Predictors and 5-Year Clinical Outcomes of Pacemaker After TAVR: Analysis From the PARTNER 2 SAPIEN 3 Registries.

BACKGROUND: Conduction disturbances requiring a permanent pacemaker (PPM) are a frequent complication of transcatheter aortic valve replacement (TAVR) with few reports of rates, predictors, and long-term clinical outcomes following implantation of the third-generation, balloon-expandable SAPIEN 3 (S3) transcatheter heart valve (THV). OBJECTIVES: The aim of this study was to investigate the rates, predictors, and long-term clinical outcomes of PPM implantation following TAVR with the S3 THV. METHODS: The current study included 857 patients in the PARTNER 2 S3 registries with intermediate and high surgical risk without prior PPM, and investigated predictors and 5-year clinical outcomes of new PPM implanted within 30 days of TAVR. RESULTS: Among 857 patients, 107 patients (12.5%) received a new PPM within 30 days after TAVR. By multivariable analysis, predictors of PPM included increased age, pre-existing right bundle branch block, larger THV size, greater THV oversizing, moderate or severe annulus calcification, and implantation depth >6 mm. At 5 years (median follow-up 1,682.0 days [min 2.0 days, max 2,283.0 days]), new PPM was not associated with increased rates of all-cause mortality (Adj HR: 1.20; 95% CI: 0.85-1.70; P = 0.30) or repeat hospitalization (Adj HR: 1.22; 95% CI: 0.67-2.21; P = 0.52). Patients with new PPM had a decline in left ventricular ejection fraction at 1 year that persisted at 5 years (55.1 ± 2.55 vs 60.4 ± 0.65; P = 0.02). CONCLUSIONS: PPM was required in 12.5% of patients without prior PPM who underwent TAVR with a SAPIEN 3 valve in the PARTNER 2 S3 registries and was not associated with worse clinical outcomes, including mortality, at 5 years. Modifiable factors that may reduce the PPM rate include bioprosthetic valve oversizing, prosthesis size, and implantation depth.

Design and rationale of the evaluation of transcatheter aortic valve replacement compared to surveillance for patients with asymptomatic severe aortic stenosis: The EARLY TAVR trial.

BACKGROUND: For patients with asymptomatic, severe aortic stenosis (AS) and preserved left ventricular ejection fraction, current guidelines recommend clinical surveillance every 6 to 12 months. To date, no randomized trials have examined whether an early intervention with transcatheter aortic valve replacement (TAVR) will improve outcomes among these patients. STUDY DESIGN AND OBJECTIVES: EARLY TAVR is a prospective, randomized, controlled, and multicenter trial, with an event-based design. Asymptomatic severe AS patients (n = 900) are randomized 1:1 to either clinical surveillance or TAVR with the Edwards SAPIEN 3/SAPIEN 3 Ultra transcatheter heart valve. Patients are stratified by whether they are able to perform a treadmill stress test. The primary end point is death, stroke, or unplanned cardiovascular hospitalization. Patients who are asymptomatic but have a positive stress test will be followed in a registry and undergo aortic valve replacement as per current guidelines. CONCLUSIONS: EARLY TAVR is the largest randomized trial to date assessing the role of early intervention among patients with asymptomatic severe AS compared to clinical surveillance and the first to study the role of TAVR. TRIAL REGISTRATION NUMBER: NCT03042104.

Cardiac Damage and Quality of Life After Aortic Valve Replacement in the PARTNER Trials.

