Association of serum asprosin with metabolic dysfunction-associated fatty liver disease in older adult type 2 diabetic patients: a cross-sectional study.

BACKGROUND: To explore the association of serum asprosin levels with metabolic dysfunction-associated fatty liver disease (MAFLD) in older adults with type 2 diabetes mellitus (T2DM). METHODS: The cross-sectional study enrolled patients ≥ 65 years old diagnosed with T2DM at two community health service centers between November 2019 and July 2021. Logistic regression was applied to analyze the influencing factors of MAFLD. RESULTS: Totally 219 cases were included. Compared with diabetic individuals without MAFLD (n = 105), diabetics with MAFLD (n = 114) had younger ages, higher body mass index values, shorter time from T2DM diagnosis, increased waist-to-hip ratios, elevated triglycerides, reduced high-density lipoprotein cholesterol (HDL-C), elevated alanine aminotransferase (ALT), elevated γ-glutaryl transferase, elevated fasting insulin, and elevated HOMA-IR (all P < 0.05). Serum asprosin levels were elevated in diabetics with MAFLD in comparison with the non-MAFLD group (291.71 ± 73.69 vs. 255.24 ± 82.52 pg/ml, P = 0.001). Multivariable analysis revealed, after adjusted for age, time from T2DM diagnosis, HDL-C, and ALT, serum asprosin level (OR = 1.006, 95%CI: 1.001-1.010, P = 0.014) were independently associated with MAFLD in T2DM. CONCLUSIONS: High asprosin level are associated with MAFLD in older patients with T2DM, after adjusted for age, time from T2DM diagnosis, WHR, TG, HDL-C, ALT, GGT, FINS, and HOMA-IR.

The correlation between serum asprosin and left ventricular diastolic dysfunction in elderly patients with type 2 diabetes mellitus in the community.

AIMS/INTRODUCTION: Serum asprosin is expected to become a screening indicator in early-stage diabetic heart disease. The relationship between serum asprosin and left ventricular diastolic dysfunction (LVDD) was studied in elderly patients with type 2 diabetes mellitus in the community. MATERIALS AND METHODS: A total of 252 elderly patients with type 2 diabetes mellitus were recruited from Zhuoma Community Care Station and Chengbei West Street Community Care Service Center in Changzhi City of Shanxi Province from November 2019 to July 2021. Patients were divided into the LVDD group (n = 195) and the non-LVDD group (n = 57). The t-test, Mann-Whitney U test, and χ2 test were used to compare indicators between the LVDD group and the non-LVDD group. Pearson or Spearman correlation analysis was adopted to evaluate the correlation between serum asprosin and other clinical data. Multivariate logistic regression analysis was applied to analyze the influencing factors on LVDD. RESULTS: Compared with patients without LVDD, patients with LVDD had a higher level of low-density lipoprotein cholesterol (LDL-C), fasting blood glucose (FPG), and asprosin, but a lower level of early diastolic movement speed (A) to diastolic movement velocity (E) (E/A). Asprosin was positively associated with waist circumference (WC), body mass index (BMI), creatinine, triglycerides (P < 0.05), and negatively associated with E/A and high density lipoprotein cholesterol HDL-C (P < 0.05). The risk of LVDD increased with elevated asprosin levels after adjustment for age, systolic blood pressure (SBP), BMI, FPG, and LDL-C. Compared with patients in the lowest tertile of serum asprosin (<275.25 pg/mL), a serum level of asprosin between 275.25-355.08 pg/mL [OR (95% CI) is 2.368 (1.169-4.796), P < 0.05] and asprosin >355.08 pg/mL [OR (95% CI) is 2.549 (1.275-5.095), P < 0.05] patients have a higher risk of left ventricular diastolic dysfunction. CONCLUSIONS: Serum asprosin was positively associated with left ventricular diastolic dysfunction, and the risk of LVDD increased significantly with increased serum levels of asprosin.

Molecular analysis of eight splicing variants in the hydroxymethylbilane synthase gene.

