Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Associations of perfluoroalkyl substances with metabolic-associated fatty liver disease and non-alcoholic fatty liver disease: NHANES 2017-2018.

OBJECTIVES: This study investigated the potential effects of perfluoroalkyl substance (PFAS) in serum on MAFLD, NAFLD, and liver fibrosis. METHODS: Our sample included 696 participants (≥ 18 years) from the 2017-2018 NHANES study with available serum PFASs, covariates, and outcomes. Using the first quartile of PFAS as the reference group, we used weighted binary logistic regression and multiple ordered logistic regression used to analyze the relationship between PFAS and MAFLD, NAFLD, and liver fibrosis and multiple ordinal logistic regression to investigate the relationship between PFAS and MAFLD, NAFLD, and liver fibrosis and calculated the odds ratio (OR) and 95% confidence interval for each chemical. Finally, stratified analysis and sensitivity analysis were performed according to gender, age, BMI, and serum cotinine concentration. RESULTS: A total of 696 study subjects were included, including 212 NAFLD patients (weighted 27.03%) and 253 MAFLD patients (weighted 32.65%). The quartile 2 of serum PFOA was positively correlated with MAFLD and NAFLD (MAFLD, OR 2.29, 95% CI 1.05-4.98; NAFLD, OR 2.37, 95% CI 1.03-5.47). PFAS were not significantly associated with liver fibrosis after adjusting for potential confounders in MAFLD and NAFLD. Stratified analysis showed that PFOA was strongly associated with MAFLD, NAFLD, and liver fibrosis in males and obese subjects. In women over 60 years old, PFHxS was also correlated with MAFLD, NAFLD, and liver fibrosis. CONCLUSION: The serum PFOA was positively associated with MAFLD and NAFLD in US adults. After stratified analysis, the serum PFHxS was correlated with MFALD, NAFLD, and liver fibrosis.

In vitro studies on the effects of cryopreserved platelet-rich plasma on cells related to wound healing.

Platelet-rich plasma (PRP) holds promise as a therapeutic modality for wound healing; however, immediate utilization encounters challenges related to volume, concentration, and consistency. Cryopreservation emerges as a viable solution, preserving PRP's bioactive components and extending its shelf life. This study explores the practicality and efficacy of cryopreserved platelet-rich plasma (cPRP) in wound healing, scrutinizing both cellular mechanisms and clinical implications. Fresh PRP and cPRP post freeze-thaw underwent assessment in macrophage, fibroblast, and endothelial cell cultures. The impact of cPRP on active component release and cell behavior pertinent to wound healing was evaluated. Varied concentrations of cPRP (1%, 5%, 10%) were examined for their influence on cell polarization, migration, and proliferation. The results showed minimal changes in cPRP's IL-1ß levels, a slight decrease in PDGF-BB, and superior effects on macrophage M2 polarization and fibroblast migration, while no statistical significance was observed in endothelial cell angiogenesis and proliferation. Remarkably, 5% PRP exhibited the most significant stimulation among all cPRP concentrations, notably impacting cell proliferation, angiogenesis, and migration. The discussion underscores that cPRP maintains platelet phenotype and function over extended periods, with 5% cPRP offering the most favorable outcomes, providing a pragmatic approach for cold storage to extend post-thaw viability and amplify therapeutic effects.

What is the context? Platelet-rich plasma (PRP) is a potential bioactive material for wound healing, but using it immediately faces issues like volume, concentration, and consistency.Low-temperature freezing is a method employed to preserve PRP. However, the current understanding of the effects of the freezing-thawing process on the components of PRP and its impact on cells relevant to wound healing remains unclear.What is new? This study explores the feasibility and effectiveness of using cryopreserved PRP at −80°C for promoting wound healing. This research stands out for its focus on cellular responses and practical implications in therapeutic contexts.To understand their distinct impact on different cell types relevant to wound healing, the study meticulously examined various final concentrations of cPRP (1%, 5%, 10%).The study identified the superior effects of 5% cPRP on crucial cellular activities, notably in cell polarization, proliferation, angiogenesis, and migration.What is the impact? Low-temperature freezing can be considered an effective method for PRP preservation.Some bioactive components in cPRP exhibit subtle changes; however, these changes result in better effects on certain cell types related to healing.The study illustrates that all concentrations of cPRP effectively enhance cell proliferation, migration, and differentiation, emphasizing the comparable efficacy of cryopreserved PRP to non-cryopreserved PRP.

