The interaction between KIF21A and KANK1 regulates dendritic morphology and synapse plasticity in neurons.

JOURNAL/nrgr/04.03/01300535-202501000-00029/figure1/v/2024-05-14T021156Z/r/image-tiff Morphological alterations in dendritic spines have been linked to changes in functional communication between neurons that affect learning and memory. Kinesin-4 KIF21A helps organize the microtubule-actin network at the cell cortex by interacting with KANK1; however, whether KIF21A modulates dendritic structure and function in neurons remains unknown. In this study, we found that KIF21A was distributed in a subset of dendritic spines, and that these KIF21A-positive spines were larger and more structurally plastic than KIF21A-negative spines. Furthermore, the interaction between KIF21A and KANK1 was found to be critical for dendritic spine morphogenesis and synaptic plasticity. Knockdown of either KIF21A or KANK1 inhibited dendritic spine morphogenesis and dendritic branching, and these deficits were fully rescued by coexpressing full-length KIF21A or KANK1, but not by proteins with mutations disrupting direct binding between KIF21A and KANK1 or binding between KANK1 and talin1. Knocking down KIF21A in the hippocampus of rats inhibited the amplitudes of long-term potentiation induced by high-frequency stimulation and negatively impacted the animals' cognitive abilities. Taken together, our findings demonstrate the function of KIF21A in modulating spine morphology and provide insight into its role in synaptic function.

The association between ondansetron use and mortality risk of traumatic brain injury patients: a population-based study.

Background: Traumatic brain injury (TBI) patients suffer high risks of mortality. Ondansetron has been verified to be effective in improving the prognosis of some kinds of critically ill patients. We design this study to explore whether ondansetron use is associated with lower risks of mortality among TBI patients. Methods: TBI patients from the Medical Information Mart for Intensive Care-III were collected. The usage of ondansetron, including intravenous injection and oral tablet, since admission to the Beth Israel Deaconess Medical Center between 2001 and 2012 was identified. Univariate and multivariate logistic regression were performed to analyze the relationship between the ondansetron use and mortality of TBI patients. Propensity score matching (PSM) was utilized to generate balanced cohorts of the non-ondansetron use group and ondansetron use group. Sub-group analysis was performed to verify the association between the ondansetron use and mortality of TBI patients in different TBI severity levels after PSM. Results: In TBI cohorts before PSM, the usage incidence of ondansetron was 37.2%. The 30-day mortality was significantly lower in the ondansetron group (p < 0.001). The multivariate logistic regression showed that ondansetron was associated with the lower mortality of TBI patients (p = 0.008). In TBI cohorts after PSM, the 30-day mortality of the ondansetron group was lower than that of the non-ondansetron group, although without statistical significance (p = 0.079). Logistic regression indicated ondansetron use was significantly associated with the lower mortality of moderate-to-severe TBI (p < 0.001) but not mild TBI (p = 0.051). In addition, Cox regression also presented that ondansetron use was significantly associated with the lower mortality of moderate-to-severe TBI (p < 0.001) but not mild TBI (p = 0.052). Conclusion: Ondansetron usage is associated with a lower mortality risk of moderate-to-severe TBI but not mild TBI patients. Ondansetron may be a novel adjunctive therapeutic strategy to improve the prognosis of moderate-to-severe TBI patients.

Moderating effect of education on glymphatic function and cognitive performance in mild cognitive impairment.

Objective: This research aims to investigate putative mechanisms between glymphatic activity and cognition in mild cognitive impairment (MCI) and analyzes whether the relationship between cognitive reserve (CR) and cognition was mediated by glymphatic activity. Methods: 54 MCI patients and 31 NCs were enrolled to evaluate the bilateral diffusivity along the perivascular spaces and to acquire an index for diffusivity along the perivascular space (ALPS-index) on diffusion tensor imaging (DTI). The year of education was used as a proxy for CR. The ALPS-index was compared between two groups and correlation analyses among the ALPS-index, cognitive function, and CR were conducted. Mediation analyses were applied to investigate the correlations among CR, glymphatic activity and cognition. Results: MCI group had a significantly lower right ALPS-index and whole brain ALPS-index, but higher bilateral diffusivity along the y-axis in projection fiber area (Dyproj) than NCs. In MCI group, the left Dyproj was negatively related to cognitive test scores and CR, the whole brain ALPS-index was positively correlated with cognitive test scores and CR. Mediation analysis demonstrated that glymphatic activity partially mediated the correlations between CR and cognitive function. Conclusion: MCI exhibited decreased glymphatic activity compared to NCs. CR has a protective effect against cognitive decline in MCI, and this effect may be partially mediated by changes in glymphatic activity.