Background: Molecular genetic testing is the most sensitive and specific method to confirm acute intermittent porphyria (AIP), a rare autosomal dominant disease, caused by Hydroxymethylbilane synthase (HMBS) gene mutation. According to the Human Gene Mutation Database (HGMD), approximately 20% of the reported HMBS gene variants affect pre-RNA splicing. Thus, the ensuing challenge is how to decipher the pathogenicity of these splicing variants. Methods: Using next-generation sequencing, we identified a novel heterozygous variant in the HMBS gene (c.160 + 5G>C) from a Chinese family with AIP. And, previously, seven HMBS variants (c.33 + 5G>A, c.88-16_88-4del, c.88-2A>G, c.161-1G>C, c.652-1G>A, c.772-2A>G and c.772-1G>C) have been reported to be linked with AIP. Herein, we performed a valid and novel in vitro minigene assay to analyze the pathogenicity of these eight splicing variants. Results: By minigene assay in 293 T cell experiments, we demonstrated that all eight variants caused splicing defects in the pre-mRNA of the HMBS gene: c.160 + 5G>C (intron3p_141bp retention), c.33 + 5G>C(intron1p_91bp retention), c.88-16_88-4del and c.88-2A>G (Exon3p_15bp deletion), c.161-1G>C (Exon4p_18bp deletion), c.652-1G>A (Exon11p_1bp deletion), c.772-2A>G and c.772-1G>C (intron11q_104bp retention or Exon12p_4bp deletion).Encouragingly, the c.160 + 5G>C RNA sequencing from peripheral blood lymphocytes was consistent with the minigene assay result. Conclusion: We have made a pioneering attempt to apply minigene in vitro validation to the HMBS gene to evaluate the splicing effect of eight variants, including a novel splice variant (c.160 + 5G>C). This study provides a molecular basis for future research on the pathogenesis and gene therapy of AIP.

Rare combination of simple virilizing form of 21-hydroxylase deficiency, Graves' disease and 47, XXX in a woman: A case report.

RATIONALE: Coexistence of congenital adrenal hyperplasia due to 21-hydroxylase deficiency, Graves' disease and 47, XXX is rare. We report a case of a 25-year-old woman presented with masculine appearance, hirsutism and enlarged clitoris. Lab tests showed elevated serum 17 hydroxyprogesterone, testosterone, dehydroepiandrosterone. Gene test revealed heterozygous gene mutation in CYP21A2:NM_000500:exon4:c.518 T > A, NM_000500:exon8:c.C1024T. Karyotype analysis showed 47, XXX. After prednisone replacement and antithyroid therapy, she got a normal menstruation and normal level of testosterone. These findings demonstrate that patients with abnormal chromosome are likely to combine 21-hydroxylase deficiency (21-OHD), thus karyotyping test should not be neglected for those who have been already diagnosed as 21-OHD. Additionally, chromosomal abnormality such as 47, XXX and Turner syndrome had susceptibility to develop autoimmune thyroid disease because a gene on X chromosome may be responsible for the occurrence of autoimmune thyroid disease. Moreover, both 21-OHD and Graves' disease (GD) can lead to high level of testosterone, thus we should keep in mind to test chromosome and thyroid function in 21-OHD patients to avoid misdiagnose or missed diagnosis. To the best of our knowledge, this is the first report of simple virilizing (SV) 21-OHD patient combined with 47, XXX and Graves disease. PATIENT CONCERNS: A 24-years-old female of Han ethnicity was admitted to the endocrinology department complaining of absence of menses for half a year. The patient didn't noticed her enlarged clitoris until she was 17 years old. Her menarche was 16 years old and the final height was 163 centimeter. She was diagnosed with GD 2 months before admission to our hospital due to palpitation, heat intolerance, muscle weakness. DIAGNOSES: The patient was diagnosed with SV 21-OHD, Graves disease and 47, XXX. INTERVENTIONS: At first, the patient was given 10 mg methimazole twice a day as well as 5 mg predisone in the morning and 2.5 mg in the evening. After a year of regular medication and reexamination, she got a regular menstruation and thyroid function and now is taking 2.5 mg prednisone twice a day. OUTCOMES: The patient got a regular menstruation and thyroid function. Laboratory results showed: testosterone declined to 0.1nmol/L (0.1-1.67nmol/L) and 17 hydroxyprogesterone get back to normal level: 1.01ng/ml (0.30-2.34ng/mL). However, her enlarged clitoris has not narrowed. LESSONS: Patients with abnormal chromosome are likely to combine 21-OHD, thus karyotyping test should not be neglected for those who have been already diagnosed as 21-OHD. Additionally, chromosomal abnormality such as 47, XXX and Turner syndrome had susceptibility to develop autoimmune thyroid disease because a gene on X chromosome may be responsible for the occurrence of autoimmune thyroid disease. Moreover, both 21-OHD and GD can lead to high level of testosterone, thus we should keep in mind to test chromosome and thyroid function in 21-OHD patients to avoid misdiagnose or missed diagnosis. To the best of our knowledge, this is the first report of SV 21-OHD patient combined with 47, XXX and Graves disease.

