Gonadal efficacy of Thymus quinquecostatus Celakovski: Regulation of testosterone levels in aging mouse models.

Late-onset hypogonadism (LOH) is an age-related disease in men characterized by decreased testosterone levels with symptoms such as decreased libido, erectile dysfunction, and depression. Thymus quinquecostatus Celakovski (TQC) is a plant used as a volatile oil in traditional medicine, and its bioactive compounds have anti-inflammatory potential. Based on this knowledge, the present study aimed to investigate the effects of TQC extract (TE) on LOH in TM3 Leydig cells and in an in vivo aging mouse model. The aqueous extract of T. quinquecostatus Celakovski (12.5, 25, and 50 µg/mL concentrations) was used to measure parameters such as cell viability, testosterone level, body weight, and gene expression, via in vivo studies. Interestingly, TE increased testosterone levels in TM3 cells in a dose-dependent manner without affecting cell viability. Furthermore, TE significantly increased the expression of genes involved in the cytochrome P450 family (Cyp11a1, Cyp17a1, Cyp19a1, and Srd5a2), which regulate testosterone biosynthesis. In aging mouse models, TE increased testosterone levels without affecting body weight and testicular tissue weight tissue of an aging animal group. In addition, the high-dose TE-treated group (50 mg/kg) showed significantly increased expression of the cytochrome p450 enzymes, similar to the in vitro results. Furthermore, HPLC-MS analysis confirmed the presence of caffeic acid and rosmarinic acid as bioactive compounds in TE. Thus, the results obtained in the present study confirmed that TQC and its bioactive compounds can be used for LOH treatment to enhance testosterone production.

In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor.

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

Computer aided aptamer selection for fabrication of electrochemical sensor to detect Aflatoxin B1.

Aflatoxin B1 (AFB1) is a naturally occurring toxin produced by Aspergillus flavus and Aspergillus parasiticus. The AFB1 is classified as a potent carcinogen and poses significant health risks both to humans and animals. Early detection of the toxin in post-harvest agricultural products will save lives and promote healthy food production. In this study, stratified docking approach was utilized to screen and identify potential aptamers that can bind to AFB1. ssDNA sequences were acquired from the Mendeley dataset, secondary and tertiary structures were predicted through a series of bioinformatics pipelines. Further, the final DNA tertiary structures were minimized and SiteMap algorithm was used to probe and locate binding cavities. According to the final XP docking result, a 34 nt sequence (5'-ATCCTGTGAGGAATGCTCATGCATAGCAAGGGCT-3') aptamer with a docking score of -5.959 kcal/mol was considered for 200 ns MD Simulation. Finally, the screened DNA-aptamer was immobilized over the gold surface based on Au-S chemistry and utilized for the detection of AFB1. The fabricated DNA-aptamer electrode demonstrated a good analytical performance including wide linear range (1.0 to 1000 ng L-1), detection limit (1.0 ng L-1), high stability, and reproducibility.Communicated by Ramaswamy H. Sarma.

Solvent based fractional biosynthesis, phytochemical analysis, and biological activity of silver nanoparticles obtained from the extract of Salvia moorcroftiana.