Temperament and past behaviour can predict behaviour success for nitrous oxide sedation.

BACKGROUND: There is currently insufficient evidence on potential predictors of a child's behaviour with nitrous oxide (N2O) sedation. AIM: To examine the association between a child's temperament and behavioural outcomes during dental treatment with N2O sedation, and the child's perception to N2O sedation. DESIGN: At the first visit (dental treatment visit), temperament was assessed using the Child Behaviour Questionnaire-Short Form and behaviour was assessed by an independent rater using the Venham Behaviour Rating Scale. At the second visit, the child's experience with N2O sedation was elicited. RESULTS: Seventy-two healthy children aged between 36 and 95 months were recruited. Planned dental treatment was completed in 84.7% of the subjects. Venham behaviour success <3 and Venham behaviour success <1 were achieved in 73.6% and 33.3%, respectively. The temperament domain of effortful control was associated with Venham behaviour score (ρ = -0.266, p = .024) and Venham behaviour success <1 (OR = 3.506, 95% CI = 1.328-9.259, p = .011). Baseline Frankl behaviour score was significantly associated with all behavioural outcomes. Venham behaviour success <3 was significantly associated with a child reporting to have enjoyed the dental treatment visit (p = .026). CONCLUSION: Effortful control and baseline behaviour were associated with behavioural outcomes of N2O sedation and can be used to predict a child's behaviour.

The landscape of transcriptional profiles in human oocytes with different chromatin configurations.

With increasingly used assisted reproductive technology (ART), the acquisition of high-quality oocytes and early embryos has become the focus of much attention. Studies in mice have found that the transition of chromatin conformation from non-surrounded nucleolus (NSN) to surrounded nucleolus (SN) is essential for oocyte maturation and early embryo development, and similar chromatin transition also exists in human oocytes. In this study, we collected human NSN and SN oocytes and investigated their transcriptome. The analysis of differentially expressed genes showed that epigenetic functions, cyclin-dependent kinases and transposable elements may play important roles in chromatin transition during human oocyte maturation. Our findings provide new insights into the molecular mechanism of NSN-to-SN transition of human oocyte and obtained new clues for improvement of oocyte in vitro maturation technique.

A novel deep learning method to segment parathyroid glands on intraoperative videos of thyroid surgery.

Introduction: The utilization of artificial intelligence (AI) augments intraoperative safety and surgical training. The recognition of parathyroid glands (PGs) is difficult for inexperienced surgeons. The aim of this study was to find out whether deep learning could be used to auxiliary identification of PGs on intraoperative videos in patients undergoing thyroid surgery. Methods: In this retrospective study, 50 patients undergoing thyroid surgery between 2021 and 2023 were randomly assigned (7:3 ratio) to a training cohort (n = 35) and a validation cohort (n = 15). The combined datasets included 98 videos with 9,944 annotated frames. An independent test cohort included 15 videos (1,500 frames) from an additional 15 patients. We developed a deep-learning model Video-Trans-U-HRNet to segment parathyroid glands in surgical videos, comparing it with three advanced medical AI methods on the internal validation cohort. Additionally, we assessed its performance against four surgeons (2 senior surgeons and 2 junior surgeons) on the independent test cohort, calculating precision and recall metrics for the model. Results: Our model demonstrated superior performance compared to other AI models on the internal validation cohort. The DICE and accuracy achieved by our model were 0.760 and 74.7% respectively, surpassing Video-TransUnet (0.710, 70.1%), Video-SwinUnet (0.754, 73.6%), and TransUnet (0.705, 69.4%). For the external test, our method got 89.5% precision 77.3% recall and 70.8% accuracy. In the statistical analysis, our model demonstrated results comparable to those of senior surgeons (senior surgeon 1: χ2 = 0.989, p = 0.320; senior surgeon 2: χ2 = 1.373, p = 0.241) and outperformed 2 junior surgeons (junior surgeon 1: χ2 = 3.889, p = 0.048; junior surgeon 2: χ2 = 4.763, p = 0.029). Discussion: We introduce an innovative intraoperative video method for identifying PGs, highlighting the potential advancements of AI in the surgical domain. The segmentation method employed for parathyroid glands in intraoperative videos offer surgeons supplementary guidance in locating real PGs. The method developed may have utility in facilitating training and decreasing the learning curve associated with the use of this technology.

