Novel dominant-negative FOXJ1 mutation in a family with heterotaxy plus mouse model.

Background: Primary ciliary dyskinesia (PCD) is a clinically heterogeneous group of autosomal or, less frequently, X-chromosomal recessive inheritance syndrome of motile cilia dysfunction characterized by neonatal respiratory distress, oto-sino-pulmonary disease, infertility and situs inversus. Recently, type 43 PCD (CILD43, OMIM#618699) was established by autosomal-dominant loss-of-function mutations identified in Forkhead box J1 (FOXJ1). However, the functional validation of FOXJ1 mutations in humans and mice has not been fully performed. Here we studied a three-generation family with heterotaxy and proband with complex congenital heart disease (CHD). Methods: We performed whole-exome sequencing to investigate the causative variant of this family and generated gene knock-in mice carrying the human equivalent mutation by homologous recombination. Then, microscopy analysis was used to characterize the phenotype and ciliary ultrastructure of the model. Effects of the variant on heart anomaly were preliminarily explored through transcriptome sequencing. Results: A novel heterozygous deletion variant (c.1129delC/p.Leu377Trpfs*76) of FOXJ1 was discovered that exerts a dominant-negative effect (DNE) in vitro. Notably, both homozygous (Foxj1c.1129delT/c.1129delT) and heterozygous (Foxj1+/c.1129delT) mice developed situs inversus, hydrocephalus and showed a disruption of trachea cilia structure, whereas these abnormalities were only observed in previously reported Foxj1-/-, not Foxj1+/- mice. Thus, a more severe phenotype and higher expressivity of our mouse model further indicated the DNE of this mutation. Meanwhile, several cardiomyopathy-related genes were differentially expressed in the homozygous Foxj1 knock-in mouse hearts, pointing to a probable function in cardiac pathology. Conclusions: Overall, our study results showed that c.1129delC mutation in FOXJ1 was regarded as the cause of situs inversus in this family and this mutant showed a capacity of DNE over wild-type FOXJ1, causing more serious consequences than the allelic deletion of Foxj1.

Simultaneous quantification and pharmacokinetics of vincristine and its major metabolite M1 in Chinese pediatric ALL patients by LC-MS/MS.

Vincristine (VCR) is a vital component in numerous treatment regimens for pediatric blood cancer. VCR-induced peripheral neuropathy (VIPN) represents a type of VCR toxicity influenced by multiple factors, including age, race, genetic traits, dosage, interactions, and administration regimen. However, the dose-response relationship of VIPN remains elusive. VCR is primarily metabolized by cytochrome P450 (CYP) 3 A to generate the major metabolite M1. To date, there is a lack of literature documenting the pharmacokinetics (PK) characteristics of VCR and M1 in Chinese children within a 96 h timeframe. To address the gap, a developed LC-MS/MS method was successfully employed in the PK study of VCR and M1 in Chinese pediatric acute lymphoblastic leukemia (ALL) patients. M1 was obtained through in vitro metabolism experiments, and mixed plasma samples of M1 and VCR were prepared. Plasma samples were pre-processed using the solid-phase extraction (SPE) technique. Samples were loaded into ProElut C18 Cartridges, washed with 5% methanol aqueous solution, and eluted with methanol. The eluent was concentrated and reconstituted for liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis. The standard calibration curves for VCR and M1 were 0.1-50 ng/mL and 0.05-5 ng/mL, respectively, with linear coefficients exceeding 0.99. Accuracy and precision of quality control (QC) samples fell within 115%. The analytical approach satisfied the quantitative demands for VCR and M1 in plasma samples within 96 h. VCR was metabolized to M1 at a relatively constant proportion (5.37%-18.06%) of VCR in vivo. No significant differences were observed in PK parameters of VCR in Chinese children compared to other countries and races. Further investigation is required to identify the key factors influencing VIPN in Chinese children.

Molecular Spectrum, Ethnic and Geographical Distribution of Thalassemia in the Southern Area of Hainan, China.

