. This finding further identifies DDOST as a genetic cause of CDGs and expands the clinical phenotype of DDOST-CDG.

Association of SHANK Family with Neuropsychiatric Disorders: An Update on Genetic and Animal Model Discoveries.

The Shank family proteins are enriched at the postsynaptic density (PSD) of excitatory glutamatergic synapses. They serve as synaptic scaffolding proteins and appear to play a critical role in the formation, maintenance and functioning of synapse. Increasing evidence from genetic association and animal model studies indicates a connection of SHANK genes defects with the development of neuropsychiatric disorders. In this review, we first update the current understanding of the SHANK family genes and their encoded protein products. We then denote the literature relating their alterations to the risk of neuropsychiatric diseases. We further review evidence from animal models that provided molecular insights into the biological as well as pathogenic roles of Shank proteins in synapses, and the potential relationship to the development of abnormal neurobehavioral phenotypes.

Genome-Wide DNA Methylation Pattern in Whole Blood Associated With Primary Intracerebral Hemorrhage.

Primary intracerebral hemorrhage (ICH) is a significant cause of morbidity and mortality throughout the world. ICH is a multifactorial disease that emerges from interactions among multiple genetic and environmental factors. DNA methylation plays an important role in the etiology of complex traits and diseases. We used the Illumina Infinium Human Methylation 850k BeadChip to detect changes in DNA methylation in peripheral blood samples from patients with ICH and healthy controls to explore DNA methylation patterns in ICH. Here, we compared genomic DNA methylation patterns in whole blood from ICH patients (n = 30) and controls (n = 34). The ICH and control groups showed significantly different DNA methylation patterns at 1530 sites (p-value < 5.92E-08), with 1377 hypermethylated sites and 153 hypomethylated sites in ICH patients compared to the methylation status in healthy controls. A total of 371 hypermethylated sites and 35 hypomethylated sites were in promoters, while 738 hypermethylated sites and 67 hypomethylated sites were in coding regions. Furthermore, the differentially methylated genes between ICH patients and controls were largely related to inflammatory pathways. Abnormalities in the DNA methylation pattern identified in the peripheral blood of ICH patients may play an important role in the development of ICH and warranted further investigation.

LC-MS-Based Untargeted Metabolomics Reveals Early Biomarkers in STZ-Induced Diabetic Rats With Cognitive Impairment.

Diabetes in the elderly increases cognitive impairment, but the underlying mechanisms are still far from fully understood. A non-targeted metabolomics approach based on liquid chromatography-mass spectrometry (LC-MS) was performed to screen out the serum biomarkers of diabetic mild cognitive impairment (DMMCI) in rats. Total 48 SD rats were divided into three groups, Normal control (NC) group, high-fat diet (HFD) fed group and type 2 diabetes mellitus (T2DM) group. The T2DM rat model was induced by intraperitoneal administration of streptozotocin (STZ, 35 mg/kg) after 6 weeks of high-fat diet (HFD) feeding. Then each group was further divided into 4-week and 8-week subgroups, which were calculated from the time point of T2DM rat model establishment. The novel object recognition test (NORT) and the Morris water maze (MWM) method were used to evaluate the cognitive deficits in all groups. Compared to the NC-8w and HFD-8w groups, both NOR and MWM tests indicated significant cognitive dysfunction in the T2DM-8w group, which could be used as an animal model of DMMCI. Serum was ultimately collected from the inferior vena cava after laparotomy. Metabolic profiling analysis was conducted using ultra high performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF-MS) technology. Principal component analysis (PCA) and orthogonal partial least squares discriminant analysis (OPLS-DA) were used to verify the stability of the model. According to variable importance in the project (VIP > 1) and the p-value of t-test (P < 0.05) obtained by the OPLS-DA model, the metabolites with significant differences were screened out as potential biomarkers. In total, we identified 94 differentially expressed (44 up-regulated and 50 down-regulated) endogenous metabolites. The 10 top up-regulated and 10 top down-regulated potential biomarkers were screened according to the FDR significance. These biomarkers by pathway topology analysis were primarily involved in the metabolism of sphingolipid (SP) metabolism, tryptophan (Trp) metabolism, Glycerophospholipid (GP) metabolism, etc. Besides, SP metabolism, Trp metabolism and GP metabolism mainly belonging to the lipid metabolism showed marked perturbations over DMMCI and may contribute to the development of disease. Taken collectively, our results revealed that T2DM could cause cognitive impairment by affecting a variety of metabolic pathways especially lipid metabolism. Besides, serum PE, PC, L-Trp, and S1P may be used as the most critical biomarkers for the early diagnosis of DMMCI.

Novel PRRT2 gene variants identified in paroxysmal kinesigenic dyskinesia and benign familial infantile epilepsy in Chinese families.