BACKGROUND: The extent of extravalvular cardiac damage is associated with increased risk of adverse events among patients with severe aortic stenosis undergoing aortic valve replacement (AVR). OBJECTIVES: The goal was to describe the association of cardiac damage on health status before and after AVR. METHODS: Patients from the PARTNER (Placement of Aortic Transcatheter Valves) 2 and 3 trials were pooled and classified by echocardiographic cardiac damage stage at baseline and 1 year as previously described (stage 0-4). We examined the association between baseline cardiac damage and 1-year health status (assessed by the Kansas City Cardiomyopathy Questionnaire Overall Score [KCCQ-OS]). RESULTS: Among 1,974 patients (794 surgical AVR, 1,180 transcatheter AVR), the extent of cardiac damage at baseline was associated with lower KCCQ scores both at baseline and at 1 year after AVR (P < 0.0001) and with increased rates of a poor outcome (death, KCCQ-OS <60, or a decrease in KCCQ-OS of ≥10 points) at 1 year (stages 0-4: 10.6% vs 19.6% vs 29.0% vs 44.7% vs 39.8%; P < 0.0001). In a multivariable model, each 1-stage increase in baseline cardiac damage was associated with a 24% increase in the odds of a poor outcome (95% CI: 9%-41%; P = 0.001). Change in stage of cardiac damage at 1 year after AVR was associated with the extent of improvement in KCCQ-OS over the same period (mean change in 1-year KCCQ-OS: improvement of ≥1 stage +26.8 [95% CI: 24.2-29.4] vs no change +21.4 [95% CI: 20.0-22.7] vs deterioration of ≥1 stage +17.5 [95% CI: 15.4-19.5]; P < 0.0001). CONCLUSIONS: The extent of cardiac damage before AVR has an important impact on health status outcomes, both cross-sectionally and after AVR. (PARTNER II Trial: Placement of AoRTic TraNscathetER Valves II - XT Intermediate and High Risk (PII A), NCT01314313; The PARTNER II Trial: Placement of AoRTic TraNscathetER Valves - PII B [PARTNERII B], NCT02184442; PARTNER 3 Trial: Safety and Effectiveness of the SAPIEN 3 Transcatheter Heart Valve in Low Risk Patients With Aortic Stenosis [P3], NCT02675114).

Congenital Pulmonic Valve Dysfunction Treated With SAPIEN 3 Transcatheter Heart Valve (from the COMPASSION S3 Trial).

Significant pulmonary regurgitation (PR) and pulmonary stenosis are common after surgical repair of some congenital heart defects. This prospective, single-arm, multicenter trial enrolled patients who underwent transcatheter heart valve (THV) implantation with a SAPIEN 3 valve to treat dysfunctional right ventricular outflow tract (RVOT) conduits or pulmonic surgical valves (≥ moderate PR and/or mean RVOT gradient ≥35 mm Hg). The primary end point was a nonhierarchical composite of THV dysfunction at 1 year comprising RVOT reintervention, ≥ moderate total PR, and mean RVOT gradient >40 mm Hg. A performance goal of <25% of upper confidence interval (CI) was prespecified for the primary end point, using a 95% exact binomial CI. Patients (n = 58) were enrolled between July 5, 2016 and July 17, 2018, with mean age of 32 years. Prestenting was performed in 53.4%. At discharge, the device success was 98.1% (single valve without explant, < moderate PR, gradient <35 mm Hg). At 30 days, there were no major adjudicated adverse clinical events. At 1 year, the primary end point composite was 4.3% (95% CI 0.5 to 14.5). The composite components were 0% (0 of 56) RVOT reintervention, 2.1% (1 of 47) ≥ moderate PR, and 2.1% (1 of 48) mean RVOT gradient >40 mm Hg. No mortality, endocarditis, thrombosis, or stent fracture were reported at 1 year. In conclusion, the SAPIEN 3 THV was safe and effective in patients with dysfunctional RVOT conduits or previously implanted valves in the pulmonic position to 1 year. Clinical trial registration: NCT02744677; https://clinicaltrials.gov/ct2/show/NCT02744677.

Clinical and Echocardiographic Characteristics of Flow-Based Classification Following Balloon-Expandable Transcatheter Heart Valve in PARTNER Trials.