Toxicity of Beauveria bassiana to Bactrocera dorsalis and effects on its natural predators.

Entomopathogenic fungi (EPF) are economical and environmentally friendly, forming an essential part of integrated pest management strategies. We screened six strains of Beauveria bassiana (B1-B6) (Hypocreales: Cordycipitaceae), of which B4 was the most virulent to Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). We further assessed the biological characteristics of strain B4 and the environmental factors influencing its ability to infect B. dorsalis. We also evaluated the effects of B4 on two of the natural predators of B. dorsalis. We found that strain B4 was the most virulent to 3rd instar larvae, pupae, and adult B. dorsalis, causing mortality rates of 52.67, 61.33, and 90.67%, respectively. B4 was not toxic to B. dorsalis eggs. The optimum B4 effects on B. dorsalis were achieved at a relative humidity of 91-100% and a temperature of 25°C. Among the six insecticides commonly used for B. dorsalis control, 1.8% abamectin emulsifiable concentrate had the strongest inhibitory effect on B4 strain germination. B4 spraying affected both natural enemies (Amblyseius cucumeris and Anastatus japonicus), reducing the number of A. cucumeris and killing A. japonicus adults. We found a valuable strain of EPF (B4) that is virulent against many life stages of B. dorsalis and has great potential for the biological control of B. dorsalis. We also provide an important theoretical and practical base for developing a potential fungicide to control B. dorsalis.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Expanding the clinical phenotype and genetic spectrum of GEMIN5 disorders: Early-infantile developmental and epileptic encephalopathies.

BACKGROUND: Several biallelic truncating and missense variants of the gem nuclear organelle-associated protein 5 (GEMIN5) gene have been reported to cause neurodevelopmental disorders characterized by cerebellar atrophy, intellectual disability, and motor dysfunction. However, the association between biallelic GEMIN5 variants and early-infantile developmental and epileptic encephalopathies (EIDEEs) has not been reported. PURPOSE: This study aimed to expand the phenotypic spectrum of GEMIN5 and explore the correlations between epilepsy and molecular sub-regional locations. METHODS: We performed whole-exome sequencing in two patients with EIDEE with unexplained etiologies. The damaging effects of variants were predicted using multiple in silico tools and modeling. All reported patients with GEMIN5 pathogenic variants and detailed neurological phenotypes were analyzed to evaluate the genotype-phenotype relationship. RESULTS: Novel biallelic GEMIN5 variants were identified in two unrelated female patients with EIDEE, including a frameshift variant (Hg19, chr5:154284147-154284148delCT: NM_015465: c.2551_c.2552delCT: p.(Leu851fs*30)), a nonsense mutation (Hg19, chr5:154299603-154299603delTinsAGA: NM_015465: c.1523delTinsAGA: p.(Leu508*)), and two missense variants (Hg19, chr5:154282663T > A: NM_015465: c.2705T > A: p.(Leu902Gln) and Hg19, chr5:154281002C > G: NM_015465: c.2911C > G: p.(Gln971Glu)), which were inherited from asymptomatic parents and predicted to be damaging or probably damaging using in silico tools. Except p.Leu508*, all these mutations are located in tetratricopeptide repeat (TPR) domain. Our two female patients presented with seizures less than 1 month after birth, followed by clusters of spasms. Brain magnetic resonance imaging suggests dysgenesis of the corpus callosum and cerebellar hypoplasia. Video electroencephalogram showed suppression-bursts. Through a literature review, we found 5 published papers reporting 48 patients with biallelic variants in GEMIN5. Eight of 48 patients have epilepsy, and 5 patients started before 1 year old, which reminds us of the relevance between GEMIN5 variants and EIDEE. Further analysis of the 49 GEMIN5 variants in those 50 patients demonstrated that variants in TPR-like domain or RBS domain were more likely to be associated with epilepsy. CONCLUSIONS: We found novel biallelic variants of GEMIN5 in two individuals with EIDEE and expanded the clinical phenotypes of GEMIN5 variants. It is suggested that the GEMIN5 gene should be added to the EIDEE gene panel to aid in the clinical diagnosis of EIDEE and to help determine patient prognosis.