Background: Thalassemia is one of the most common genetic diseases in southern China. Accurate population frequency data regarding the occurrence and distribution of thalassemia are important for designing appropriate prevention strategies for thalassemia. This study aims to reveal the molecular spectrum, ethnic and geographical distribution of thalassemia in the southern area of Hainan Province, China. Methods: A total of 9813 suspected carriers of thalassemia were screened for genetic analysis by using the PCR-reverse dot blot hybridization method targeting three known deletions of α-thalassemias (--SEA, -α3.7, and -α4.2), three nondeletional mutations of α-thalassaemias (αCS, αQS, and αWS) and the 17 most common mutations of ß-thalassaemias in the Chinese population. Results: Approximately 6,924 subjects were genetically diagnosed as thalassemia carriers or patients, including 5812 cases of α-thalassemia (83.9%), 369 cases of ß-thalassemia (5.3%), and 743 cases of α-composite ß-thalassemia (10.7%). A total of 21 distinct genotypes were identified among the 5,812 α-thalassemia carriers, -α4.2/αα, -α3.7/αα, and -α3.7/-α4.2 were the most common α-thalassemia genotypes. The most frequent ß-thalassemia genotype was ßCD41-42/ßN, with a notable proportion of 69.6%, followed by the ß-28M /ßN, ßIVS-II-654/ßN, ßCD71-72/ßN, ßE/ßN, and ßCD17/ßN genotypes. In addition, 37 genotypes were detected among the 743 cases of both α- and ß-thalassemia mutations. The α-thalassemia genotypes were most commonly found in the Li people, who accounted for 73.5% of α-thalassemia carriers. The ß-thalassemia genotypes were most commonly identified in the Han people, who accounted for 59.4% of ß-thalassemia carriers. Among the subjects carrying both α- and ß-thalassemia variations, only three ethnic minorities were identified, including the Li, Han, and Miao people, accounting for 82.0, 17.4, and 0.7%, respectively. Conclusions: Our study indicates that there is high genetic heterogeneity, geographical and ethnic differences in thalassemia in populations in the southern area of Hainan Province. These findings will be helpful in guiding genetic counseling and prenatal diagnosis of thalassemia in Hainan Province.

Copy number variation analysis in Chinese children with complete atrioventricular canal and single ventricle.

BACKGROUND: Congenital heart disease (CHD) is one of the most common birth defects. Copy number variations (CNVs) have been proved to be important genetic factors that contribute to CHD. Here we screened genome-wide CNVs in Chinese children with complete atrioventricular canal (CAVC) and single ventricle (SV), since there were scarce researches dedicated to these two types of CHD. METHODS: We screened CNVs in 262 sporadic CAVC cases and 259 sporadic SV cases respectively, using a customized SNP array. The detected CNVs were annotated and filtered using available databases. RESULTS: Among 262 CAVC patients, we identified 6 potentially-causative CNVs in 43 individuals (16.41%, 43/262), including 2 syndrome-related CNVs (7q11.23 and 8q24.3 deletion). Surprisingly, 90.70% CAVC patients with detected CNVs (39/43) were found to carry duplications of 21q11.2-21q22.3, which were recognized as trisomy 21 (Down syndrome, DS). In CAVC with DS patients, the female to male ratio was 1.6:1.0 (24:15), and the rate of pulmonary hypertension (PH) was 41.03% (16/39). Additionally, 6 potentially-causative CNVs were identified in the SV patients (2.32%, 6/259), and none of them was trisomy 21. Most CNVs identified in our cohort were classified as rare (< 1%), occurring just once among CAVC or SV individuals except the 21q11.2-21q22.3 duplication (14.89%) in CAVC cohort. CONCLUSIONS: Our study identified 12 potentially-causative CNVs in 262 CAVC and 259 SV patients, representing the largest cohort of these two CHD types in Chinese population. The results provided strong correlation between CAVC and DS, which also showed sex difference and high incidence of PH. The presence of potentially-causative CNVs suggests the etiology of complex CHD is incredibly diverse, and CHD candidate genes remain to be discovered.

Generation of a homozygous CRISPR/Cas9-mediated knockout human iPSC line for PTCH1 gene.

PTCH1 is the receptor protein of Hedgehog signaling pathway, and Hedgehog pathway plays a vital role in mammalian embryonic development. However, the specific biological role of PTCH1 is incompletely understood for embryonic development. Here, we used a CRISPR/Cas9 genome editing approach to generate a homozygous PTCH1 knock-out iPSC line (SCMCi001-A-1) from a healthy donor, which will be a valuable in vitro model to study the pathogenic mechanism of PTCH1 dysfunction in congenital disease.