The present study was performed to investigate the clinical manifestations and pathogenic variants in three large families with autosomal dominant paroxysmal kinesigenic dyskinesia (PKD) and/or benign familial infantile epilepsy (BFIE) in China. Detailed clinical data and family history were collected. Genomic DNA was isolated from the peripheral blood samples of all available members. The genetic diagnosis was made by whole-exome sequencing on the three probands and the candidate variants were verified by PCR-Sanger sequencing. The pathogenicity of variants was predicted by bioinformatics analyses and classified according to the American College of Medical Genetics criteria. A total of three causative heterozygous variants were identified in the proline-rich transmembrane protein 2 (PRRT2) gene by DNA sequencing: A novel c.324_334del(p.Val109Argfs*21) deletion variant in Family A, as well as the previously known c.510_513del(p.Ser172Argfs*3) deletion variant in Family B and c.649dupC(p.Arg217Profs*8) duplication variant in Family C. The three variants of PRRT2 co-segregated with the phenotype and genotype in the family members. The present results deepen the current understanding of PKD/BFIE and extend the genotypic-phenotypic spectrum of PKD/BFIE.

Label-Free Liquid Chromatography-Mass Spectrometry Proteomic Analysis of Urinary Identification in Diabetic Vascular Dementia in a Han Chinese Population.

Objective: This study aimed to identify potential diagnostic biomarkers of diabetic vascular dementia (DVD) and unravel the underlying mechanisms using mass spectrometry (MS). Methods: Label-free liquid chromatography-tandem mass spectrometry (LC-MS/MS) proteomic analysis was applied to urine samples from four groups, including 14 patients with vascular dementia (VD), 22 patients with type 2 diabetes mellitus (T2DM), 12 patients with DVD, and 21 normal controls (NCs). Searching the MS data by Proteome Discoverer software (ThermoFisher Scientific; Waltham, MA, USA), protein abundances were analyzed qualitatively and quantitatively and compared between these groups. Combining bioinformatics analysis using Gene Ontology (GO), pathway crosstalk analysis using Kyoto Encyclopedia of Genes and Genomes (KEGG), protein-protein interaction (PPI) network analysis using STRING, and literature searching, the differentially expressed proteins (DEPs) of DVD can be comprehensively judged and were further quantified by receiver operating characteristic (ROC) curve methods. Results: The proteomic findings showed quantitative changes in patients with DVD compared to patients with NC, T2DM, and VD groups; among 4,744 identified urine proteins, 1,222, 1,152, and 1,180 proteins displayed quantitative changes unique to DVD vs. NC, T2DM, and VD, respectively, including 481 overlapped common DEPs. Then, nine unique proteins [including HP, SERPIND, ATP5PB, VNN2, ALDH3A1, U2AF2, C6, A0A5C2GRG5 (no name), and A0A5C2FZ29 (no name)] and two composite markers (CM) (A0A5C2GRG5+U2AF2 and U2AF2+C6) were confirmed by a ROC curve method. Conclusion: This study provided an insight into the potential pathogenesis of DVD and elucidated a method for early detection.

Impaired Cognitive Abilities in Siblings of Patients with Temporal Lobe Epilepsy.

PURPOSE: Patients with temporal lobe epilepsy (TLE) are at high risk of cognitive impairment. In addition to persistent seizures and antiepileptic drugs (AEDs), genetic factors also play an important role in the progression of cognitive deficits in TLE patients. Defining a cognitive endophenotype for TLE can provide information on the risk of cognitive impairment in patients. This study investigated the cognitive endophenotype of TLE by comparing neuropsychological function between patients with TLE, their unaffected siblings, and healthy control subjects. PATIENTS AND METHODS: A total of 46 patients with TLE, 26 siblings, and 33 control subjects were recruited. Cognitive function (ie, general cognition, short- and long-term memory, attention, visuospatial and executive functions, and working memory) was assessed with a battery of neuropsychological tests. Differences between groups were evaluated by analysis of covariance, with age and years of education as covariates. The Kruskal-Wallis test was used to evaluate data that did not satisfy the homogeneity of variance assumption. Pairwise comparisons were adjusted by Bonferroni correction, with a significance threshold of P<0.05. RESULTS: Patients with TLE showed deficits in the information test (P<0.001), arithmetic test (P=0.003), digit symbol substitution test (P=0.001), block design test (BDT; P=0.005), and backward digit span test (P=0.001) and took a longer time to complete the Hayling test Part A (P=0.011) compared to controls. Left TLE patients tended to have worse executive function test scores than right TLE patients. The siblings of TLE patients showed deficits in the BDT (P=0.006, Bonferroni-corrected) relative to controls. CONCLUSION: Patients with TLE exhibit cognitive impairment. Executive function is worse in patients with left TLE than in those with right TLE. Siblings show impaired visuospatial function relative to controls. Thus, cognitive deficits in TLE patients have a genetic component and are independent of seizures or AED use.

A conjoint analysis of epilepsy and migraine through network-and-pathway-based method.

BACKGROUND: Epilepsy and migraine are both considered as paroxysmal neurologic disorders. Previous studies have reported some cases with comorbidity of these two diseases. As the underlying molecular mechanism remains unclear, we performed a network-and-pathway-based method with candidate gene sets of epilepsy and migraine to explore it. METHODS: : Comparing the candidate genes between epilepsy and migraine, we identified 21 common genes. Functional enrichment analysis indicated that epilepsy and migraine are dysfunctional in the similar biological processes, such as glutamatergic transmissions, channel activities, and transporter activities. We also explored many shared pathways between these two diseases such as neuroactive ligand-receptor interaction. RESULTS: By combining systematical analysis and previous studies review, we finally identified six essential genes associated with the comorbidity of epilepsy and migraine. CONCLUSIONS: This is the first time to address the common ground of epilepsy and migraine by a systematic biology method. The present study provides a novel way to explain the potential mechanisms of these two diseases and a new set of therapeutic targets.