BACKGROUND: Current expected normal echocardiographic measures of transcatheter heart valve (THV) function were derived from pooled cohorts of the randomized trials; however, THV function by flow state before or following transcatheter aortic valve replacement (TAVR) has not been previously reported. OBJECTIVES: This study sought to assess the expected normal echocardiographic hemodynamics for the balloon-expandable THV grouped by stroke volume index (SVI). METHODS: Patients with severe aortic stenosis enrolled in PARTNER (Placement of Aortic Transcatheter Valves) 1 (high/extreme surgical risk), PARTNER 2 (intermediate surgical risk), or PARTNER 3 (low surgical risk) trials with complete core laboratory echocardiography were included. Patients were grouped by low-flow (SVILOW <35 mL/m2) and normal-flow (SVINORMAL ≥35 mL/m2). Mean gradient, effective orifice area (EOA), and Doppler velocity index (DVI) were collected at baseline and at 30 days post-TAVR. Prosthesis-patient mismatch (PPM) was both calculated and predicted from normative data, using defined criteria. RESULTS: In the entire population (N = 4,991), mean age was 81.8 years, 58% of patients were male, and 42% had low flow. Compared with patients with baseline SVINORMAL, those with SVILOW were more likely to be male; have more comorbidities; and lower left ventricular ejection fraction, mean gradient, and EOA. Post-TAVR, SVILOW increased to SVINORMAL in 17.3% and SVINORMAL decreased to SVILOW in 12.3% of patients. Using baseline SVI, follow-up EOA, mean gradient, and DVI for patients with SVILOW tended to be lower than for patients with SVINORMAL. Using the post-TAVR SVI, follow-up EOA, mean gradient, and DVI were significantly lower for patients with SVILOW than for those with SVINORMAL (P < 0.001 for all). The incidence of calculated, but not predicted, severe PPM was higher in patients with low flow than it was in patients with normal flow, suggesting pseudo-PPM in the presence of low flow. CONCLUSIONS: This study demonstrates that flow affects THV hemodynamics and both baseline and follow-up SVI should be considered when predicting THV hemodynamics prior to TAVR, as well as assessing valve function following valve implantation.

Coronary calcium density in relation to coronary heart disease and cardiovascular disease in adults with diabetes or metabolic syndrome: the Multi-ethnic Study of Atherosclerosis (MESA).

BACKGROUND: Coronary artery calcium (CAC) density is inversely associated with coronary heart disease (CHD) and cardiovascular disease (CVD) risk. We examined this relation in those with diabetes mellitus (DM) or metabolic syndrome (MetS). METHODS: We studied 3,818 participants with non-zero CAC scores from the Multiethnic Study of Atherosclerosis and classified them as DM, MetS (without DM) or neither DM/MetS. Risk factor-adjusted CAC density was calculated and examined in relation to incident CHD and CVD events over a median follow-up of 15 years among these three disease groups. RESULTS: Adjusted CAC density was 2.54, 2.61 and 2.69 among those with DM, MetS or neither DM/MetS. Hazard ratios (HRs) for CHD per 1 SD increase of CAC density was 0.91 (95% CI: 0.72-1.16), 0.70 (95% CI: 0.56-0.87) and 0.79 (95% CI: 0.66-0.95) for those with DM, MetS or neither DM/MetS groups and were 0.77 (95% CI: 0.64-0.94), 0.83 (95% CI: 0.70-0.99) and 0.82 (95% CI: 0.71-0.95) for CVD, respectively. Adjustment for CAC density increased the HRs of CAC volume for CHD/CVD events. Compared to prediction models with or without single CAC measures, c-statistics of models with CAC volume and density were the highest ranging 0.67-0.72. CONCLUSION: CAC density is lower among patients with DM or MetS than those with neither DM/MetS and is inversely associated with future CHD/CVD risk among them. Including CAC density in risk assessment among those with MetS may improve prediction of CHD and CVD.

Evolution and Prognostic Impact of Cardiac Damage After Aortic Valve Replacement.