Identification of the genetic basis of sporadic polydactyly in China by targeted sequencing.

PURPOSE: Polydactyly is a highly heterogeneous group of skeletal deformities in clinical and genetic background. The variation spectrum in Chinese sporadic polydactyly has not been comprehensively analyzed. To elucidate genetic variation spectrum and genotype-phenotype correlations in Chinese patients with polydactyly, we conducted comprehensive genetic analysis of patients nationwide using targeted sequencing. METHODS: A total of 181 patients diagnosed with polydactylies were recruited. We designed a targeted capture panel for sequencing 721 genes that are associated with the pathogenesis of skeletal dysplasia. We performed rigorous variant- and gene-level filtrations to identify potentially damaging variants, followed by enrichment analysis and gene prioritization. RESULTS: A total of 568 deleterious variants of 293 genes were identified in 173 of 181 patients with a positive rate of 95.6% by targeted sequencing. For each sample, an average of 3.17 deleterious variants were identified. Especially, 14 pathogenic or likely pathogenic variants were identified in 10 genes in 14 patients out of the 181 patients, providing a positive molecular diagnostic rate of 7.7%. CONCLUSION: Targeted sequencing analysis provides a high efficiency approach for the genetic diagnosis of polydactyly. This is the largest next generation sequencing study performed to date in patients with polydactyly and represents the genetic basis of polydactyly typically encountered in genetics clinics.

SORBS2 is a genetic factor contributing to cardiac malformation of 4q deletion syndrome patients.

Chromosome 4q deletion is one of the most frequently detected genomic imbalance events in congenital heart disease (CHD) patients. However, a portion of CHD-associated 4q deletions without known CHD genes suggests unknown CHD genes within these intervals. Here, we have shown that knockdown of SORBS2, a 4q interval gene, disrupted sarcomeric integrity of cardiomyocytes and caused reduced cardiomyocyte number in human embryonic stem cell differentiation model. Molecular analyses revealed decreased expression of second heart field (SHF) marker genes and impaired NOTCH and SHH signaling in SORBS2-knockdown cells. Exogenous SHH rescued SORBS2 knockdown-induced cardiomyocyte differentiation defects. Sorbs2-/- mouse mutants had atrial septal hypoplasia/aplasia or double atrial septum (DAS) derived from impaired posterior SHF with a similar expression alteration. Rare SORBS2 variants were significantly enriched in a cohort of 300 CHD patients. Our findings indicate that SORBS2 is a regulator of SHF development and its variants contribute to CHD pathogenesis. The presence of DAS in Sorbs2-/- hearts reveals the first molecular etiology of this rare anomaly linked to paradoxical thromboembolism.

Nonframeshifting indel variations in polyalanine repeat of HOXD13 gene underlies hereditary limb malformation for two Chinese families.

BACKGROUND: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention. METHODS: The present study aimed to identify the genetic etiologies of a three-generation family with postaxial polydactyly and a four-generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. RESULTS: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly-Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly-Ala position is highly conserved. Hypothetical three-dimensional (3-D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short ß-strand (residues 63-68 or residues 64-68), thereby forming a conformational change. CONCLUSIONS: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management.

Identification of miRNA-mRNA-TFs Regulatory Network and Crucial Pathways Involved in Tetralogy of Fallot.