Robust Radicals Featuring B- and N-Embedded Dioxygen-Bridged Units: Synthesis, Structures, and Optical Properties.

Tris(2,4,6trichlorophenyl)methyl (TTM) group has been widely used for constructing organic radicals, but the poor optical stabilities limit the application prospects of the TTM radicals. In this work, the rigid B- and N-embedded dioxygen-bridged (BO and NO) units were attached to the TTM skeleton as the strong electron-withdrawing and electron-donating groups, respectively. The rigidity and strong electronic effect of the BO and NO units contribute to the high chemical and optical stability of BO-TTM and NO-TTM radicals. Notably, NO-TTM exhibits near-infrared emission at 830 nm with a narrow full width at half maximum (FWHM) of 55 nm (100 meV), while BO-TTM shows blue-shifted luminescence at 635 nm and a narrower FWHM of merely 43 nm (130 meV). This study has developed a methodology to produce highly efficient and enduring luminescent radicals, which could tune emission properties such as wavelength and FWHM.

Administration of Liposomal-Based Pde3b Gene Therapy Protects Mice Against Collagen-Induced Rheumatoid Arthritis via Modulating Macrophage Polarization.

Background: Rheumatoid arthritis (RA) is a chronic and systemic autoimmune disease characterized by synovial inflammation and joint destruction. Despite progress in RA therapy, it remains difficult to achieve long-term remission in RA patients. Phosphodiesterase 3B (Pde3b) is a member of the phosphohydrolyase family that are involved in many signal transduction pathways. However, its role in RA is yet to be fully addressed. Methods: Studies were conducted in arthritic DBA/1 mice, a suitable mouse strain for collagen-induced rheumatoid arthritis (CIA), to dissect the role of Pde3b in RA pathogenesis. Next, RNAi-based therapy with Pde3b siRNA-loaded liposomes was assessed in a CIA model. To study the mechanism involved, we investigated the effect of Pde3b knockdown on macrophage polarization and related signaling pathway. Results: We demonstrated that mice with CIA exhibited upregulated Pde3b expression in macrophages. Notably, intravenous administration of liposomes loaded with Pde3b siRNA promoted the macrophage anti-inflammatory program and alleviated CIA in mice, as indicated by the reduced inflammatory response, synoviocyte infiltration, and bone and cartilage erosion. Mechanistic study revealed that depletion of Pde3b increased cAMP levels, by which it enhanced PKA-CREB-C/EBPß pathway to transcribe the expression of anti-inflammatory program-related genes. Conclusion: Our results support that Pde3b is involved in the pathogenesis of RA, and Pde3b siRNA-loaded liposomes might serve as a promising therapeutic approach against RA.

Overlooked interaction between redox-mediator and bisphenol-A in permanganate oxidation.

Research efforts on permanganate (Mn(VII)) combined with redox-mediator (RM), have received increasing attention due to their significant performance for bisphenol-A (BPA) removal. However, the mechanisms underpinning BPA degradation remain underexplored. Here we show the overlooked interactions between RM and BPA during permanganate oxidation by introducing an RM-N-hydroxyphthalimide (NHPI). We discovered that the concurrent generation of MnO2 and phthalimide-N-oxyl (PINO) radical significantly enhances BPA oxidation within the pH range of 5.0-6.0. The detection of radical cross-coupling products between PINO radicals and BPA or its derivatives corroborates the pivotal role of radical cross-coupling in BPA oxidation. Intriguingly, we observed the formation of an NHPI-BPA complex, which undergoes preferential oxidation by Mn(VII), marked by the emergence of an electron-rich domain in NHPI. These findings unveil the underlying mechanisms in the Mn(VII)/RM system and bridge the knowledge gap concerning BPA transformation via complexation. This research paves the way for further exploration into optimizing complexation sites and RM dosage, significantly enhancing the system's efficiency in water treatment applications.