BACKGROUND: The impact of aortic valve replacement (AVR) on progression/regression of extravalvular cardiac damage and its association with subsequent prognosis is unknown. OBJECTIVES: The purpose of this study was to describe the evolution of cardiac damage post-AVR and its association with outcomes. METHODS: Patients undergoing transcatheter or surgical AVR from the PARTNER (Placement of Aortic Transcatheter Valves) 2 and 3 trials were pooled and classified by cardiac damage stage at baseline and 1 year (stage 0, no damage; stage 1, left ventricular damage; stage 2, left atrial or mitral valve damage; stage 3, pulmonary vasculature or tricuspid valve damage; and stage 4, right ventricular damage). Proportional hazards models determined association between change in cardiac damage post-AVR and 2-year outcomes. RESULTS: Among 1,974 patients, 121 (6.1%) were stage 0, 287 (14.5%) stage 1, 1,014 (51.4%) stage 2, 412 (20.9%) stage 3, and 140 (7.1%) stage 4 pre-AVR. Two-year mortality was associated with extent of cardiac damage at baseline and 1 year. Compared with baseline, cardiac damage improved in ∼15%, remained unchanged in ∼60%, and worsened in ∼25% of patients at 1 year. The 1-year change in cardiac damage stage was independently associated with mortality (adjusted HR for improvement: 0.49; no change: 1.00; worsening: 1.95; P = 0.023) and composite of death or heart failure hospitalization (adjusted HR for improvement: 0.60; no change: 1.00; worsening: 2.25; P < 0.001) at 2 years. CONCLUSIONS: In patients undergoing AVR, extent of extravalvular cardiac damage at baseline and its change at 1 year have important prognostic implications. These findings suggest that earlier detection of aortic stenosis and intervention before development of irreversible cardiac damage may improve global cardiac function and prognosis. (PARTNER II Trial: Placement of AoRTic TraNscathetER Valves II - XT Intermediate and High Risk [PII A], NCT01314313; The PARTNER II Trial: Placement of AoRTic TraNscathetER Valves - PII B [PARTNERII B], NCT02184442; and PARTNER 3 Trial: Safety and Effectiveness of the SAPIEN 3 Transcatheter Heart Valve in Low Risk Patients With Aortic Stenosis [P3], NCT02675114).

Impact of Frailty and Prefrailty on Outcomes of Transcatheter or Surgical Aortic Valve Replacement.

BACKGROUND: Randomized trials have shown short- and mid-term benefits with transcatheter versus surgical aortic valve replacement (TAVR versus SAVR) for patients at intermediate or low-risk for surgery. Frailty and prefrailty could explain some of this benefit due to an impaired ability to recover fully from a major surgical procedure. METHODS: We examined 2-year outcomes (survival and Kansas City Cardiomyopathy Questionnaire [KCCQ] scores) among patients at intermediate or low surgical risk treated with transfemoral-TAVR or SAVR within the PARTNER (Placement of Aortic Transcatheter Valves) 2A trial, SAPIEN 3 intermediate-risk registry, and PARTNER 3 trial. Frailty was examined as a continuous variable based on grip strength, gait speed, serum albumin, and activities of daily living. We tested the interaction of frailty markers by treatment (TAVR versus SAVR) in proportional hazards regression models (survival) and piecewise linear regression models (KCCQ), adjusting for patient demographic and clinical factors. RESULTS: Among the 3025 patients in the analytic cohort (2003 TAVR, 1022 SAVR; mean age 79.3 years, 61.6% men), 799 (26.4%) were nonfrail, 2041 (67.5%) were prefrail (1-2 frailty markers), and 185 (6.1%) were frail (3-4 frailty markers). Increasing frailty (none versus prefrail versus frail) was associated with higher 2-year mortality (5.5% versus 11.1% versus 22.8%; log-rank P<0.001) and worse 2-year health status among survivors (KCCQ scores adjusted for baseline: 84.8 versus 79.6 versus 77.4, P<0.001). In multivariable models, there were no significant interactions between frailty markers and treatment group for either survival (interaction P=0.39) or health status (interaction P>0.47 for all time points). CONCLUSIONS: In a cohort of older patients with severe aortic stenosis who were at low or intermediate surgical risk, increasing frailty markers were associated with worse 2-year mortality and greater health status impairment after either TAVR or SAVR, but there were no significant interactions between type of valve replacement and frailty with respect to either outcome.