Association Between Serum Asprosin and Diabetic Nephropathy in Patients with Type 2 Diabetes Mellitus in the Community: A Cross-Sectional Study.

Objective: To explore the association between serum asprosin and diabetic nephropathy (DN) in patients with type 2 diabetes mellitus (T2DM) in the community. Methods: In this cross-sectional study, we retrospectively collected the clinical data of T2DM patients from a community health service center in southeastern Shanxi Province between November 2019 and July 2021. Logistic regression analysis was used to calculate the odds ratio (OR) and the 95% confidence interval (95% CI) of asprosin levels on the risk of DN. Results: Among 498 T2DM patients included in this study, 221 had microalbuminuria, 105 had massive albuminuria, and 172 did not have any signs of nephropathy. Serum asprosin level was positively correlated with diastolic blood pressure, body mass index, triglycerides, aspartate aminotransferase, alanine aminotransferase, creatinine, ACR and albumin-to-creatinine ratio (all P < 0.05) and negatively correlated with low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, fasting plasma glucose, HbA1c and estimated glomerular filtration rate (all P < 0.05). After adjusting for covariates, increased asprosin was associated with diabetic nephropathy (all OR = 2.560, 95% CI: 1.1592-4.116; P < 0.001). Conclusion: The risk of DN significantly increases with serum asprosin levels, especially among female patients.

To Assess Liraglutide's Therapeutic Effect in Patients with Type 2 Diabetes Mellitus Using Flash Glucose Monitoring System.

PURPOSE: Liraglutide, a type of glucagon-like peptide-1 receptor agonist, has significant anti-hyperglycaemic activity without increasing the incidence of hypoglycaemia. In addition, it can improve ß-cell function and insulin resistance. The flash glucose monitoring system (FGMS) is a novel method to document consecutive and detailed interstitial glucose levels, further reflecting blood glucose levels. This study aimed to investigate the therapeutic effect of liraglutide on blood glucose management (glucose variability, hyperglycaemia, and the incidence of hypoglycaemia), ß-cell function, and insulin resistance in patients with diabetes. PATIENTS AND METHODS: Thirty-three patients with type 2 diabetes mellitus were recruited in this study. On the basis of metformin monotherapy, these patients received liraglutide add-on treatment for 3 months. The FGMS was used to document glucose levels before and after add-on treatment. Parameters of glucose variability, blood glucose levels at specific time periods, and the incidence of hypoglycaemia were assessed according to FGMS data and compared before and after liraglutide add-on treatment. Further, ß-cell function and insulin resistance were assessed and compared before and after liraglutide add-on treatment. RESULTS: According to FGMS monitoring data, liraglutide add-on treatment significantly improved general, within-day, and day-to-day glucose variability and the glucose-target-rate. Further, the specifically analysed blood glucose levels at different time periods showed that blood glucose levels significantly decreased at nocturnal, fasting, and postprandial periods after add-on treatment. The incidence of hypoglycaemia was comparable during the whole day, daytime, and night-time according to the prespecified cutoffs (3.9 mmol/L and 3.0 mmol/L) before and after add-on treatment. Analysis of other assessed parameters revealed significant differences in glycosylated hemoglobin A1c and fasting blood glucose levels as well as parameters of ß-cell function and insulin resistance before and after add-on treatment. CONCLUSION: In type 2 diabetes mellitus, liraglutide treatment can effectively decrease glucose variability and ameliorate hyperglycaemia without increasing the incidence of hypoglycaemia. In addition, liraglutide can significantly improve the ß-cell function and insulin resistance.