Multi-drug resistant bacteria sometimes known as "superbugs" developed through overuse and misuse of antibiotics are determined to be sensitive to small concentrations of silver nanoparticles. Various methods and sources are under investigation for the safe and efficient synthesis of silver nanoparticles having effective antibacterial activity even at low concentrations. We used a medicinal plant named Salvia moorcroftiana to extract phytochemicals with antibacterial, antioxidant, and reducing properties. Three types of solvents; from polar to nonpolar, i.e., water, dimethyl sulfoxide (DMSO), and hexane, were used to extract the plant as a whole and as well as in fractions. The biosynthesized silver nanoparticles in all extracts (except hexane-based extract) were spherical, smaller than 20 nm, polydispersed (PDI ranging between 0.2 and 0.5), and stable with repulsive force of action (average zeta value = -18.55±1.17). The tested bacterial strains i.e., Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, and Enterococcus faecalis were found to be sensitive to even small concentrations of Ag-NPs, especially P. aeruginosa. The antibacterial effect of these Ag-NPs was associated with their ability to generate reactive oxygen species. DMSO (in fraction) could efficiently extract antibacterial phytochemicals and showed activity against MDR bacteria (inhibition zone = 11-12 mm). Thus, the antibacterial activity of fractionated DMSO extract was comparable to that of Ag-NPs because it contained phytochemicals having solid antibacterial potential. Furthermore, Ag-NPs synthesized from this extract owned superior antibacterial activity. However, whole aqueous extract-based Ag-NPs MIC was least (7-32 µg/mL) as compared to others.

Metallic Nanoparticles: A Promising Arsenal against Antimicrobial Resistance-Unraveling Mechanisms and Enhancing Medication Efficacy.

The misuse of antibiotics and antimycotics accelerates the emergence of antimicrobial resistance, prompting the need for novel strategies to combat this global issue. Metallic nanoparticles have emerged as effective tools for combating various resistant microbes. Numerous studies have highlighted their potential in addressing antibiotic-resistant fungi and bacterial strains. Understanding the mechanisms of action of these nanoparticles, including iron-oxide, gold, zinc oxide, and silver is a central focus of research within the life science community. Various hypotheses have been proposed regarding how nanoparticles exert their effects. Some suggest direct targeting of microbial cell membranes, while others emphasize the release of ions from nanoparticles. The most compelling proposed antimicrobial mechanism of nanoparticles involves oxidative damage caused by nanoparticles-generated reactive oxygen species. This review aims to consolidate knowledge, discuss the properties and mechanisms of action of metallic nanoparticles, and underscore their potential as alternatives to enhance the efficacy of existing medications against infections caused by antimicrobial-resistant pathogens.

An update on Cryptosporidium biology and therapeutic avenues.

Cryptosporidium species has been identified as an important pediatric diarrheal pathogen in resource-limited countries, particularly in very young children (0-24 months). However, the only available drug (nitazoxanide) has limited efficacy and can only be prescribed in a medical setting to children older than one year. Many drug development projects have started to investigate new therapeutic avenues. Cryptosporidium's unique biology is challenging for the traditional drug discovery pipeline and requires novel drug screening approaches. Notably, in recent years, new methods of oocyst generation, in vitro processing, and continuous three-dimensional cultivation capacities have been developed. This has enabled more physiologically pertinent research assays for inhibitor discovery. In a short time, many great strides have been made in the development of anti-Cryptosporidium drugs. These are expected to eventually turn into clinical candidates for cryptosporidiosis treatment in the future. This review describes the latest development in Cryptosporidium biology, genomics, transcriptomics of the parasite, assay development, and new drug discovery.

In vitro embryotoxicity and mode of antibacterial mechanistic study of gold and copper nanoparticles synthesized from Angelica keiskei (Miq.) Koidz. leaves extract.