Genetic variations in adiponectin levels and dietary patterns on metabolic health among children with normal weight versus obesity: the BCAMS study.

BACKGROUND/OBJECTIVES: Adiponectin represents an important link between adipose tissue dysfunction and cardiometabolic risk in obesity; however, there is a lack of data on the effects of adiponectin-related genetic variations and gene-diet interactions on metabolic disorders in children. We aimed to investigate possible interactions between adiponectin-related genetic variants and habitual dietary patterns on metabolic health among children with normal weight versus overweight/obesity, and whether these effects in childhood longitudinally contribute to metabolic risk at follow-up. SUBJECTS/METHODS: In total, 3,317 Chinese children aged 6-18 at baseline and 339 participants at 10-year follow-up from the Beijing Child and Adolescent Metabolic Syndrome study cohort were included. Baseline lifestyle factors, plasma adiponectin levels, and six adiponectin-related genetic variants resulting from GWAS in East Asians (loci in/near ADIPOQ, CDH13, WDR11FGF, CMIP, and PEPD) were assessed for their associations with the metabolic disorders. Being metabolically unhealthy was defined by exhibiting any metabolic syndrome component. RESULTS: Among the six loci, ADIPOQ rs6773957 (OR 1.26, 95% CI:1.07-1.47, P = 0.004) and adiponectin receptor CDH13 rs4783244 (0.82, 0.69-0.96, P = 0.017) were correlated with metabolic risks independent of lifestyle factors in normal-weight children, but the associations were less obvious in those with overweight/obesity. A significant interaction between rs6773957 and diet (Pinteraction = 0.004) for metabolic health was observed in normal-weight children. The adiponectin-decreasing allele of rs6773957 was associated with greater metabolic risks in individuals with unfavorable diet patterns (P < 0.001), but not in those with healthy patterns (P > 0.1). A similar interaction effect was observed using longitudinal data (Pinteraction = 0.029). CONCLUSIONS: These findings highlight a novel gene-diet interaction on the susceptibility to cardiometabolic disorders, which has a long-term impact from childhood onward, particularly in those with normal weight. Personalized dietary advice in these individuals may be recommended as an early possible therapeutic measure to improve metabolic health.

Identification and Predictors for Cardiovascular Disease Risk Equivalents among Adults With Diabetes Mellitus.

OBJECTIVE: We examined diabetes mellitus (DM) as a cardiovascular disease (CVD) risk equivalent based on diabetes severity and other CVD risk factors. RESEARCH DESIGN AND METHODS: We pooled 4 US cohorts (ARIC, JHS, MESA, FHS-Offspring) and classified subjects by baseline DM/CVD. CVD risks between DM+/CVD- vs. DM-/CVD+ were examined by diabetes severity and in subgroups of other CVD risk factors. We developed an algorithm to identify subjects with CVD risk equivalent diabetes by comparing the relative CVD risk of being DM+/CVD- vs. DM-/CVD+. RESULTS: The pooled cohort included 27,730 subjects (mean age of 58.5 years, 44.6% male). CVD rates per 1000 person-years were 16.5, 33.4, 43.2 and 71.4 among those with DM-/CVD-, DM+/CVD-, DM-/CVD+ and DM+/CVD+, respectively. Compared with those with DM-/CVD+, CVD risks were similar or higher for those with HbA1c ≥ 7%, diabetes duration ≥10 years, or diabetes medication use while those with less severe diabetes had lower risks. Hazard ratios (95%CI) for DM+/CVD- vs. DM-/CVD+ were 0.96(0.86-1.07), 0.97(0.88-1.07), 0.96(0.82-1.13), 1.18(0.98-1.41), 0.93(0.85-1.02) and 1.00(0.89-1.13) among women, white race, age <55 years, triglycerides ≥2.26 mmol/L, hs-CRP ≥ 2 mg/L and eGFR<60 mL/min/1.73m2, respectively. In DM+/CVD- group, 19.1% had CVD risk equivalent diabetes with a lower risk score but a higher observed CVD risk. CONCLUSION: Diabetes is a CVD risk equivalent in one-fifth of CVD-free adults living with diabetes. High HbA1c, long diabetes duration, and diabetes medication use were predictors of CVD risk equivalence. Diabetes is a CVD risk equivalent for women, white people, those of younger age, with higher triglycerides or CRP, or reduced kidney function.