NR4A1 Methylation Associated Multimodal Neuroimaging Patterns Impaired in Temporal Lobe Epilepsy.

DNA hypermethylation has been widely observed in temporal lobe epilepsy (TLE), in which NR4A1 knockdown has been reported to be able to alleviate seizure severity in mouse model, while the underlying methylation-imaging pathway modulated by aberrant methylation levels of NR4A1 remains to be clarified in patients with TLE. Here, using multi-site canonical correlation analysis with reference, methylation levels of NR4A1 in blood were used as priori to guide fusion of three MRI features: functional connectivity (FC), fractional anisotropy (FA), and gray matter volume (GMV) for 56 TLE patients and 65 healthy controls. Post-hoc correlations were further evaluated between the identified NR4A1-associated brain components and disease onset. Results suggested that higher NR4A1 methylation levels in TLE were related with impaired temporal-cerebellar and occipital-cerebellar FC strength, lower FA in cingulum (hippocampus), and reduced GMV in putamen, temporal pole, and cerebellum. Moreover, findings were also replicated well in both patient subsets with either right TLE or left TLE only. Particularly, right TLE patients showed poorer cognitive abilities and more severe brain impairment than left TLE patients, especially more reduced GMV in thalamus. In summary, this work revealed a potential imaging-methylation pathway modulated by higher NR4A1 methylation in TLE via data mining, which may impact the above-mentioned multimodal brain circuits and was also associated with earlier disease onset and more cognitive deficits.

Silencing miR-20a-5p inhibits axonal growth and neuronal branching and prevents epileptogenesis through RGMa-RhoA-mediated synaptic plasticity.

Epileptogenesis is a potential process. Mossy fibre sprouting (MFS) and synaptic plasticity promote epileptogenesis. Overexpression of repulsive guidance molecule a (RGMa) prevents epileptogenesis by inhibiting MFS. However, other aspects underlying the RGMa regulatory process of epileptogenesis have not been elucidated. We studied whether RGMa could be modulated by microRNAs and regulated RhoA in epileptogenesis. Using microRNA databases, we selected four miRNAs as potential candidates. We further experimentally confirmed miR-20a-5p as a RGMa upstream regulator. Then, in vitro, by manipulating miR-20a-5p and RGMa, we investigated the regulatory relationship between miR-20a-5p, RGMa and RhoA, and the effects of this pathway on neuronal morphology. Finally, in the epilepsy animal model, we determined whether the miR-20a-5p-RGMa-RhoA pathway influenced MFS and synaptic plasticity and then modified epileptogenesis. Our results showed that miR-20a-5p regulated RGMa and that RGMa regulated RhoA in vitro. Furthermore, in primary hippocampal neurons, the miR-20a-5p-RGMa-RhoA pathway regulated axonal growth and neuronal branching; in the PTZ-induced epilepsy model, silencing miR-20a-5p prevented epileptogenesis through RGMa-RhoA-mediated synaptic plasticity but did not change MFS. Overall, we concluded that silencing miR-20a-5p inhibits axonal growth and neuronal branching and prevents epileptogenesis through RGMa-RhoA-mediated synaptic plasticity in the PTZ-induced epilepsy model, thereby providing a possible strategy to prevent epileptogenesis.

Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia.

Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

CpG methylation signature defines human temporal lobe epilepsy and predicts drug-resistant.

AIMS: Temporal lobe epilepsy (TLE) is the most common focal epilepsy syndrome in adults and frequently develops drug resistance. Studies have investigated the value of peripheral DNA methylation signature as molecular biomarker for diagnosis or prognosis. We aimed to explore methylation biomarkers for TLE diagnosis and pharmacoresistance prediction. METHODS: We initially conducted genome-wide DNA methylation profiling in TLE patients, and then selected candidate CpGs in training cohort and validated in another independent cohort by employing machine learning algorithms. Furthermore, nomogram comprising DNA methylation and clinicopathological data was generated to predict the drug response in the entire patient cohort. Lastly, bioinformatics analysis for CpG-associated genes was performed using Ingenuity Pathway Analysis. RESULTS: After screening and validation, eight CpGs were identified for diagnostic biomarker with an area under the curve (AUC) of 0.81 and six CpGs for drug-resistant prediction biomarker with an AUC of 0.79. The nomogram for drug-resistant prediction comprised methylation risk score, disease course, seizure frequency, and hippocampal sclerosis, with AUC as high as 0.96. Bioinformatics analysis indicated drug response-related CpGs corresponding genes closely related to DNA methylation. CONCLUSIONS: This study demonstrates the ability to use peripheral DNA methylation signature as molecular biomarker for epilepsy diagnosis and drug-resistant prediction.