Exploring the effectiveness of endometrial receptivity array and immune profiling in patients with multiple implantation failure：A retrospective cohort study based on propensity score matching.

This study aimed to evaluate the effectiveness of the endometrial receptivity array (ERA), endometrial immune profiling, and a combination of both in improving the pregnancy outcomes for multiple implantation failure patients. According to patients' willingness, 1429 women who incurred at least two or more consecutive implantation failures in IVF/ICSI treatment opted for frozen embryo transfer and were divided into four groups: 'No test', 'Immune Profiling', 'ERA' and 'ERA+ Immune Profiling'. Women in three test groups underwent timed endometrial biopsy for ERA, immune profiling, a combination of both. We observed the overall incidence rates of the displaced window of implantation (WOI) and endometrial immune dysregulation were 75.14% and 79.29%, respectively. After 1:1 propensity score matching (PSM), our data revealed that the 'ERA' and 'ERA + Immune Profiling' groups demonstrated significantly higher rates of biochemical, clinical, ongoing pregnancy, and implantation compared to the 'No test' group (p < 0.01). The 'Immune Profiling' group showed a higher implantation rate compared to 'No test' group (p < 0.05). Furthermore, when comparing three test groups, the 'ERA + Immune Profiling' group exhibited notably higher rates of clinical and ongoing pregnancy compared to the 'Immune Profiling' group (p < 0.017). However, there was no association between endometrial immune profiling and ERA phases, and their results did not differ between embryo implantation and non-implantation in these patients. Our findings underline the increased implantation rates by use of ERA and endometrial immune profiling in patients with multiple implantation failure, either individually or corporately. Moreover, a combination of both could improve their pregnancy outcomes significantly.

First Report of Epicoccum latusicollum Causing Leaf Spot Disease on Banana in China.

Banana (Musa acuminata) is one of the most important fruit crops in the world. In June 2020, a leaf spot disease was detected on M. acuminata (AAA Cavendish cv. Williams B6) in a commercial plantation (∼1.2 ha), Nanning, Guangxi province, China. The disease occurred on ~30% of plants. The first symptoms were round or irregular dark brown spots on the leaf surface, which progressively expanded into large, suborbicular or irregular-shaped dark brown necrotic areas. Finally, the lesions coalesced and resulted in leaf abscission. Fragments of tissues (~5 mm) were cut from six symptomatic leaves, surface disinfected (2 min in 1% NaOCl, and rinsed three times in sterile water), and incubated on potato dextrose agar (PDA) at 28°C for 3 days. The hyphal tips from emerging colonies were transferred onto fresh PDA plates to obtain pure cultures. From the 23 isolates, 19 exhibited similar morphology. The colonies on PDA and Oatmeal agar (OA) were villose, dense, white to grey. NaOH spot test resulted in a dark green discolouration on malt extract agar (MEA) cultures. After 15 days of incubation, pycnidia were observed, which were dark, spherical or flat spherical, 67.1 to 173.1 µm (n = 64) in diameter. Conidia were oval mostly, aseptate, hyaline, guttulate, 4.1 to 6.3 × 1.6 to 2.8 µm (n = 72). Morphological features were similar to Epicoccum latusicollum (Chen et al. 2017, Qi et al. 2021). The internal transcribed spacer (ITS), the partial 28S large subunit rDNA (LSU), beta-tubulin (TUB), and RNA polymerase II second largest subunit (RPB2) genes of the three representative isolates (GX128.6.3, GX132.14.1, GX140.4.3) were amplified and sequenced using the primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), TUB2-Ep-F/TUB2-Ep-R (GTTCACCTTCAAACCGGTCAATG/AAGTTGTCGGGACGGAAGAGCTG), and RPB2-Ep-F/RPB2-Ep-R (GGTCTTGTGTGCCCCGCTGAGAC/TCGGGTGACATGACAATCATGGC), respectively. The ITS (OL614830-32), LSU (OL739128-30), TUB (OL739131-33), and RPB2 (OL630965-67) sequences were 99% (478/479, 478/479, and 478/479 bp), 99% (881/882, 867/868, and 877/878 bp), 99 to 100% (332/333, 333/333, and 333/333 bp), and 100% (556/556, 559/559, and 555/555 bp) identical to those of the ex-type E. latusicollum LC5181 (KY742101, KY742255, KY742343, KY742174) (Chen et al. 2017). A phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular data, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on 1.5 months old banana plants (cv. Williams B6) were stab-wounded using a needle and inoculated with either mycelial discs (5 mm) or aliquots of 10 µl conidial suspension (106 conidia/ml). Three leaves on each of six plants were inoculated. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free PDA discs or sterile water served as controls. All plants were incubated in a greenhouse at 28°C (12-h photoperiod, 80% humidity). After seven days, leaf spot appeared on the inoculated leaves. No symptoms were detected on controls. The experiments were repeated three times showed similar results. To fulfill Koch's postulates, the Epicoccum isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing. To our knowledge, this is the first report of E. latusicollum causing leaf spot on banana in China. This study may provide the basis for control of the disease.