The present study demonstrated the in vitro embryotoxicity assessment of gold nanoparticles (AuNPs) and copper nanoparticles (CuNPs) prepared from the leaves extract of Angelica keiskei (Miq.) Koidz. and addressed their mode of antibacterial mechanisms. Both AuNPs and CuNPs were rapidly synthesized and the formations were observed within 1 h and 24 h, respectively. Further the morphological images of the nanoparticles were confirmed through transmission electron microscopy (TEM), field emission scanning electron microscopy (FE-SEM) and atomic force microscopy (AFM). The high-resolution X-ray diffraction (HR-XRD) analysis of the biosynthesized AuNPs and CuNPs were matched with joint committee on powder diffraction standards (JCPDS) file no of 04-0784 and 89-5899, respectively. A strong prominent Au and Cu signals were observed through energy dispersive spectroscopy (EDS) analysis. Fourier transform infrared spectroscopy (FT-IR) analysis confirmed the responsible phytochemicals for the synthesis of AuNPs and CuNPs. In order to assess the toxic effects of AuNPs and CuNPs, bactericidal activity was performed against few of the test pathogens in which the effective inhibition was observed against Gram-negative bacteria than the Gram-positive bacteria. The mode of action and interaction of nanoparticles were performed on the bacterial pathogens and the results concluded that the interaction of nanoparticles initially initiated on the surface of the cell wall adherence followed by ruptured the cells and caused the cell death. In addition to the antibacterial activity, in vitro embryotoxicity studies were performed against zebrafish embryos and the results confirmed that 200 µg/ml concentration of AuNPs showed the embryotoxicity, whereas 2 µg/ml of CuNPs resulted the embryotoxicity. Furthermore, the morphological anomalies of zebrafish embryos revealed the toxic nature of the synthesized nanoparticles.

In vitro toxicological assessment and biosensing potential of bioinspired chitosan nanoparticles, selenium nanoparticles, chitosan/selenium nanocomposites, silver nanoparticles and chitosan/silver nanocomposites.

Hydrogen peroxide (H2O2) is widely used in various industries and biological fields. H2O2 rapidly contaminants with water resources and hence simple detection process is highly wanted in various fields. The present study was focused on the biosensing, antimicrobial and embryotoxicity of bioinspired chitosan nanoparticles (Cs NPs), selenium nanoparticles (Se NPs), chitosan/selenium nanocomposites (Cs/Se NCs), silver nanoparticles (Ag NPs) and chitosan/silver nanocomposites (Cs/Ag NCs) synthesized using the aqueous Cucurbita pepo Linn. leaves extract. The physico-chemical properties of as-synthesized nanomaterials were confirmed by various spectroscopic and microscopic techniques. Further, hydrogen peroxide (H2O2) sensing properties and their sensitivities were confirmed by cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and chronoamperometry (CA) methods, in which Cs/Ag NCs showed pronounced sensing properties. In addition, the mode of antibacterial interaction results clearly demonstrated the effective inhibitory activity of as-prepared Ag NPs and Cs/Ag NCs against Gram negative pathogenic bacteria. The highest embryotoxicity was recorded at 0.19 µg/ml of Ag NPs and 1.56 µg/ml of Se NPs. Intriguingly, the embryo treated with Cs/Se NCs and Cs/Ag NCs significantly reduced the toxicity in the presence of Cs matrix. However, Cs/Se NCs did not show good response in H2O2 sensing than the Cs/Ag NCs, implying the biocompatibility of Cs/Ag NCs. Overall, the obtained results clearly suggest that Cs/Ag NCs could be suitable for dual applications such as for the detection of environmental pollutant biosensors and for biomedical research.

Artemisia gmelinii Attenuates Lung Inflammation by Suppressing the NF-κB/MAPK Pathway.

Cigarette smoke (CS) is the main cause of chronic obstructive pulmonary disease (COPD), and continuous CS exposure causes lung inflammation and deterioration. To investigate the protective effects of Artemisia gmelinii against lung inflammation in this study, cigarette smoke extract (CSE)/lipopolysaccharide (LPS)-treated alveolar macrophages (AMs) and mice stimulated with CSE/porcine pancreas elastase (PPE) were used. Artemisia gmelinii ethanol extract (AGE) was effective in decreasing the levels of cytokines, chemokine, inducible nitric oxide synthase, and cyclooxygenase-2 by inhibiting mitogen-activated protein (MAP) kinases/nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) signaling pathway in AMs. Additionally, oral administration of AGE suppressed inflammatory cells' infiltration and secretion of inflammatory cytokines, chemokines, matrix metallopeptidase 9, and neutrophil extracellular traps in bronchoalveolar lavage fluid from the COPD model. Moreover, the obstruction of small airways, the destruction of the lung parenchyma, and expression of IL-6, TNF-α, IL-1ß, and MIP-2 were suppressed by inhibiting NF-κB activation in the lung tissues of the AGE group. These effects are associated with scopolin, chlorogenic acid, hyperoside, 3,4-di-O-caffeoylquinic acid, 3,5-di-O-caffeoylquinic acid, and 4,5-di-O-caffeoylquinic acid, which are the main components of AGE. These data demonstrate the mitigation effect of AGE on lung inflammation via inhibition of MAPK and NF-κB pathways, suggesting that AGE may be instrumental in improving respiratory and lung health.