The FAITHS2 Model Predicts Functional Disability in Patients With Acute Ischemic Stroke.

The present study aimed to develop a model to predict functional disability at 3 months in patients with acute ischemic stroke (AIS) (n = 5,406). The primary outcome was functional disability (modified Rankin Scale [mRS] >2) at 3 months. A prediction model including blood biomarkers was developed based on a multivariable logistic regression model, which was internally validated by the 100-time bootstrap method. A nomogram and a web-based calculator were developed for usage in clinical practice. At 3 months, 11% (638/5,406) of the patients had functional disability. Seven independent predictors of functional disability at 3 months were incorporated into the FAITHS2 model (fasting plasma glucose, age, interleukin-6, stroke history, National Institute of Health Stroke Scale [NIHSS] at admission, sex, and systolic blood pressure). The Area Under Curves (AUCs) were 0.814 (95% confidence interval [CI] 0.796-0.832) and 0.808 (95% CI 0.806-0.810), and the Brier scores were 0.088 ± 0.214 and 0.089 ± 0.003 for the derivation cohort and internal validation, respectively, showing optimal performance of the model. The FAITHS2 model has excellent potential to be a dependable application for individualized clinical decision making.

OsMPK12 positively regulates rice blast resistance via OsEDC4-mediated transcriptional regulation of immune-related genes.

Mitogen-activated protein kinase (MAPK) signalling cascades are functionally important signalling modules in eukaryotes. Transcriptome reprogramming of immune-related genes is a key process in plant immunity. Emerging evidence shows that plant MAPK cascade is associated with processing (P)-body components and contributes to transcriptome reprogramming of immune-related genes. However, it remains largely unknown how this process is regulated. Here, we show that OsMPK12, which is induced by Magnaporthe oryzae infection, positively regulates rice blast resistance. Further analysis revealed that OsMPK12 directly interacts with enhancer of mRNA decapping protein 4 (OsEDC4), a P-body-located protein, and recruits OsEDC4 to where OsMPK12 is enriched. Importantly, OsEDC4 directly interacts with two decapping complex members OsDCP1 and OsDCP2, indicating that OsEDC4 is a subunit of the mRNA decapping complex. Additionally, we found that OsEDC4 positively regulates rice blast resistance by regulating expression of immune-related genes and maintaining proper mRNA levels of some negatively-regulated genes. And OsMPK12 and OsEDC4 are also involved in rice growth and development regulation. Taken together, our data demonstrate that OsMPK12 positively regulates rice blast resistance via OsEDC4-mediated mRNA decay of immune-related genes, providing new insight into not only the new role of the MAPK signalling cascade, but also posttranscriptional regulation of immune-related genes.

Evidence from mendelian randomization identifies several causal relationships between primary membranous nephropathy and gut microbiota.

BACKGROUND: Research has showcased a correlation between disruptions in gut microbiota and primary membranous nephropathy (pMN), giving rise to the concept of the 'gut-kidney axis'. However, the precise relationship between gut microbiota and pMN remains elusive. Hence, this study endeavors to investigate whether a causal relationship exists between gut microbiota and pMN utilizing Mendelian randomization (MR) analysis. METHODS: The primary method employed for MR analysis is the inverse variance weighting method, supplemented by MR-Egger and the weighted median method, to infer causality. This approach was validated within the pMN cohort across two distinct populations. RESULTS: At the species level, the abundance of Bifidobacterium bifidum and Alistipes indistinctus was negatively correlated with the risk of pMN. Conversely, pMN was positively associated with Bacilli abundance at the class level, Lachnospiraceae abundance at the family level, and Dialister abundance at the genus level. Specifically, at the species level, pMN was positively correlated with the abundance of Ruminococcus lactaris, Dialister invisus, and Coprococcus_sp_ART55_1. CONCLUSION: These findings lay the groundwork for future research exploring the interplay between pMN and the gut microbiota, with substantial implications for the prevention and treatment of pMN and its associated complications.