Dysregulated low-density granulocyte contributes to early spontaneous abortion.

Spontaneous abortion (SA) is a common adverse pregnancy event with unclarified pathogenesis and limited therapeutic efficiency. Although most SA cases with the euploid embryo(s) are associated with immunological factors, the contribution of low-density granulocyte (LDG) in SA pathogenesis is rarely reported. This study aimed to investigate the serial characteristics and possible contribution of LDG and their subpopulations in early pregnancy, especially in early SA. Unpregnant (UP), normally pregnant (NP), and SA women were recruited, and the peripheral blood and endometrium/decidua were collected for LDG isolation and histological observation. The percentage, phenotype, and subpopulations of LDG were analyzed via flow cytometric analysis, and the ability of Nets formation was assessed by immunofluorescent and immunohistochemical assays. As a result, 43 participants were enrolled, including 10 UP, 15 NP, and 18 SA women. Compared with the UP group, the LDG percentage in peripheral blood mononuclear cells (PBMCs) and decidual immune cells (DICs) increased in the NP group, while the loss of this increase was observed in the SA group. Meanwhile, CD16int/- cell percentage in peripheral blood LDG (PB-LDG) increased in the NP and SA groups, and insufficient activation of CD16hi PB-LDG characterized by reduced CD11b expression was discovered in the SA group. Moreover, the LDG percentage in DICs was higher than that in PBMCs, and the decidual LDG (D-LDG) showed a surface marker expression profile that is easier to be activated in the pregnant cohort (NP + SA women). Finally, increased decidual Nets formation was observed in the SA group compared with the NP group, and more Nets formation was detected in D-LDG of NP and SA women following PMA stimulation. Overall, LDG participates in the maintenance of early pregnancy, while dysregulated LDG is responsible for early SA, providing novel potential targets for further exploration of SA pathogenesis and therapeutics.

Phenylethanoid Glycosides of Cistanche Improve Learning and Memory Disorders in APP/PS1 Mice by Regulating Glial Cell Activation and Inhibiting TLR4/NF-κB Signaling Pathway.

Phenylethanoid Glycosides of Cistanche (PhGs) have a certain curative effect on AD animal model, Echinacea (ECH) and verbascoside (ACT), as the quality control standard of Cistanche deserticola Y. C. Ma and the main representative compounds of PhGs have been proved to have neuroprotective effects, but the specific mechanism needs to be further explored. This study explored the mechanisms of PhGs, ECH, and ACT in the treatment of Alzheimer's disease (AD) from the perspectives of glial cell activation, TLR4/NF-κB signaling pathway, and synaptic protein expression. We used APP/PS1 mice as AD models. After treatment with PhGs, ECH, and ACT, the learning and memory abilities of APP/PS1 mice were enhanced, and the pathological changes in brain tissue were alleviated. The expression of pro-inflammatory M1 microglia markers (CD11b, iNOS, and IL-1ß) was decreased; the expression of M2 microglia markers (Arg-1 and TGF-ß1) was increased, which promoted the transformation of microglia from M1 pro-inflammatory phenotype to M2 anti-inflammatory phenotype. In addition, PhGs, ECH, and ACT could down-regulate the expression of proteins related to the TLR4/NF-κB signaling pathway and up-regulate the expression of synaptic proteins. The results indicated that PhGs, ECH, and ACT played a neuroprotective role by regulating the activation of glial cells and inhibiting the TLR4/NF-κB inflammatory pathway, and improving the expression levels of synapse-related proteins.