Tetralogy of Fallot (TOF) is the most common cyanotic congenital heart disease. However, its pathogenesis remains unknown. To explore key regulatory connections and crucial pathways underlying the TOF, gene or microRNA expression profile datasets of human TOF were obtained from the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database. The differentially expressed mRNAs (DEmRNAs) and microRNAs (DEmiRs) between TOF and healthy groups were identified after data preprocessing, followed by Gene Ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. Then, we further constructed protein-protein interaction (PPI) network and subnetwork of modules. Ultimately, to investigate the regulatory network underlying TOF, a global triple network including miRNAs, mRNAs, and transcription factors (TFs) was constructed based on the integrated data. In the present study, a total of 529 DEmRNAs, including 115 downregulated and 414 upregulated DEmRNAs, and 7 significantly upregulated DemiRs, including miR-499, miR-23b, miR-222, miR-1275, miR-93, miR-155, and miR-187, were found between TOF and control groups. Furthermore, 22 hub genes ranked by top 5% genes with high connectivity and six TFs, including SRF, CNOT4, SIX6, SRRM3, NELFA, and ONECUT3, were identified and might play crucial roles in the molecular pathogenesis of TOF. Additionally, an miRNA-mRNA-TF co-regulatory network was established and indicated ubiquitin-mediated proteolysis, energy metabolism associated pathways, neurodevelopmental disorder associated pathways, and ribosomes might be involved in the pathogenesis of TOF. The current research provides a comprehensive perspective of regulatory mechanism networks underlying TOF and also identifies potential molecule targets of genetic counseling and prenatal diagnosis for TOF.

In vitro residual activities in 20 variants of phenylalanine hydroxylase and genotype-phenotype correlation in phenylketonuria patients.

Phenylketonuria (PKU), caused by phenylalanine hydroxylase (PAH) gene variants, is a common autosomal inherited metabolic disease. So far, 1111 PAH variants have been revealed. The residual activity of the PAH variants is the key determinant of the metabolic phenotype and BH4 responsiveness in PKU patients. In this study, the spectrum of PAH variants in 1083 Chinese PKU patients was analyzed. Then 20 variants (p.L52F, p.R86P, p.L128P, p.L142P, p.D163N, p.C203G, p.E214G, p.F260L, p.M276T, p.L311R, p.P314A, p.L364F, p.Q375H, p.F382I, p.A395S, p.V412D, p.E108*, p.C203*, p.C284* and p.E353*) were expressed in COS-7 cells. The residual activities and protein expression levels were detected by isotope-dilution liquid chromatography-electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) and Western blotting, respectively. We compared the results of the phenotypic prediction based on APV and PAH activity respectively, and further explored the relationship between residual activity and phenotype in PKU patients. We reported 9 newly discovered PAH variants for the first time, thereby expanding the spectrum of PAH variants. Among the 20 variants in our assay, 8 variants showed mild impaired residual activities (48-92%) and approximately normal protein expression levels compared to the wild-type PAH. In contrast, 9 variants showed severely impaired residual activities (0-34%) and reduced protein expression. However, three variants (p.L52F, p.F260L and p.P314A) showed impaired residual activities (5%, 32% and 29%), although the proteins were well expressed. We assigned APV scores for 14 variants, in which the results of the phenotypic prediction were consistent for 12/14 (86%) variants based on APV and residual activity respectively, and the residual activity correctly predicted 17/22 (77%) of the patients. Our study helped to further understand the genotype-phenotype correlation in PKU patients.

Identification of a novel ANO5 missense mutation in a Chinese family with familial florid osseous dysplasia.

Familial florid osseous dysplasia (FFOD) is an autosomal dominant disorder of connective tissue, characterized by lobulated cementum-like masses scattered throughout the jaws and the alveolar process. This study aimed to identify the genetic etiology of a three-generation Chinese family affected with FFOD. A novel missense mutation p.C356W in anoctamin 5 (ANO5) gene was successfully identified as the pathogenic mutation by whole-exome sequencing (WES). The p.C356W mutation is located in the first loop between the first and second transmembrane domain of ANO5 protein. Sequence alignment of ANO5 protein among many different species revealed that this position is highly conserved. The p.C356W mutation may damage the predicted protein stability of ANO5 by altering the structure of several extracellular loops of ANO5 and affecting the formation of the disulfide bond, thereby disrupting the correct folding of ANO5 protein. Thus, the amino acid at position 356 appears to play a key role in the protein structural stability and function of ANO5 protein. Our results may also provide new insights into the cause and diagnosis of FFOD and may have implications for genetic counseling and clinical management.

MET mutation causes muscular dysplasia and arthrogryposis.