LncRNA NEAT1 inhibition upregulates miR-16-5p to restrain the progression of sepsis-induced lung injury via suppressing BRD4 in a mouse model.

OBJECTIVE: Long non-coding RNAs (lncRNAs) are known to sponge microRNAs (miRNAs) to regulate biological processes. However, the role of nuclear paraspeckle assembly transcript 1 (NEAT1) binding miR-16-5p in sepsis-induced lung injury remains largely unknown. We aim to explore the effect of NEAT1 sponging miR-16-5p on sepsis-induced lung injury via regulating bromodomain containing 4 (BRD4). METHODS: A mouse model of sepsis-induced lung injury was established. Expression of NEAT1, miR-16-5p and BRD4 was determined. The pulmonary edema, myeloperoxidase (MPO) activity, pathological changes, levels of inflammatory factors, cell viability and apoptosis in mouse lung tissues were evaluated. The binding relationships between NEAT1 and miR-16-5p, and between miR-16-5p and BRD4 were confirmed. RESULTS: NEAT1 and BRD4 were upregulated while miR-16-5p was downregulated in sepsis-induced lung injury. NEAT1 inhibition or miR-16-5p elevation suppressed pulmonary edema, MPO activity, pathological changes, inflammation and apoptosis, and promoted cell viability in mouse lung tissues. NEAT1 bound with miR-16-5p and miR-16-5p targeted BRD4. CONCLUSION: NEAT1 inhibition upregulates miR-16-5p to repress the progression of sepsis-induced lung injury via downregulating BRD4.

Flash glucose monitoring system was applied to cortisol treatment for a patient with congenital adrenal hyperplasia and 17α-hydroxylase deficiency.

BACKGROUND: Congenital adrenal hyperplasia (CAH) with 17α-hydroxylase deficiency is a rare disease; patients often require lifetime cortisol treatment. In this case report, we presented a patient with CAH and 17α-hydroxylase deficiency, who was previously misdiagnosed as having primary aldosteronism. Furthermore, the flash glucose monitoring system (FGMS) was used to ascertain a suitable cortisol therapeutic regimen for this patient. CASE PRESENTATION: A 29-year-old woman presented with sex dysgenesis, hypertension and hypokalaemia. She had been diagnosed with primary aldosteronism at a local hospital. The re-measured aldosterone level in our hospital was below the normal range after antihypertensive medication adjustment, suggesting that the primary aldosteronism was a misdiagnosis. The patient was finally diagnosed as having CAH with 17α-hydroxylase deficiency according to the endocrine profile, adrenocorticotropic hormone stimulation test, and genetic analysis. Then, the patient was recommended cortisol treatment, during which the endocrine profile, blood pressure, plasma potassium level, and blood glucose level were observed to ascertain a suitable dosage. The FGMS was used to monitor blood glucose level, which indicated that the patient's glucose metabolism was maintained normally under the final treatment dosage. CONCLUSION: The misdiagnosis might have been because of the effects of the antihypertension medications on aldosterone and renin levels. The final dosage of cortisol treatment achieved a normal endocrine profile, while maintaining the homeostasis of blood glucose level, plasma potassium level and blood pressure. FGMS may be an effective method to ascertain a suitable cortisol therapeutic regimen for patients with CAH and 17α-hydroxylase deficiency.

Positron emission computed tomography/single photon emission computed tomography in Parkinson disease.