RBF neural network disturbance observer-based backstepping boundary vibration control for Euler-Bernoulli beam model with input saturation.

The main objective of this paper is to address the issue of vibration control for a class of Euler-Bernoulli beam systems that are subject to external disturbances and input saturation. The proposed controller differs from other backstepping methods in that it employs a radial basis function (RBF) neural network to accurately estimate boundary disturbances and incorporates the hyperbolic tangent function to ensure input constraints. The nonlinear partial differential equation (PDE) model is initially derived based on Hamilton's principle to capture the dominant dynamic characteristics of the flexible beam. In the framework of the Lyapunov direct approach, an adaptive RBF neural network-based law is subsequently designed to estimate the state-related boundary disturbances. The backstepping approach is then developed to propose sufficient conditions for ensuring the stability and convergence of closed-loop systems subject to input saturation. Finally, the effectiveness and superiority of the proposed methodology are further demonstrated by comparing the simulation results of constrained backstepping controllers.

Dimethyl-Dioctadecyl-Ammonium Bromide/Poly(lactic acid) Nanoadjuvant Enhances the Immunity and Cross-Protection of an NM2e-Based Universal Influenza Vaccine.

For most frequent respiratory viruses, there is an urgent need for a universal influenza vaccine to provide cross-protection against intra- and heterosubtypes. We previously developed an Escherichia coli fusion protein expressed extracellular domain of matrix 2 (M2e) and nucleoprotein, named NM2e, and then combined it with an aluminum adjuvant, forming a universal vaccine. Although NM2e has demonstrated a protective effect against the influenza virus in mice to some extent, further improvement is still needed for the induction of immune responses ensuring adequate cross-protection against influenza. Herein, we fabricated a cationic solid lipid nanoadjuvant using poly(lactic acid) (PLA) and dimethyl-dioctadecyl-ammonium bromide (DDAB) and loaded NM2e to generate an NM2e@DDAB/PLA nanovaccine (Nv). In vitro experiments suggested that bone marrow-derived dendritic cells incubated with Nv exhibited ∼4-fold higher antigen (Ag) uptake than NM2e at 16 h along with efficient activation by NM2e@DDAB/PLA Nv. In vivo experiments revealed that Ag of the Nv group stayed in lymph nodes (LNs) for more than 14 days after initial immunization and DCs in LNs were evidently activated and matured. Furthermore, the Nv primed T and B cells for robust humoral and cellular immune responses after immunization. It also induced a ratio of IgG2a/IgG1 higher than that of NM2e to a considerable extent. Moreover, NM2e@DDAB/PLA Nv quickly restored body weight and improved survival of homo- and heterosubtype influenza challenged mice, and the cross-protection efficiency was over 90%. Collectively, our study demonstrated that NM2e@DDAB/PLA Nv could offer notable protection against homo- and heterosubtype influenza virus challenges, offering the potential for the development of a universal influenza vaccine.

The added value of ultrasound imaging biomarkers to clinicopathological factors for the prediction of high-risk Oncotype DX recurrence scores in patients with breast cancer.