Atmosphere teleconnections from abatement of China aerosol emissions exacerbate Northeast Pacific warm blob events.

During 2010 to 2020, Northeast Pacific (NEP) sea surface temperature (SST) experienced the warmest decade ever recorded, manifested in several extreme marine heatwaves, referred to as "warm blob" events, which severely affect marine ecosystems and extreme weather along the west coast of North America. While year-to-year internal climate variability has been suggested as a cause of individual events, the causes of the continuous dramatic NEP SST warming remain elusive. Here, we show that other than the greenhouse gas (GHG) forcing, rapid aerosol abatement in China over the period likely plays an important role. Anomalous tropospheric warming induced by declining aerosols in China generated atmospheric teleconnections from East Asia to the NEP, featuring an intensified and southward-shifted Aleutian Low. The associated atmospheric circulation anomaly weakens the climatological westerlies in the NEP and warms the SST there by suppressing the evaporative cooling. The aerosol-induced mean warming of the NEP SST, along with internal climate variability and the GHG-induced warming, made the warm blob events more frequent and intense during 2010 to 2020. As anthropogenic aerosol emissions continue to decrease, there is likely to be an increase in NEP warm blob events, disproportionately large beyond the direct radiative effects.

Findings from the 2019 nationally representative oral health survey for adults in Singapore.

OBJECTIVES: The aim of this study was to present key findings from the 2019 national adult oral health survey in Singapore (NAOHS). METHODS: A multi-stage stratified sampling method was used to recruit participants for a representative national adult oral health survey. A total of 12 212 households were randomly selected from the National Database on Dwellings in Singapore. Within each household eligible persons aged ≥65 years were automatically invited to participate while a Kish selection method was used to invite those between 21 and 64 years old. The survey comprised a face-to-face interview questionnaire and a clinical examination which recorded details of tooth loss, DMFT, DMFS and prevalence of periodontal disease according to the CPITN and the US CDC-AAP classifications. Weighted analysis was performed to adjust for oversampling, non-response and post-stratification. Multivariate regression with backward stepwise selection was carried out to identify predictors of chronic periodontal disease and untreated dental caries. RESULTS: Six hundred and sixty-three participants completed both the questionnaires and the clinical examination. The prevalence of edentulousness was 2.7%. Of participants, 34.8% presented with untreated dental caries with a higher proportion found in those who were aged ≥60 years, of Malay ethnicity, living in 1-2-room public housing and who only visited the dentist when there was a problem. Mean DMFS and DMFT indices were 24.7 and 7.9 respectively. Based on the CDC-AAP classification, the prevalence of moderate-severe chronic periodontitis was 56.9% and increased with age, with a higher proportion in males. Participants with untreated dental caries were more likely to have moderate or severe periodontal disease. CONCLUSIONS: Survey findings showed high prevalence of dental caries and periodontal disease, at 34.8% and 77.6% respectively. A clear socio-economic gradient in the distribution of tooth loss, untreated dental caries and moderate-to-severe periodontitis was observed.

Multicenter evaluation of the safety and efficacy of selective internal radiation therapy with yttrium-90 resin microspheres in Taiwan: data from the RESIN registry.