Effects of HSYA on serum and brain cholesterol levels in AD rats based on quantitative proteomics.

Backgroud: Hydroxysafflor yellow A (HSYA) has a certain improvement effect on Alzheimer's disease (AD) rats, but its specific mechanism is still unclear. The purpose of this study was to observe the regulatory effect of HSYA on learning and memory ability of AD rats induced by Aß1-42.Materials and methods: Morris water maze test was used to evaluate the effect of HSYA on the learning and memory ability of AD model rats. To explore the effective targets and potential molecular mechanisms of HSYA in AD treatment based on quantitative proteomics.Results: Through the Morris water maze experiment, we found that after HSYA treatment, the learning ability of rats in the model group has been significantly improved. Quantitative proteomics results showed that among the 11 common differential proteins between the "model/sham operation" comparison group and the "HSYA treatment/model" comparison group, the cholesterol synthesis rate-limiting enzyme mevalonate decarboxylase (Mvd) Western Blot results are consistent with the results of quantitative proteomics analysis. We found that HSYA can inhibit the expression of BACE protein in hippocampus of AD rats and decrease the level of Aß1-42. Besides, HSYA could also reduce cholesterol levels in serum and hippocampus.Conclusion: In summary, HSYA can effectively improve learning and memory disorders in AD rats, and exert neuroprotective effects by effectively controlling serum and brain cholesterol to down-regulate the expression of BACE and thus reduce the content of Aß1-42.

Scaled Sea Surface Design and RCS Measurement Based on Rough Film Medium.

The electromagnetic (EM) scattering characteristics of the rough sea surface is very important for target surveying and detection in a sea environment. This work proposes a scaled sea surface designing method based on a rough thin-film medium. For the prototype sea surface, the permittivity is calculated with the seawater temperature, salinity, and EM wave frequency according to the Debye model. The scale film material is mixed with carbon black and epoxy, whose volume ratio is optimized with the genetic algorithm through the existing electromagnetic parameter library. This method can overcome the previous difficulties of adjusting the same permittivity of the prototype sea water. According to the EM scaled theory, the scaled geometric sample is numerically generated with the D-V spectrum for the given wind speed, and is fabricated using 3D printing to keep the similar seawater shape. Then, the sample is sprayed with a layer of film material for EM scattering measurement. The simulated and measured radar cross-section (RCS) results show good consistency for the prototype seawater and scaled materials, which indicates the proposed scaled method is a more efficient method to get the seawater scattering characteristics.

miR-146a-5p enhances embryo survival in unexplained recurrent spontaneous abortion by promoting M2 polarization of decidual macrophages.

Unexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions in the reproductive field, and macrophage M1/M2 polarization disorder is involved in URSA pathogenesis, although the relevant mechanisms are undefined. miR-146a-5p possesses an immunoregulatory role and is expressed in decidual immune cells, and this study aims to investigate its effect on decidual macrophage polarization and therapeutic prospects in URSA, which has never been reported. The levels of M1/M2 markers in the deciduae and the miR-146a-5p expression in the decidual macrophages of URSA and healthy pregnant women were first detected and analyzed. Then, the in vitro effect of miR-146a-5p on the M1/M2 polarization and the secretion of inflammatory cytokines was investigated in Tamm-Horsfall protein-1 (THP-1)-induced macrophages. Finally, the in vivo immunotherapeutic effect of miR-146a-5p on embryo survival and the potential mechanisms were evaluated in a murine model of immune-based URSA. As a result, the abnormal M1/M2 polarization, which showed a shift towards the M1 phenotype and correlated with the decreased expression of miR-146a-5p, was verified in human URSA decidual macrophages. miR-146a-5p could inhibit M1 polarization, promote M2 polarization, and result in an anti-inflammatory microenvironment in THP-1-induced macrophages. The intravenous injection of exogenous miR-146a-5p in the first trimester of pregnant URSA mice significantly reduced the embryo resorption rate and promoted the M2 polarization of decidual macrophages. In conclusion, miR-146a-5p enhances embryo survival in URSA by promoting decidual macrophage polarization toward an M2 phenotype, giving new ideas and potential targets for subsequent research on the pathogenesis and immunotherapeutic strategies of URSA.