Background: The Oncotype DX (ODX) recurrence score (RS), a 21-gene assay, has been proven to recognize patients at high risk of recurrence (RS ≥26) who would benefit from chemotherapy. However, it has limited availability and high costs. Our study thus aimed to identify ultrasound (US) imaging biomarkers and develop a prediction model for identifying patients with a high ODX RS. Methods: In this retrospective study, consecutive patients with T1-3N0-1M0 breast cancer who were hormone receptor positive and human epidermal growth factor receptor 2 (HER2) negative who had an available ODX RS were reviewed. Patients treated from May 2012 and December 2015 were placed into a training cohort, and those treated from January 2016 to January 2017 were placed in a validation cohort. Clinicopathologic data were collected, and preoperative US scans were analyzed. Univariable and multivariable regression analyses were performed to evaluate the independent predictors for a high-risk of breast cancer in the training cohort, and a nomogram was developed and evaluated with the area under the receiver operating characteristic curve (AUC), calibration curve, and decision curve analysis (DCA). Results: A total of 363 patients were in the training cohort and 160 in the validation cohort, with the proportion with a high RS (RS 26-100) being 14% and 13.1%, respectively. Echogenic halo, enhanced posterior echo, low level of progesterone receptor (PR), and high Ki-67 index were identified as independent risk factors for high RS (all P values <0.05). The nomogram was constructed based on the combined model, which showed a better discrimination ability than did the clinicopathological model [combined model: AUC =0.95, 95% confidence interval (CI): 0.93-0.97; clinicopathological model: AUC =0.89, 95% CI: 0.86-0.92; P=0.001] and greater clinical benefit according to DCA. Furthermore, the nomogram was found to be effective in the validation cohort (AUC =0.90, 95% CI: 0.84-0.94), especially in patients with stage T1N0M0 disease (AUC =0.91, 95% CI: 0.84-0.95). Conclusions: US features may serve as valuable imaging biomarkers for the prediction of high recurrence risk in patients with T1-3N0-1M0 breast cancer and hormone receptor (HR)-positive and HER2-negative status. A nomogram incorporating PR status, Ki-67 index, and US imaging biomarkers showed a good discrimination ability in the early selection of patients at high risk of recurrence, especially in those with stage T1N0M0 disease.

High-Entropy Polymer Electrolytes Derived from Multivalent Polymeric Ligands for Solid-State Lithium Metal Batteries with Accelerated Li+ Transport.

Solid-state polymer-based electrolytes (SSPEs) exhibit great possibilities in realizing high-energy-density solid-state lithium metal batteries (SSLMBs). However, current SSPEs suffer from low ionic conductivity and unsatisfactory interfacial compatibility with metallic Li because of the high crystallinity of polymers and sluggish Li+ movement in SSPEs. Herein, differing from common strategies of copolymerization, a new strategy of constructing a high-entropy SSPE from multivariant polymeric ligands is proposed. As a protocol, poly(vinylidene fluoride-co-hexafluoropropylene) (PH) chains are grafted to the demoed polyethylene imine (PEI) with abundant -NH2 groups via a click-like reaction (HE-PEIgPHE). Compared to a PH-based SSPE, our HE-PEIgPHE shows a higher modulus (6.75 vs 5.18 MPa), a higher ionic conductivity (2.14 × 10-4 vs 1.03 × 10-4 S cm-1), and a higher Li+ transference number (0.55 vs 0.42). A Li|HE-PEIgPHE|Li cell exhibits a long lifetime (1500 h), and a Li|HE-PEIgPHE|LiFePO4 cell delivers an initial capacity of 160 mAh g-1 and a capacity retention of 98.7%, demonstrating the potential of our HE-PEIgPHE for the SSLMBs.

Superfast Zincophilic Ion Conductor Enables Rapid Interfacial Desolvation Kinetics for Low-Temperature Zinc Metal Batteries.

Low-temperature rechargeable aqueous zinc metal batteries (AZMBs) as highly promising candidates for energy storage are largely hindered by huge desolvation energy barriers and depressive Zn2+ migration kinetics. In this work, a superfast zincophilic ion conductor of layered zinc silicate nanosheet (LZS) is constructed on a metallic Zn surface, as an artificial layer and ion diffusion accelerator. The experimental and simulation results reveal the zincophilic ability and layer structure of LZS not only promote the desolvation kinetics of [Zn(H2O)6]2+ but also accelerate the Zn2+ transport kinetics across the anode/electrolyte interface, guiding uniform Zn deposition. Benefiting from these features, the LZS-modified Zn anodes showcase long-time stability (over 3300 h) and high Coulombic efficiency with ≈99.8% at 2 mA cm-2, respectively. Even reducing the environment temperature down to 0 °C, ultralong cycling stability up to 3600 h and a distinguished rate performance are realized. Consequently, the assembled Zn@LZS//V2O5-x full cells deliver superior cyclic stability (344.5 mAh g-1 after 200 cycles at 1 A g-1) and rate capability (285.3 mAh g-1 at 10 A g-1) together with a low self-discharge rate, highlighting the bright future of low-temperature AZMBs.

