ABSTRACT
BACKGROUND: Commonly used glucocorticoids replacement regimens in patients with hypopituitarism have difficulty mimicking physiological cortisol rhythms and are usually accompanied by risks of over-treatment, with adverse effects on glucose metabolism. Disorders associated with glucose metabolism are established risk factors of cardiovascular events, one of the life-threatening ramifications. AIM: To investigate the glycometabolism profile in patients with hypopituitarism receiving prednisone (Pred) replacement, and to clarify the impacts of different Pred doses on glycometabolism and consequent adverse cardiovascular outcomes. METHODS: Twenty patients with hypopituitarism receiving Pred replacement [patient group (PG)] and 20 normal controls (NCs) were recruited. A flash glucose monitoring system was used to record continuous glucose levels during the day, which provided information on glucose-target-rate, glucose variability (GV), period glucose level, and hypoglycemia occurrence at certain periods. Islet ß-cell function was also assessed. Based on the administered Pred dose per day, the PG was then regrouped into Pred > 5 mg/d and Pred ≤ 5 mg/d subgroups. Comparative analysis was carried out between the PG and NCs. RESULTS: Significantly altered glucose metabolism profiles were identified in the PG. This includes significant reductions in glucose-target-rate and nocturnal glucose level, along with elevations in GV, hypoglycemia occurrence and postprandial glucose level, when compared with those in NCs. Subgroup analysis indicated more significant glucose metabolism impairment in the Pred > 5 mg/d group, including significantly decreased glucose-target-rate and nocturnal glucose level, along with increased GV, hypoglycemia occurrence, and postprandial glucose level. With regard to islet ß-cell function, PG showed significant difference in homeostasis model assessment (HOMA)-ß compared with that of NCs; a notable difference in HOMA-ß was identified in Pred > 5 mg/d group when compared with those of NCs; as for Pred ≤ 5 mg/d group, significant differences were found in HOMA-ß, and fasting glucose/insulin ratio when compared with NCs. CONCLUSION: Our results demonstrated that Pred replacement disrupted glycometabolic homeostasis in patients with hypopituitarism. A Pred dose of > 5 mg/d seemed to cause more adverse effects on glycometabolism than a dose of ≤ 5 mg/d. Comprehensive and accurate evaluation is necessary to consider a suitable Pred replacement regimen, wherein, flash glucose monitoring system is a kind of promising and reliable assessment device. The present data allows us to thoroughly examine our modern treatment standards, especially in difficult cases such as hormonal replacement mimicking delicate natural cycles, in conditions such as diabetes mellitus that are rapidly growing in worldwide prevalence.
ABSTRACT
BACKGROUND: Hyperphosphatemia is a common complication of late-stage chronic kidney disease (CKD). Nicotinamide (NAM) has been reported as an adjunctive therapy for hyperphosphatasemia, but the effect of NAM on fibroblast growth factor 23 (FGF23) and Klotho has rarely been reported. METHODS: We randomly assigned 98 patients who underwent regular hemodialysis to received NAM (0.5-1.5 g per day, or 1-3 tablets per day) or placebo (1-3 tablets per day) as an add-on therapy of calcium-based phosphorus binders in a 1:1 ratio. All enrollments were followed-up for 52 weeks. We investigated the serum phosphorus as the primary outcome and serum FGF23 and Klotho as the secondary outcomes. Abdominal aortic calcification (AAC), which had a good correlation with coronary calcification was also compared between the two groups. RESULTS: In total, 37 patients in the placebo group and 35 patients in the NAM group completed the 52-week follow-up. Compared with the placebo group, the NAM group showed a significant decrease of serum phosphorus at the 8th, 12th, 20th, 44th, and 52nd week. There was a declining trend of FGF23 and Klotho in both the placebo and NAM groups. Linear mixed models (LMMs) for overall comparisons by repeated measures of analysis of variance (ANOVA) revealed a significant decrease of FGF23 and slower declining rate of Klotho in the NAM group. No significant difference of AAC was detected between the two groups (P=0.805). CONCLUSIONS: NAM can not only further decrease the phosphorus level but also reduce the FGF23 level and slow down the descending rate of Klotho in chronic hemodialysis patients.
ABSTRACT
RATIONALE: Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation. PATIENT CONCERNS: A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia. DIAGNOSES: She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome. INTERVENTIONS: The proband was treated with intravenous glucose (at least 250âg per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing. OUTCOMES: A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability. LESSONS: Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.