Arthrogryposis is a group of phenotypically and genetically heterogeneous disorders characterized by congenital contractures of two or more parts of the body; the pathogenesis and the causative genes of arthrogryposis remain undetermined. We examined a four-generation arthrogryposis pedigree characterized by camptodactyly, limited forearm supination, and loss of myofibers in the forearms and hands. By using whole-exome sequencing, we confirmed MET p.Y1234C mutation to be responsible for arthrogryposis in this pedigree. MET p.Y1234C mutation caused the failure of activation of MET tyrosine kinase. A Met p.Y1232C mutant mouse model was established. The phenotypes of homozygous mice included embryonic lethality and complete loss of muscles that originated from migratory precursors. Heterozygous mice were born alive and showed reduction of the number of myofibers in both appendicular and axial muscles. Defective migration of muscle progenitor cells and impaired proliferation of secondary myoblasts were proven to be responsible for the skeletal muscle dysplasia of mutant mice. Overall, our study shows MET to be a causative gene of arthrogryposis and MET mutation could cause skeletal muscle dysplasia in human beings.

Accurate diagnosis of spinal muscular atrophy and 22q11.2 deletion syndrome using limited deoxynucleotide triphosphates and high-resolution melting.

BACKGROUND: Copy number variation (CNV) has been implicated in the genetics of multiple human diseases. Spinal muscular atrophy (SMA) and 22q11.2 deletion syndrome (22q11.2DS) are two of the most common diseases which are caused by DNA copy number variations. Genetic diagnostics for these conditions would be enhanced by more accurate and efficient methods to detect the relevant CNVs. METHODS: Competitive PCR with limited deoxynucleotide triphosphates (dNTPs) and high-resolution melting (HRM) analysis was used to detect 22q11.2DS, SMA and SMA carrier status. For SMA, we focused on the copy number of SMN1 gene. For 22q11.2DS, we analyzed CNV for 3 genes (CLTCL1, KLHL22, and PI4KA) which are located between different region-specific low copy repeats. CFTR was used as internal reference gene for all targets. Short PCR products with separated Tms were designed by uMelt software. RESULTS: One hundred three clinical patient samples were pretested for possible SMN1 CNV, including carrier status, using multiplex ligation-dependent probe amplification (MLPA) commercial kit as gold standard. Ninety-nine samples consisting of 56 wild-type and 43 22q11.2DS samples were analyzed for CLTCL1, KLHL22, and PI4KA CNV also using MLPA. These samples were blinded and re-analyzed for the same CNVs using the limited dNTPs PCR with HRM analysis and the results were completely consistent with MLPA. CONCLUSIONS: Limited dNTPs PCR with HRM analysis is an accurate method for detecting SMN1 and 22q11.2 CNVs. This method can be used quickly, reliably, and economically in large population screening for these diseases.

A novel dNTP-limited PCR and HRM assay to detect Williams-Beuren syndrome.

BACKGROUND: Williams-Beuren syndrome (WBS) is caused by a microdeletion of chromosome arm 7q11.23. A rapid and inexpensive genotyping method to detect microdeletion on 7q11.23 needs to be developed for the diagnosis of WBS. This study describes the development of a new type of molecular diagnosis method to detect microdeletion on 7q11.23 based upon high-resolution melting (HRM). METHODS: Four genes on 7q11.23 were selected as the target genes for the deletion genotyping. dNTP-limited duplex PCR was used to amplify the reference gene, CFTR, and one of the four genes respectively on 7q11.23. An HRM assay was performed on the PCR products, and the height ratio of the negative derivative peaks between the target gene and reference gene was employed to analyze the copy number variation of the target region. RESULTS: A new genotyping method for detecting 7q11.23 deletion was developed based upon dNTP-limited PCR and HRM, which cost only 96 min. Samples from 15 WBS patients and 12 healthy individuals were genotyped by this method in a blinded fashion, and the sensitivity and specificity was 100% (95% CI, 0.80-1, and 95% CI, 0.75-1, respectively) which was proved by CytoScan HD array. SIGNIFICANCE: The HRM assay we developed is an rapid, inexpensive, and highly accurate method for genotyping 7q11.23 deletion. It is potentially useful in the clinical diagnosis of WBS.

A Novel Multiplex HRM Assay to Detect Clopidogrel Resistance.