Comparison of the Effectiveness of Endometrial Receptivity Analysis (ERA) to Guide Personalized Embryo Transfer with Conventional Frozen Embryo Transfer in 281 Chinese Women with Recurrent Implantation Failure.

BACKGROUND This study aimed to compare the effectiveness of endometrial receptivity analysis (ERA)-guided personalized embryo transfer (pET) with conventional frozen embryo transfer (FET) in 281 Chinese women with recurrent implantation failure (RIF). MATERIAL AND METHODS A total of 281 eligible patients with RIF were recruited and assigned to ERA (ERA followed by pET) and FET groups. The clinical pregnancy outcomes were compared between the 2 groups. RESULTS There were no significant differences between the ERA and FET groups in terms of endometrial thickness on the day of embryo transfer, mean attempts of assisted reproductive technology (ART) treatment, anti-Mullerian hormone, follicle-stimulating hormone, or antral follicle count in the fresh cycle (P>0.05). The ERA test identified 35% of samples as receptive and 65% as nonreceptive, and comparable pregnancy outcomes were observed between receptive and nonreceptive patients (P>0.05). Higher pregnancy and implantation rates were found in the ERA group than in the FET group (P<0.01), while no significant differences were detected between the 2 groups in terms of miscarriage rates (P>0.05). CONCLUSIONS In this study of Chinese women with RIF undergoing in vitro fertilization and embryo transfer, ERA-guided pET resulted in a significant improvement in pregnancy and implantation rates when compared with FET.

Effectiveness comparison between endometrial receptivity array, immune profiling and the combination in treating patients with multiple implantation failure.

PROBLEM: The clinical value of endometrial receptivity array (ERA), endometrial immune profiling, or a combination of both for multiple implantation failure patients is unclear. METHOD OF STUDY: One hundred and seventy-two women with a history of at least two or more consecutive implantation failures in IVF/ICSI treatment were included. According to patients' willingness, they were divided into four groups, 'no treatment', 'Immune Profiling', 'ERA' and 'ERA + Immune Profiling'. Endometrial biopsy was examined by ERA, immune profiling alone, or combination, and intention was adopted accordingly. Pregnancy outcomes were compared, and the association between ERA phases and endometrial immune profiling was also assessed. RESULTS: The overall incidence rate of the displaced window of implantation (WOI) and endometrial immune dysregulations were 84.9% and 75.3%, respectively. Implantation rate was significantly higher in the 'ERA + Immune Profiling' group than the 'no treatment' group (P = .007). Clinical pregnancy rate was somewhat improved in the three treatment groups but with a borderline significance (P = .071). After controlling for other confounders, 'ERA + Immune Profiling' treatment was associated with a higher pregnancy rate [aOR (95%CI)  = â€Š3.412 (1.387-8.395), P = .008]. There was no association between endometrial immune profiling and ERA phases. CONCLUSIONS: Our findings highlight the high incidence of displaced WOI and endometrial immune dysregulation in multiple implantation failure patients. The combination of ERA and endometrial immune profiling is more likely to have clinical value than ERA or immune profiling alone. These data suggested the unsubstitutability of ERA and endometrial immune profiling on the treatment outcome for multiple implantation failure patients.

miR-146a-5p improves the decidual cytokine microenvironment by regulating the toll-like receptor signaling pathway in unexplained spontaneous abortion.