Parkinson disease (PD) is the second-most common neurodegenerative disorder. Its main pathological mechanism is the selective degeneration and deletion of dopaminergic neurons in the dense part of the substantia nigra and the damage of dopaminergic neurons caused by the abnormal deposition of a Lewy body, leading to a decreased dopamine level. Positron emission computed tomography (PET)/single photon emission computed tomography (SPECT) is a molecular imaging technology that can directly or indirectly reflect changes in molecular levels by using a specific tracer. With the research and development on the tracers of related enzymes for labeling dopamine transporter and dopamine receptor and for being involved in dopamine formation, this imaging technology has been applied to all aspects of PD research. It not only contributes to clinical work but also provides an important theoretical basis for exploring the pathological mechanism of PD at a molecular level. Therefore, this review discusses the application value of PET/SPECT in PD in terms of early diagnosis, disease severity evaluation, clinical manifestations, differential diagnosis, and pathological mechanism.

Association between serum uric acid and nonalcoholic fatty liver disease in community patients with type 2 diabetes mellitus.

BACKGROUND: To investigate whether SUA is associated with NAFLD in men and women with T2DM. METHODS: This cross-sectional study enrolled patients with T2DM at Shanxi High-Tech Development Zone Central Hospital (June 2011 to September 2017). Patients were stratified according to gender and presence/absence of NAFLD. Parameters associated with NAFLD were identified using multivariate stepwise linear regression and univariate/multivariate logistic regression. RESULTS: Among 597 patients (325 males) enrolled, 352 had NAFLD. SUA was higher in the NAFLD group than in the non-NAFLD group for both men and women (P < 0.001). Multiple linear regression showed that body mass index (positively), triglycerides (positively) and estimated glomerular filtration rate (negatively) were independently related to SUA (P < 0.001). Univariate logistic regression revealed increased odds of NAFLD for SUA tertiles 2 (P = 0.022) and 3 (P = 0.001) in women and tertile 3 (P = 0.039) in men. After adjustment for multiple clinical parameters, SUA tertiles were significantly associated with NAFLD for tertile 3 in women (P = 0.014), although there were trends toward associations for tertile 2 in women (P = 0.074) and tertiles 2 and 3 in men (P = 0.085 and 0.054, respectively). CONCLUSION: SUA is not independently associated with NAFLD in men or women with T2DM after rigorous adjustment for other metabolic parameters.

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.

RATIONALE: Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation. PATIENT CONCERNS: A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia. DIAGNOSES: She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome. INTERVENTIONS: The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing. OUTCOMES: A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability. LESSONS: Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.

Analysis of endocrine hormone metabolism level in a Chinese patient with mucopolysaccharidosis IVA: A case report.

RATIONALE: Mucopolysaccharidosis IVA (Morquio A) is a catabolic mucopolysaccharide disorder caused by galactose-6-sulfate sulfatase deficiency. It is an autosomal recessive inherited disease. Previous reports on clinical characteristics of Morquio A mainly focused on growth retardation, skeletal deformities, and organ damage in children and adolescents, while the effects of mucopolysaccharide metabolism disorders on endocrine hormone metabolism level have not been reported. Herein, we reported the endocrine hormone metabolism in a case diagnosed as Morquio A. PATIENT CONCERNS: The patient was a 17-year-old girl with growth retardation, hearing loss, and severe skeletal dysplasia(scoliosis and chicken breast), and was evaluated to have normal nervous system function and intelligence by physicians. DIAGNOSES: She was diagnosed as Morquio A based on gene analysis, mucopolysaccharide-related enzymes and her clinical features. INTERVENTIONS: The patient didn't accepted the enzyme replacement therapy. OUTCOMES: She had a homozygous mutation of the GALNS gene. The b-glucuronidase content in the blood was reduced. The serum sodium, serum adrenocorticotropic hormone, and cortisol rhythms (8 AM) were decreased. The levels of PRA(plasma renin activity) , PAII(plasma angiotensin II), and PALD(plasma aldosterone) were elevated. Bone mineral density suggests osteoporosis. There were no abnormalities in bone metabolism indicators, growth hormone, thyroid hormone, and sex hormones. In summary, the level of endocrine hormones in patients with mucopolysaccharidosis IV changes. LESSONS: This is the report on endocrine hormone level in a patient with mucopolysaccharidosis IV in China. Due to the disease may have relatively incomplete adrenal function, which provides a basis for future understanding and diagnosis of this disease.