Silver nanoparticles decorated reduced graphene oxide: Eco-friendly synthesis, characterization, biological activities and embryo toxicity studies.

This study was aimed on the eco-friendly synthesis of silver nanoparticles (AgNPs), reduced graphene oxide (rGO) and AgNPs decorated rGO (rGO/AgNPs) nanocomposite and appraisal of their bioactivities and toxicity. As-prepared nanomaterials were established through high resolution X-ray diffraction (HR-XRD), high resolution transmission electron microscopy (HR-TEM), X-ray photoelectron spectroscopy (XPS), Raman spectroscopy, UV-Vis. spectroscopy and Fourier transform infrared spectroscopy (FT-IR). In this study, leaves extract, graphene oxide (GO) and rGO did not show antibacterial and anticancer activities; no significant embryo toxicity was recorded. On the other hand, AgNPs displayed good antibacterial and anticancer activities; however, higher toxic effects were observed even at the lowest test concentration (0.7 µg/ml). In case of rGO/AgNPs nanocomposite, significant antibacterial activity together with low cytotoxicity was noticed. Interestingly, the embryo toxicity of AgNPs was significantly reduced by rGO, implying the biocompatible nature of as-synthesized nanocomposite. Taken together, these results clearly suggest that rGO/AgNPs nano hybrid composite could be developed as the promising biomaterial for future biomedical applications.

QSAR and deep learning model for virtual screening of potential inhibitors against Inosine 5' Monophosphate dehydrogenase (IMPDH) of Cryptosporidium parvum.

Cryptosporidium parvum (Cp) causes a gastro-intestinal disease called Cryptosporidiosis. C. parvum Inosine 5' monophosphate dehydrogenase (CpIMPDH) is responsible for the production of guanine nucleotides. In the present study, 37 known urea-based congeneric compounds were used to build a 2D and 3D QSAR model against CpIMPDH. The built models were validated based on OECD principles. A deep learning model was adopted from a framework called Deep Purpose. The model was trained with 288 known active compounds and validated using a test set. From the training set of the 3D QSAR, a pharmacophore model was built and the best pharmacophore hypotheses were scored and sorted using a phase-hypo score. A phytochemical database was screened using both the pharmacophore model and a deep learning model. The screened compounds were considered for glide XP docking, followed by quantum polarized ligand docking. Finally, the best compound among them was considered for molecular dynamics simulation study.

A review on the toxicity of silver nanoparticles against different biosystems.

Despite significant progress made in the past two decades, silver nanoparticles (AgNPs) have not yet made it to the clinical trials. In addition, they showed both positive and negative effects in their toxicity from unicellular organism to well-developed multi-organ system, for example, rat. Although it is generally accepted that capped (bio)molecules have synergistic bioactivities and diminish the toxicity of metallic Ag core, convincing evidence is completely lacking. Therefore, in this review, we first highlight the recent in vivo toxicity studies of chemically manufactured AgNPs, biologically synthesized AgNPs and reference AgNPs of European Commission. Then, their toxic effects are compared with each other and the overlooked factors leading to the potential conflict of obtained toxicity results are discussed. Finally, suggestions are given to better design and conduct the future toxicity studies and to fast-track the successful clinical translation of AgNPs as well.