Spontaneous abortion (SA) is a common pregnancy failure, but the cause of numerous cases remains unexplained. Decidual immune cells (DICs)-mediated cytokine microenvironment is involved in pregnancy and regulated by many microRNAs, but whether microRNA-146a-5p (miR-146a) regulate the decidual cytokine microenvironment and the potential mechanisms in unexplained SA pathogenesis have rarely been reported. In this study, the levels of cytokines and miR-146a in healthy and unexplained SA deciduae were first investigated, and the correlation between them was analyzed. Then, the effect of miR-146a inhibitor on cytokines was assessed in healthy deciduae-derived DICs. Third, the downstream targets and related molecular mechanisms of miR-146a were analyzed by bioinformatics, and the levels of the predicted targets in deciduae were assessed, followed by the correlation analysis between the levels of miR-146a and the targets. Finally, the effect of miR-146a on the predicted targets and inflammatory cytokines was validated in unexplained SA deciduae-derived DICs. As a result, decreased miR-146a correlated with the cytokine disorder in unexplained SA deciduae, and inhibition of miR-146a promoted pro-inflammatory response in healthy deciduae-derived DICs. One hundred four target genes and related molecular mechanisms of miR-146a were predicted, among which the toll-like receptor (TLR) pathway might be associated with the decidual cytokine regulation. Upregulation of miR-146a inhibited the expression of the predicted molecules enriched in the TLR pathway and improved the cytokine disorder in unexplained SA deciduae-derived DICs. Collectively, miR-146a improves the decidual cytokine microenvironment by regulating the TLR pathway in unexplained SA, providing novel potential targets for further therapeutic research.

High-throughput method for preliminary screening of high dietary fiber rice.

Dietary fiber has several benefits for humans, and the development of healthier rice with an improved dietary fiber composition has attracted increasing amounts of attention. Based on the method of AOAC 2002.02, we developed a simplified method to screen polished rice containing high total dietary fiber (TDF). Mutant cw with a high TDF content could be distinguished easily from R7954 (indica) and Nipponbare (japonica) by the digestion-resistant phenotype, which is characterized as an almost intact grain after hydrolysis by pepsin, pancreatic α-amylase and amyloglucosidase. The individuals identified from the F2 population showed digestion resistance all had TDF content higher than 5%, while those without a digestion-resistant phenotype had TDF content lower than 5%. The phenotype of digestion resistance could be a valuable index for identifying rice with higher TDF content, and the identification of this phenotype provides a simplified, economical and high throughput method for high TDF rice breeding.

Ethanol treatment improves the sensory quality of cherry tomatoes stored at room temperature.

The effects of ethanol treatment on quality characteristics of cherry tomatoes were investigated over 11 days of storage at room temperature (25 °C). Results showed that sensory quality was improved after ethanol treatment, with redder, softer fruits at the edible stage (11 days) compared with control fruit. In addition, the contents of ascorbic acid, sucrose and fructose were elevated after ethanol treatment as well as the concentration of 6-methyl-5-hepten-2-one. Conversely, decreased levels of methyl salicylate (MeSA), guaiacol, (Z)-3-hexenal and (E)-2-hexenal were observed. Selected consumers showed a preference for ethanol-treated cherry tomato fruits compared with controls. Taken together, 0.1% ethanol application has the potential to improve the quality characteristics of cherry tomatoes stored at room temperature.

Enhanced therapeutic efficacy of LHRHa-targeted brucea javanica oil liposomes for ovarian cancer.

BACKGROUND: Although brucea javanica oil liposomes (BJOLs) have been used clinically to treat ovarian cancer, its clinical efficacy is often limited by systemic side effects due to non-specific distribution. Luteinizing hormone releasing hormone receptor (LHRHR) is overexpressed in most ovarian cancers but negligibly expressed in most of the other visceral organs. In this study, we aimed to develop a novel LHRHa targeted and BJO-loaded liposomes (LHRHa-BJOLs), and investigate its characteristics, targeting ability and anti-ovarian cancer efficiency both in vitro and in vivo. METHODS: The LHRHa-BJOLs were prepared by film-dispersion and biotin-streptavidin linkage methods, and characterized in terms of its morphology, particle size, zeta potential, ligand conjugation, encapsulation efficiency and stability. The targeting nature and antitumor effects of the liposomes were evaluated in vitro using cultured human ovarian cancer A2780/DDP cells, and in vivo using ovarian cancer-bearing nude mice. RESULTS: The LHRHa-BJOLs were successfully synthesized, with a uniformly spherical shape, appropriate particle size and zeta potential, as well as a high encapsulation efficiency. Compared to non-targeted liposomes and BJO emulsion, the LHRHa-BJOLs could significantly increase specific intracellular uptaking rate, enhance cell inhibitory effect and induce cell apoptosis in A2780/DDP cells in vitro. Meanwhile, LHRHa-BJOLs also had a significantly stronger activity of targeting tumor tissue, inhibiting tumor growth, inducing tumor apoptosis and prolonging survival time in ovarian cancer-bearing mice in vivo. CONCLUSIONS: Our experiment suggests that LHRHa-BJOLs may be a useful targeted drug for the treatment of ovarian cancer.