BACKGROUND AND AIM: The REgistry of Selective Internal radiation therapy in AsiaNs (RESIN) was a multicenter, single-arm, prospective, observational study of 90Y resin microspheres in patients with hepatocellular carcinoma (HCC) or metastatic colorectal cancer (mCRC) from Taiwan. RESIN is the first real-life clinical study of this therapy in an Asian cohort. Study objectives were to evaluate the safety and efficacy of 90Y resin microspheres. METHODS: Adults with HCC or mCRC scheduled to receive SIRT with 90Y resin microspheres were included. Primary endpoints were best overall response rate (ORR), adverse events, and changes from baseline in liver function. Secondary efficacy endpoints included overall survival (OS). RESULTS: Of 107 enrolled patients, 83 had HCC, and 24 had mCRC. ORR was 55.41% (HCC) and 33.33% (mCRC). Of 58 HCC patients with 6-month post-SIRT data, 13.79% (n = 8) had resection, transplantation, transarterial chemoembolization, or radiofrequency ablation as the result of down-staging or down-sizing of their lesions. One hundred and ten treatment emergent adverse events (TEAEs) were reported in 51 patients, and five serious adverse events (SAEs) were reported in five patients. The most frequent TEAEs were abdominal pain, nausea and decreased appetite (HCC), and abdominal pain, decreased appetite, fatigue, and vomiting (mCRC). Two deaths due to SAEs (probably related to SIRT) were reported, both in patients with extensive HCC, active hepatitis infection, and other comorbidities. Median OS was 24.07 (HCC) and 12.66 (mCRC) months. CONCLUSIONS: Safety and efficacy outcomes with the routine use of SIRT with 90Y resin microspheres in Taiwan are consistent with published data.

A chromosomal-scale genome assembly of modern cultivated hybrid sugarcane provides insights into origination and evolution.

Sugarcane is a vital crop with significant economic and industrial value. However, the cultivated sugarcane's ultra-complex genome still needs to be resolved due to its high ploidy and extensive recombination between the two subgenomes. Here, we generate a chromosomal-scale, haplotype-resolved genome assembly for a hybrid sugarcane cultivar ZZ1. This assembly contains 10.4 Gb genomic sequences and 68,509 annotated genes with defined alleles in two sub-genomes distributed in 99 original and 15 recombined chromosomes. RNA-seq data analysis shows that sugar accumulation-associated gene families have been primarily expanded from the ZZSO subgenome. However, genes responding to pokkah boeng disease susceptibility have been derived dominantly from the ZZSS subgenome. The region harboring the possible smut resistance genes has expanded significantly. Among them, the expansion of WAK and FLS2 families is proposed to have occurred during the breeding of ZZ1. Our findings provide insights into the complex genome of hybrid sugarcane cultivars and pave the way for future genomics and molecular breeding studies in sugarcane.

Multi-endpoint in vitro toxicological assessment of snus and tobacco-free nicotine pouch extracts.

'Modern' oral tobacco-free nicotine pouches (NPs) are a nicotine containing product similar in appearance and concept to Swedish snus. A three-step approach was taken to analyse the biological effects of NPs and snus extracts in vitro. ToxTracker was used to screen for biomarkers for oxidative stress, cell stress, protein damage and DNA damage. Cytotoxicity, mutagenicity, and genotoxicity were assessed in the following respective assays: Neutral Red Uptake (NRU), Ames and Mouse Lymphoma Assay (MLA). Targeted analysis of phosphorylation signalling and inflammatory markers under non-toxic conditions was used to investigate any potential signalling pathways or inflammatory response. A reference snus (CRP1.1) and four NPs with various flavours and nicotine strengths were assessed. Test article extracts was generated by incubating one pouch in 20 mL of media (specific to each assay) with the inclusion of the pouch material. NP extracts did not induce any cytotoxicity or mutagenic response, genotoxic response was minimal and limited signalling or inflammatory markers were induced. In contrast, CRP1.1 induced a positive response in four toxicological endpoints in the absence of S9: Srxn1 (oxidative stress), Btg2 (cell stress), Ddit3 (protein damage) and Rtkn (DNA damage), and three endpoints in presence of S9: Srxn1, Ddit3 and Rtkn. CRP1.1 was genotoxic when assessed in MLA and activated signalling pathways involved in proliferation and cellular stress and specifically induced phosphorylation of c-JUN, CREB1, p53, p38 MAPK and to a lesser extent AKT1S1, GSK3α/ß, ERK1/2 and RSK1 in a dose-dependent manner. CRP 1.1 extracts resulted in the release of several inflammatory mediators including cytokines IL-1α, IL5, IL6, IL8, IL-1RA, MIF and TNF-ß, receptor IL-2RA, and growth factors FGF-basic, VEGF and M-CSF. In conclusion these assays contribute to the weight of evidence assessment of the potential comparative health risks of NPs and snus.

Temporal Single-Cell Sequencing Analysis Reveals That GPNMB-Expressing Macrophages Potentiate Muscle Regeneration.