Antidiabetic Effect of Noodles Containing Fermented Lettuce Extracts.

The aim of the current study was to examine the antidiabetic effect of noodle containing fermented lettuce extract (FLE) on diabetic mice as a pre-clinical study. The γ-aminobutyric acid (GABA) content, antioxidant capacity, and total polyphenol content of the FLE noodles were analyzed and compared with those of standard noodles. In addition, oral glucose and sucrose tolerance, and fasting blood glucose tests were performed using a high-fat diet/streptozotocin-mediated diabetic mouse model. Serum metabolite profiling of mice feed standard or FLE noodles was performed using gas chromatography-time-of-flight mass spectrometry (GC-TOF-MS) to understand the mechanism changes induced by the FLE noodles. The GABA content, total polyphenols, and antioxidant activity were high in FLE noodles compared with those in the standard noodles. In vivo experiments also showed that mice fed FLE noodles had lower blood glucose levels and insulin resistance than those fed standard noodles. Moreover, glycolysis, purine metabolism, and amino acid metabolism were altered by FLE as determined by GC-TOF-MS-based metabolomics. These results demonstrate that FLE noodles possess significant antidiabetic activity, suggesting the applicability of fermented lettuce extract as a potential food additive for diabetic food products.

In-silico analysis of Calcium Dependent Protein Kinase 6 of Cryptosporidium parvum through molecular modeling, docking, and dynamics simulation study.

Calcium Dependent Protein Kinases are found in the Apicomplexan, algae, and plants; however, they are not reported in vertebrates and are regarded as excellent drug targets for pharmaceutical interventions. Calcium Dependent Protein Kinases of Cryptosporidium are probably involved in the regulation of invasion and egress process during the infection of the host cells. The previous study reported that after the Calcium Dependent Protein Kinase 1 gene, Calcium Dependent Protein Kinase 6 of Cryptosporidium parvum is expressed in all stages of the parasite (merozoites/schizonts as well as sexual stages) at a comparable level and makes it as a valid drug target. In this study, an attempt is made to address the similarity in sequences and phylogenetic study of Calcium Dependent Protein Kinase 6 (CDPK6) among Calcium Dependent Protein Kinases of Apicomplexans. Further, the three-dimensional structure determination of CDPK6 of C. parvum was performed through a molecular modeling approach followed by virtual screening of small-molecule inhibitors from different datasets. The best inhibitor from Tres Cantos Antimalarial Set with ID 11730 reported a binding affinity of -8.2 kcal/mol against CDPK6 of C. parvum. Furthermore, the reliability of the binding mode of the inhibitor is validated through a complex molecular dynamics simulation study for a time interval of 100 ns. The simulation study advocates that the inhibitor Tres Cantos Antimalarial Set_11730 formed a stable interaction with the predicted active site residues and can be considered for industrial pharmaceutical research in future.Communicated by Ramaswamy H. Sarma.

An immunoinformatics approach for design and validation of multi-subunit vaccine against Cryptosporidium parvum.

An immunoinformatics-based approach is explored for potential multi-subunit vaccine candidates against Cryptosporidium parvum. We performed protein structure based systematic methodology for the development of a proficient multi-subunit vaccine candidate against C. parvum based on their probability of antigenicity, allergenicity and transmembrane helices as the screening criteria. The best-screened epitopes like B-cell epitopes (BCL), Helper T-lymphocytes (HTL) and cytotoxic T- lymphocytes (CTL) were joined by using the appropriate linkers to intensify and develop the presentation and processing of the antigenic molecules. Modeller software was used to generate the best 3D model of the subunit protein. RAMPAGE and other web servers were employed for the validation of the modeled protein. Furthermore, the predicted modeled structure was docked with the two known receptors like TLR2 and TLR4 through ClusPro web server. Based on the docking score, the multi-subunit vaccine docked with TLR2 was subjected to energy minimization by molecular dynamics (MD) simulation to examine their stability within a solvent system. From the simulation study, we found that the residue Glu-107 of subunit vaccine formed a hydrogen bond interaction with Arg-299 of the TLR2 receptor throughout the time frame of the MD simulation. The overall results showed that the multi-subunit vaccine could be an efficient vaccine candidate against C. parvum.