Sequence variation and haplotypes of lipoxygenase gene LOX-1 in the Australian barley varieties.

BACKGROUND: Lipoxygenases are a family of enzymes which catalyse the hydroperoxidation of polyunsaturated fatty acids with a cis, cis-1,4-pentadiene to form conjugated hydroperoxydienes. Lipoxygenase-1 (LOX-1) in barley worsens the flavour and foam stability of beer. It has become a major selection criteria for malting quality in the last few years. RESULTS: Lipoxygenase activity was investigated in 41 Australian barley cultivars and advanced breeding lines released since the 1950s; the cultivars differed markedly, ranging from 22.3 to 46.5 U/g. The structural gene and its promoter of lipoxygenase-1 were sequenced from the barley varieties representing different levels of LOX. Based on the analysis of nucleotide and deduced amino acid sequences, two major haplotypes were identified. Barley varieties with lower LOX were classified into three categories based on their pedigrees and sequence variations in the structural gene: (1) barley varieties derived from Canadian varieties with the pre-harvest sprouting susceptible allele, (2) Skiff and Hindmarsh with unique haplotype in the structural gene, and (3) Gairdner and Onslow with an unknown mechanism. CONCLUSION: Lipoxygenase activity has been reduced in the malting barley cultivars in the last 60 years although it is only recognized as a malting quality trait recently. There are clear haplotypes of the lipoxygenase structual gene. The polymorphisms detected in the structural gene can be used to design molecular markers for selection of low LOX haplotype. Other mechanisms also existed for controlling lipoxygenase activity. The results suggest that it is possible to develop barley varieties with lower LOX by combination of low LOX-1 haplotype and other trans-regulation factors.

A nonsense mutation in a putative sulphate transporter gene results in low phytic acid in barley.

Low phytic acid grains can provide a solution to dietary micronutrient deficiency and environmental pollution. A low phytic acid 1-1 (lpa1-1) barley mutant was identified using forward genetics and the mutant gene was mapped to chromosome 2HL. Comparative genomic analysis revealed that the lpa1-1 gene was located in the syntenic region of the rice Os-lpa-MH86-1 gene on chromosome 4. The gene ortholog of rice Os-lpa-MH86-1 (designated as HvST) was isolated from barley using polymerase chain reaction and mapped to chromosome 2HL in a doubled haploid population of Clipper×Sahara. The results demonstrate the collinearity between the rice Os-lpa-MH86-1 gene and the barley lpa1-1 region. Sequence analysis of HvST revealed a single base pair substitution (C→T transition) in the last exon of the gene in lpa1-1 (M422), which resulted in a nonsense mutation. These results will facilitate our understanding of the molecular mechanisms controlling the low phytic acid phenotype and assist in the development of a diagnostic marker for the selection of the lpa1-1 gene in barley.

Slow digestion properties of rice different in resistant starch.

The hydrolysis of starch is a key factor for controlling the glycemic index (GI). Slow digestion properties of starch lead to slower glucose release and lower glycemic response. Food with high resistant starch (RS) possesses great value for controlling the GI. To elucidate the factors that play a role in slow digestibility, seven rice mutants different in RS contents were selected for comparative studies. The degree of hydrolysis showed highly significant correlation with RS, apparent amylose content (AAC), lipid content (LC), and other starch physiochemical properties in all these materials with different RS contents. The rate of in vitro digestible starch correlated positively with RS, whereas digestibility was affected mostly by lipid content for those mutants with similar RS. Starch-lipid complexes and short chains with degrees of polymerization (DP) of 8-12 strongly influenced starch digestion. The integrity of aggregated starch and the number of round starch granules might influence the digestibility of starch directly.