Macrophages play a crucial role in coordinating the skeletal muscle repair response, but their phenotypic diversity and the transition of specialized subsets to resolution-phase macrophages remain poorly understood. To address this issue, we induced injury and performed single-cell RNA sequencing on individual cells in skeletal muscle at different time points. Our analysis revealed a distinct macrophage subset that expressed high levels of Gpnmb and that coexpressed critical factors involved in macrophage-mediated muscle regeneration, including Igf1, Mertk, and Nr1h3. Gpnmb gene knockout inhibited macrophage-mediated efferocytosis and impaired skeletal muscle regeneration. Functional studies demonstrated that GPNMB acts directly on muscle cells in vitro and improves muscle regeneration in vivo. These findings provide a comprehensive transcriptomic atlas of macrophages during muscle injury, highlighting the key role of the GPNMB macrophage subset in regenerative processes. Targeting GPNMB signaling in macrophages could have therapeutic potential for restoring skeletal muscle integrity and homeostasis.

Isoprenoid flavonoids isolated from Sophora davidii and their activities induces apoptosis and autophagy in HT29 cells.

Four previously undescribed isoprenoid flavonoids (2-5) were isolated from Sophora davidii, along with five known analogues. The structures of the compounds were established through comprehensive analysis of spectroscopic data, including HRESIMS, 1D and 2D NMR, and absolute configurations determined by theoretical calculations, including ECD and NMR calculation. The cytotoxic effects of the isolated compounds on human HT29 colon cancer cells were evaluated using the MTT assay, compound 1 exhibited cytotoxicity against human HT29 colon cancer cells with an IC50 value of 8.39 ± 0.09 µM. Studies conducted with compound 1 in HT29 cells demonstrated that it may induce apoptosis and autophagy in HT29 by promoting the phosphorylation of P38 MAPK and inhibiting the phosphorylation of Erk MAPK.

Detoxifying bacterial genes for deoxynivalenol epimerization confer durable resistance to Fusarium head blight in wheat.

Fusarium head blight (FHB) and the presence of mycotoxin deoxynivalenol (DON) pose serious threats to wheat production and food safety worldwide. DON, as a virulence factor, is crucial for the spread of FHB pathogens on plants. However, germplasm resources that are naturally resistant to DON and DON-producing FHB pathogens are inadequate in plants. Here, detoxifying bacteria genes responsible for DON epimerization were used to enhance the resistance of wheat to mycotoxin DON and FHB pathogens. We characterized the complete pathway and molecular basis leading to the thorough detoxification of DON via epimerization through two sequential reactions in the detoxifying bacterium Devosia sp. D6-9. Epimerization efficiently eliminates the phytotoxicity of DON and neutralizes the effects of DON as a virulence factor. Notably, co-expressing of the genes encoding quinoprotein dehydrogenase (QDDH) for DON oxidation in the first reaction step, and aldo-keto reductase AKR13B2 for 3-keto-DON reduction in the second reaction step significantly reduced the accumulation of DON as virulence factor in wheat after the infection of pathogenic Fusarium, and accordingly conferred increased disease resistance to FHB by restricting the spread of pathogenic Fusarium in the transgenic plants. Stable and improved resistance was observed in greenhouse and field conditions over multiple generations. This successful approach presents a promising avenue for enhancing FHB resistance in crops and reducing mycotoxin contents in grains through detoxification of the virulence factor DON by exogenous resistance genes from microbes.

Using machine learning to identify key subject categories predicting the pre-clerkship and clerkship performance: 8-year cohort study.