In vivo toxicity evaluation of biologically synthesized silver nanoparticles and gold nanoparticles on adult zebrafish: a comparative study.

In this study, toxicity of biologically synthesized silver nanoparticles (AgNPs) and gold nanoparticles (AuNPs) was compared using zebrafish as a model organism. At 96 h, LC50 of AgNPs and AuNPs was found to be 24.5 µg/L and 41 mg/L, respectively. Following the LC50 determination, half of the LC50 of AgNPs (12.25 µg/L) and AuNPs (20.5 mg/L) was exposed to adult zebrafishes for 14 days. Morphological changes, liver marker enzymes, reactive oxygen species (ROS) generation, genotoxic effects and mRNA expression levels of oxidative stress and innate immune response related genes were studied using nanoparticle treated gill, liver and blood cells. In this study, AgNP-treated gill and liver tissues showed a number of morphological changes such as cell membrane damage, irregular cell outlines, pyknotic nuclei and complete disruption of gill and liver cells; on the contrary, AuNPs treated liver tissues alone showed such changes. The levels of liver marker enzymes such as alanine aminotransferase and aspartate aminotransferase were increased after AgNPs treatment when compared to AuNPs treatment. AgNP-treated liver cells showed higher levels of ROS generation than the control; on the other hand, AuNPs treatment exhibited lower levels of ROS generation than the control. Interestingly, AgNP-treated blood cells showed micronuclei formation and nuclear abnormalities, while AuNPs treatment did not show such effects. Based on these observations, it is clear that AgNPs may cause oxidative stress and immunotoxicity to adult zebrafish than the AuNPs. However, these results clearly reveal the significance of relatively safe and less toxic bionanomaterials for possible biomedical applications.

In-silico screening of small molecule inhibitors against Lactate Dehydrogenase (LDH) of Cryptosporidium parvum.

Cryptosporidium parvum is a protozoan parasite which causes waterborne diseases known as Cryptosporidiosis. It is an acute enteric diarrheal disease being severe in the case of immunocompromised individuals and children. C. parvum mainly depends on the glycolysis process for energy production and LDH (Lactate Dehydrogenase) is a key controller of this process. In this study from different in-silico approaches such as structure-based, ligand-based and de novo drug design; a total of 40 compounds were selected for docking studies against LDH. The study reported a compound CHEMBL1784973 from Pathogen Box as the best inhibitor in terms of docking score and pharmacophoric features. Furthermore, the binding mode of the best-reported inhibitor was validated through molecular dynamics simulation for a time interval of 70 ns in water environment. The findings resulted in the stable conformation of the inhibitor in the active site of the protein. This study will be helpful for experimental validation.

Interaction of silver and gold nanoparticles in mammalian cancer: as real topical bullet for wound healing- A comparative study.