Controllable Design of Metal-Organic Framework-Derived Vanadium Oxynitride for High-Capacity and Long-Cycle Aqueous Zn-Ion Batteries.

Introducing N atoms in vanadium oxides (VOx) of aqueous Zn-ion batteries (ZIBs) can reduce their bandgap energy and enhance their electronic conductivity, thereby promoting the diffusion of Zn2+. The close-packed vanadium oxynitride (VON) generated often necessitates the intercalation of water molecules for restructuring, rendering it more conducive for zinc ion intercalation. However, its dense structure often causes structural strain and the formation of by-products during this process, resulting in decreased electrochemical performance. Herein, carbon-coated porous V2O3/VN nanosheets (p-VON@C) are constructed by annealing vanadium metal-organic framework in an ammonia-contained environment. The designed p-VON@C nanosheets are efficiently converted to low-crystalline hydrated N-doped VOx during subsequent activation while maintaining structural stability. This is because the V2O3/VN heterojunction and abundant oxygen vacancies in p-VON@C alleviate the structural strain during water molecule intercalation, and accelerate the intercalation rate. Carbon coating is beneficial to prevent p-VON@C from sliding or falling off during the activation and cycling process. Profiting from these advantages, the activated p-VON@C cathode delivers a high specific capacity of 518 mAh g-1 at 0.2 A g-1 and maintains a capacity retention rate of 80.9% after 2000 cycles at 10 A g-1. This work provides a pathway to designing high-quality aqueous ZIB cathodes.

Synergistic dual sites of Zn-Mg on hierarchical porous carbon as an advanced oxygen reduction electrocatalyst for Zn-air batteries.

The development of cost-effective and high-performance non-noble metal catalysts for the oxygen reduction reaction (ORR) holds substantial promise for real-world applications. Introducing a secondary metal to design bimetallic sites enables effective modulation of a metal-nitrogen-carbon (M-N-C) catalyst's electronic structure, providing new opportunities for enhancing ORR activity and stability. Here, we successfully synthesized an innovative hierarchical porous carbon material with dual sites of Zn and Mg (Zn/Mg-N-C) using polymeric ionic liquids (PILs) as precursors and SBA-15 as a template through a bottom-up approach. The hierarchical porous structure and optimized Zn-Mg bimetallic catalytic centers enable Zn/Mg-N-C to exhibit a half-wave potential of 0.89 V, excellent stability, and good methanol tolerance in 0.1 M KOH solution. Theoretical calculations indicated that the Zn-Mg bimetallic sites in Zn/Mg-N-C effectively lowered the ORR energy barrier. Furthermore, the Zn-air batteries assembled based on Zn/Mg-N-C demonstrated an outstanding peak power density (298.7 mW cm-2) and superior cycling stability. This work provides a method for designing and synthesizing bimetallic site catalysts for advanced catalysis.

Efficacy of a novel affitoxin targeting MOMP against Chlamydia trachomatis in vitro and in vivo.

Targeted therapy is an attractive approach for treating infectious diseases. Affibody molecules have similar capability to antibodies that facilitate molecular recognition in both diagnostic and therapeutic applications. Targeting major outer membrane protein (MOMP) for treating infection of Chlamydia trachomatis, one of the most common sexually transmitted pathogens, is a promising therapeutic approach. Previously, we have reported a MOMP-specific affibody (ZMOMP:461) from phage display library. Here, we first fused it with modified Pseudomonas Exotoxin (PE38KDEL) and a cell-penetrating peptide (CPP) to develop an affitoxin, Z461X-CPP. We then verified the addition of both toxin and CPPs that did not affect the affinitive capability of ZMOMP:461 to MOMP. Upon uptake by C.trachomatis-infected cells, Z461X-CPP induced cell apoptosis in vitro. In animal model, Z461X significantly shortened the duration of C. trachomatis infection and prevented pathological damage in mouse reproductive system. These findings provide compelling evidence that the MOMP-specific affitoxin has great potential for targeting therapy of C. trachomatis infection.