BACKGROUND: Medical students need to build a solid foundation of knowledge to become physicians. Clerkship is often considered the first transition point, and clerkship performance is essential for their development. We hope to identify subjects that could predict the clerkship performance, thus helping medical students learn more efficiently to achieve high clerkship performance. METHODS: This cohort study collected background and academic data from medical students who graduated between 2011 and 2019. Prediction models were developed by machine learning techniques to identify the affecting features in predicting the pre-clerkship performance and clerkship performance. Following serial processes of data collection, data pre-processing before machine learning, and techniques and performance of machine learning, different machine learning models were trained and validated using the 10-fold cross-validation method. RESULTS: Thirteen subjects from the pre-med stage and ten subjects from the basic medical science stage with an area under the ROC curve (AUC) greater than 0.7 for either pre-clerkship performance or clerkship performance were found. In each subject category, medical humanities and sociology in social science, chemistry and physician scientist-related training in basic science, and pharmacology, immunology-microbiology, and histology in basic medical science have predictive abilities for clerkship performance above the top tertile. Using a machine learning technique based on random forest, the prediction model predicted clerkship performance with 95% accuracy and 88% AUC. CONCLUSION: Clerkship performance was predicted by selected subjects or combination of different subject categories in the pre-med and basic medical science stages. The demonstrated predictive ability of subjects or categories in the medical program may facilitate students' understanding of how these subjects or categories of the medical program relate to their performance in the clerkship to enhance their preparedness for the clerkship.

Acceptor-Reactivity-Controlled Stereoconvergent Synthesis and Immunological Activity of a Unique Pentasaccharide from the Cell Wall Polysaccharide of Cutibacterium acnes C7.

Bacterial cell-surface polysaccharides are involved in various biological processes and have attracted widespread attention as potential targets for developing carbohydrate-based drugs. However, the accessibility of structurally well-defined polysaccharide or related active oligosaccharide domains remains challenging. Herein, we describe an efficiently stereocontrolled approach for the first total synthesis of a unique pentasaccharide repeating unit containing four difficult-to-construct 1,2-cis-glycosidic linkages from the cell wall polysaccharide of Cutibacterium acnes C7. The features of our approach include: 1) acceptor-reactivity-controlled glycosylation to stereoselectively construct   two challenging rare 1,2-cis-ManA2,3(NAc)2 (ß-2,3-diacetamido-2,3-dideoxymannuronic acid) linkages, 2) combination use of 6-O-tert-butyldiphenylsilyl (6-O-TBDPS)-mediated steric shielding effect and ether solvent effect to stereoselectively install a 1,2-cis-glucosidic linkage, 3) bulky 4,6-di-O-tert-butylsilylene (DTBS)-directed glycosylation to stereospecifically construct a 1,2-cis-galactosidic linkage, 4) stereoconvergent [2+2+1] and one-pot chemoselective glycosylation to rapidly assemble the target pentasaccharide. Immunological activity tests suggest that the pentasaccharide can induce the production of proinflammatory cytokine TNF-α in a dose-dependent manner.

[Preliminary Study on the Identification of Aerobic Vaginitis by Artificial Intelligence Analysis System]. / 人工智能分析系统对需氧菌性阴道炎的判读方法初探.

Objective: To develop an artificial intelligence vaginal secretion analysis system based on deep learning and to evaluate the accuracy of automated microscopy in the clinical diagnosis of aerobic vaginitis (AV). Methods: In this study, the vaginal secretion samples of 3769 patients receiving treatment at the Department of Obstetrics and Gynecology, West China Second Hospital, Sichuan University between January 2020 and December 2021 were selected. Using the results of manual microscopy as the control, we developed the linear kernel SVM algorithm, an artificial intelligence (AI) automated analysis software, with Python Scikit-learn script. The AI automated analysis software could identify leucocytes with toxic appearance and parabasal epitheliocytes (PBC). The bacterial grading parameters were reset using standard strains of lactobacillus and AV common isolates. The receiver operating characteristic (ROC) curve analysis was used to determine the cut-off value of AV evaluation results for different scoring items were obtained by using the results of manual microscopy as the control. Then, the parameters of automatic AV identification were determined and the automatic AV analysis scoring method was initially established. Results: A total of 3769 vaginal secretion samples were collected. The AI automated analysis system incorporated five parameters and each parameter incorporated three severity scoring levels. We selected 1.5 µm as the cut-off value for the diameter between Lactobacillus and common AV bacterial isolates. The automated identification parameter of Lactobacillus was the ratio of bacteria ≥1.5 µm to those <1.5 µm. The cut-off scores were 2.5 and 0.5, In the parameter of white blood cells (WBC), the cut-off value of the absolute number of WBC was 103 µL－1 and the cut-off value of WBC-to-epithelial cell ratio was 10. The automated identification parameter of toxic WBC was the ratio of toxic WBC toWBC and the cut-off values were 1% and 15%. The parameter of background flora was bacteria<1.5 µm and the cut-off values were 5×103 µL－1 and 3×104 µL－1. The parameter of the parabasal epitheliocytes was the ratio of PBC to epithelial cells and the cut-off values were 1% and 10%. The agreement rate between the results of automated microscopy and those of manual microscopy was 92.5%. Out of 200 samples, automated microscopy and manual microscopy produced consistent scores for 185 samples, while the results for 15 samples were inconsistent. Conclusion: We developed an AI recognition software for AV and established an automated vaginal secretion microscopy scoring system for AV. There was good overall concordance between automated microscopy and manual microscopy. The AI identification software for AV can complete clinical lab examination with rather high objectivity, sensitivity, and efficiency, markedly reducing the workload of manual microscopy.