The present study evaluates in vitro cytotoxic effects and the mode of interaction of biologically synthesized Ag and Au nanoparticles (NPs) using Brassica oleracea L. var. capitata f. rubra (BOL) against HT-1080 cancer cells and bacterial cells as well as their wound healing efficacy using a mouse model. UV-visible spectroscopy, scanning electron microscopy, high-resolution transmission electron microscopy, and energy-dispersive X-ray analysis have ascertained the formation of nano-sized Ag and Au particles. Fourier transform infrared analysis has confirmed that polyphenol and amide groups in BOL act as capping as well as reducing agents. The free radical scavenging activity under in vitro conditions is found to be higher for the Ag NPs when compared to the Au NPs. Acridine orange-ethidium bromide dual staining and comet assay have indicated that the cytotoxic effects are mediated through nuclear morphological changes and DNA damage. The intracellular localization of Ag and Au NPs in HT-1080 cells and their subsequent effect on apoptosis and necrosis were analyzed by flow cytometry while the mode of interaction was established by scanning electron microscopy under field emission mode and by bio-transmission electron microscopy. These methods of analysis clearly revealed that the Ag and Au NPs have easily entered and accumulated into the cytosol and nucleus, resulting in activation of inflammatory and apoptosis pathways, which in turn cause damage in DNA. Further, mRNA and protein expression of caspase-3 and caspase-7, TNF-α, and NF-κB have provided sufficient clues for induction of intrinsic and extrinsic apoptosis and inflammatory pathways in Ag NP- and Au NP-treated cells. Evaluation of wound healing properties of Ag and Au NPs using a mouse model indicates rapid healing of wounds. In addition, no clear toxic effects and no nuclear abnormalities in peripheral blood cells are observed. Ag NPs appear to be a better anticancer therapeutic agent than Au NPs. Nonetheless, both Ag NPs and Au NPs show potential for promoting topical wound healing without any toxic effects. Graphical abstract Schematic representation of biological synthesis of Ag and Au NPs and its application on cancer and wound healing.

Anticancer activity of biologically synthesized silver and gold nanoparticles on mouse myoblast cancer cells and their toxicity against embryonic zebrafish.

The aim of this study was to evaluate the anticancer activity of bioinspired silver nanoparticles (AgNPs) and gold nanoparticles (AuNPs) against mouse myoblast cancer cells (C2C12). Both AgNPs and AuNPs were biologically synthesized using Spinacia oleracea Linn., aqueous leaves extract. UV-Vis. spectrophotometer, high resolution-transmission electron microscopy (HR-TEM), field emission-scanning electron microscopy (FE-SEM) and X-ray diffraction (XRD) studies supported the successful synthesis of AgNPs and AuNPs. Both these NPs have shown cytotoxicity against C2C12 cells even at very low concentration (5µg/mL). Acridine orange/Ethidium bromide (AO/EB) dual staining confirmed the apoptotic morphological features. The levels of caspase enzymes (caspase-3 and caspase-7) were significantly up-regulated in NPs treated myoblast cells than the plant extract. Furthermore, in zebrafish embryo toxicity study, AgNPs showed 100% mortality at 3µg/mL concentration while AuNPs exhibited the same at much higher concentration (300mg/mL). Taken together, these results provide a preliminary guidance for the development of biomaterials based drugs to fight against the fatal diseases for example cancer.

Peanut skin extract mediated synthesis of gold nanoparticles, silver nanoparticles and gold-silver bionanocomposites for electrochemical Sudan IV sensing.

Sustainable methods are needed for rapid and efficient detection of environmental and food pollutants. The Sudan group of dyes has been used extensively as adulterants in food and also are found to be polluting the soil and water bodies. There have been several methods for detection of Sudan dyes, but most of them are not practical enough for common use. In this study, the electrochemical detection efficiency and stability of gold nanoparticle (AuNPs), silver NPs and Au-Ag bionanocomposites, synthesised by peanut skin extract, modified glassy carbon electrode has been investigated. The synthesised nanomaterial samples were characterised, for their quality and quantity, using ultra-visible spectroscopy, inductive coupled plasma mass spectrophotometer, Fourier transform infrared spectroscopy, energy-dispersive X-ray spectroscopy, high-resolution transmission electron microscope and field emission scanning electron microscope. The nanomaterial hybrid electrodes showed great efficiency and stability in the detection of Sudan IV compared with the other previous electrodes. The peak current of the Sudan IV oxidation and reduction was found to be proportional to its concentration, in the range of 10-80 µM, with a detection limit of 4 µM. The hybrid electrodes showed 90% stability in detection for 20 cycles.