Clopidogrel is an antiplatelet medicine used to prevent blood clots in patients who have had a heart attack, stroke, or other symptoms. Variability in the clinical response to clopidogrel treatment has been attributed to genetic factors. In particular, five SNPs of rs4244285, rs4986893, rs12248560, rs662 and rs1045642 have been associated with resistance to clopidogrel therapy in Chinese population. This work involves the development of a multiplex high-resolution melting (HRM) assay to genotype all five of these loci in 2 tubes. Amplicons corresponding to distinct SNPs in a common tube were designed with the aid of uMelt prediction software to have different melting temperatures Tm by addition of a GC-rich tail to the 5' end of the certain primers. Two kinds of commercial methods, Digital Fluorescence Molecular Hybridization (DFMH) and Sanger sequencing, were used as a control. Three hundred sixteen DFMH pretested samples from consecutive acute coronary syndrome patients were used for a blinded study of multiplex HRM. The sensitivity of HRM was 100% and the specificity was 99.93% reflecting detection of variants other than the known resistance SNPs. Multiplex HRM is an effective closed-tube, highly accurate, fast, and inexpensive method for genotyping the 5 clopidogrel resistance associated SNPs.

Human fetal heart specific coexpression network involves congenital heart disease/defect candidate genes.

Heart development is a complex process requiring dynamic transcriptional regulation. Disturbance of this process will lead to severe developmental defects such as congenital heart disease/defect (CHD). CHD is a group of complex disorder with high genetic heterogeneity, common pathways associated with CHD remains largely unknown. In the manuscript, we focused on the tissue specific genes in human fetal heart samples to explore such pathways. We used the RNA microarray dataset of human fetal tissues from ENCODE project to identify genes with heart tissue specific expression. A transcriptional network was constructed for these genes based on the Pearson correlation coefficients of their expression levels. Function, selective constraints and disease associations of these genes were then examined. Our analysis identified a network consisted of 316 genes with human fetal heart specific expression. The network was highly co-regulated and showed evolutionary conserved tissue expression pattern in tetrapod. Genes in this network are enriched in CHD specific genes and disease mutations. Using the transcriptomic data, we discovered a highly concerted gene network that might reflect a common pathway associated with the etiology of CHD. Such analysis should be helpful for disease associated gene identification in clinical studies.

Exome Sequencing Identified a Novel FBN2 Mutation in a Chinese Family with Congenital Contractural Arachnodactyly.

Congenital contractural arachnodactyly (CCA) is an autosomal dominant disorder of connective tissue. CCA is characterized by arachnodactyly, camptodactyly, contrature of major joints, scoliosis, pectus deformities, and crumpled ears. The present study aimed to identify the genetic cause of a three-generation Chinese family with CCA. We successfully identified a novel missense mutation p.G1145D in the fibrillin-2 (FBN2) gene as the pathogenic mutation by whole exome sequencing (WES). The p.G1145D mutation occurs in the 12th calcium-binding epidermal growth factor-like (cbEGF) domain. The p.G1145D mutation caused a hydrophobic to hydrophilic substitution, altering the amino acid property from neutral to acidic. Three-dimensional structural analysis showed that this mutation could alter the conformation of the residue side chain, thereby producing steric clashes with spatially adjacent residues, disrupting the formation of H bonds and causing folding destabilization. Therefore, this amino acid appears to play an important role in the structure and function of FBN2. Our results may also provide new insights into the cause and diagnosis of CCA and may have implications for genetic counseling and clinical management.

Association between ABO Blood Group and Risk of Congenital Heart Disease: A 6-year large cohort study.

ABO blood group, except its direct clinical implications for transfusion and organ transplantation, is generally accepted as an effect factor for coronary heart disease, but the associations between ABO blood group and congenital heart disease (CHD) are not coherent by previous reports. In this study, we evaluated the the potential relationship between ABO blood group and CHD risk. In 39,042 consecutive inpatients (19,795 CHD VS 19,247 controls), we used multivariable logistic regression to evaluate the roles of ABO blood group, gender, and RH for CHD. The associations between ABO blood group and CHD subgroups, were further evaluated using stratification analysis, adjusted by gender. A blood group demonstrated decreased risk for isolated CHD (OR 0.82; 95% CI, 0.78-0.87) in individuals with A blood group in the overall cohort analysis, and the finding was consistently replicated in independent subgroup analysis. ABO blood group may have a role for CHD, and this novel finding provides ABO blood group as a possible marker for CHD, but more studies need to be done.