Inhibition and Mechanism of Protein Nonenzymatic Glycation by Lactobacillus fermentum.

Lactobacillus fermentum (L. fermentum) was first evaluated as a potential advanced glycation end-product (AGE) formation inhibitor by establishing a bovine serum albumin (BSA) + glucose (glu) glycation model in the present study. The results showed that the highest inhibition rates of pentosidine and total fluorescent AGEs by L. fermentum were approximately 51.67% and 77.22%, respectively, which were higher than that of aminoguanidine (AG). Mechanistic analysis showed that L. fermentum could capture methylglyoxal and glyoxal, inhibit carbonyl and sulfhydryl oxidation, reduce the binding of glucose and amino groups, increase total phenolic content and antioxidant activity, and release intracellular substances to scavenge free radicals; these abilities were the basis of the antiglycation mechanism of L. fermentum. In addition, L. fermentum significantly prevented conformational changes in proteins during glycation, reduced protein cross-linking by 35.67%, and protected the intrinsic fluorophore. Therefore, the inhibition of L. fermentum on glycation mainly occurs through antioxidation, the capture of dicarbonyl compounds, and the protection of the BSA structure. These findings collectively suggest that Lactobacillus is an inhibitor of protein glycation and AGE formation and has the potential for nutraceutical applications.

Usefulness of Diffusion-Weighted Imaging in Evaluating Acute Cellular Rejection and Monitoring Treatment Response in Liver Transplant Recipients.

Acute cellular rejection (ACR) is a significant immune issue among recipients following liver transplantation. Although diffusion-weighted magnetic resonance imaging (DWI) is widely used for diagnosing liver disease, it has not yet been utilized for monitoring ACR in patients after liver transplantation. Therefore, the aim of this study was to evaluate the efficacy of DWI in monitoring treatment response among recipients with ACR. This study enrolled 25 recipients with highly suspected ACR rejection, and all subjects underwent both biochemistry and DWI scans before and after treatment. A pathological biopsy was performed 4 to 24 h after the first MRI examination to confirm ACR and degree of rejection. All patients were followed up and underwent a repeated MRI scan when their liver function returned to the normal range. After data acquisition, the DWI data were post-processed to obtain the apparent diffusion coefficient (ADC) map on a voxel-by-voxel basis. Five regions of interest were identified on the liver parenchyma to measure the mean ADC values from each patient. Finally, the mean ADC values and biochemical markers were statistically compared between ACR and non-ACR groups. A receiver operating characteristic (ROC) curve was constructed to evaluate the performance of the ADC and biochemical data in detecting ACR, and correlation analysis was used to understand the relationship between the ADC values, biochemical markers, and the degree of rejection. The histopathologic results revealed that 20 recipients had ACR, including 10 mild, 9 moderate, and 1 severe rejection. The results demonstrated that the ACR patients had significantly lower hepatic ADC values than those in patients without ACR. After treatment, the hepatic ADC values in ACR patients significantly increased to levels similar to those in non-ACR patients with treatment. The ROC analysis showed that the sensitivity and specificity for detecting ACR were 80% and 95%, respectively. Furthermore, the correlation analysis revealed that the mean ADC value and alanine aminotransferase level had strong and moderate negative correlation with the degree of rejection, respectively (r = -0.72 and -0.47). The ADC values were useful for detecting hepatic ACR and monitoring treatment response after immunosuppressive therapy.