Relation of First and Total Recurrent Atherosclerotic Cardiovascular Disease Events to Increased Lipoprotein(a) Levels Among Statin Treated Adults With Cardiovascular Disease.

The relation between elevated lipoprotein(a) and total atherosclerotic cardiovascular disease (ASCVD) residual risk in persons with known cardiovascular disease on statin therapy is not well-established. We examined first and total recurrent ASCVD event risk in statin-treated adults with prior ASCVD. We studied 3,359 adults (mean age 63.6 years, 85.1% male) with prior ASCVD on statin therapy from the AIM-HIGH clinical trial cohort. The first and total ASCVD event rates were calculated by lipoprotein(a) [Lp(a)] categories. Cox regression and Prentice, Williams and Peterson (PWP) models provided hazard ratios (HRs) for ASCVD events over a mean follow-up of 3.3 years, adjusted for age, gender, trial treatment, LDL-C, and other risk factors. A total of 747 events occurred during follow-up, among which 544 were first events. First and total ASCVD event rates were greater with higher Lp(a) levels. Compared with Lp(a)<15 mg/dL, HRs (95% CIs) for subsequent total ASCVD events among Lp(a) levels of 15-<30, 30-<50, 50-<70, and ≥70 mg/dL were 1.04 (0.82 to 1.32), 1.15 (0.88 to 1.49), 1.27 (1.00 to 1.63) and 1.51 (1.25 to 1.84). Moreover, a continuous relation for total events was observed (HR=1.08 [1.04 to 1.12] per 20 mg/dL greater Lp(a). Findings for first ASCVD events and in those with LDL-C ≥70 mg/dL versus <70 mg/dL and with and without diabetes were similar. The risk of first and total ASCVD events is increased with Lp(a) levels of ≥70 mg/dL and ≥50 mg/dL, respectively, among adults with known CVD on statin therapy.

Diabetes associated residual atherosclerotic cardiovascular risk in statin-treated patients with prior atherosclerotic cardiovascular disease.

AIM: In statin-treated persons with atherosclerotic cardiovascular disease (ASCVD) the further ASCVD risk that diabetes mellitus (DM) adds is not well-quantified. We examined this residual risk for initial and total recurrent ASCVD events. METHODS: We studied 3271 patients with ASCVD on statin therapy in the AIM-HIGH clinical trial cohort. Cox regression and the Prentice, Williams, and Peterson model examined the excess risk of initial and total recurrent ASCVD events associated with DM over a 3- year mean follow-up. Predictors of first and total ASCVD events in those with and without DM were also examined. RESULTS: Of our cohort with ASCVD on statin therapy 40% also had DM. Those with vs. without DM were older, were less likely to be male or white. They had higher systolic blood pressure, lower HDL-C, LDL-C, lipoprotein (a), but higher triglycerides and BMI (all p < 0.01). Adjusted HRs were 1.21 (95% CI; 1.01-1.46, p = 0.038) and 1.23 (95% CI: 1.05-1.44, p = 0.012) for first and total recurrent ASCVD events, respectively. Homocysteine and lipoprotein(a) most strongly predicted events in those with and without DM, respectively. CONCLUSION: In statin-treated patients with ASCVD, DM was associated with significantly greater residual risk over ASCVD alone for both first and total recurrent ASCVD events.

Five-Year Residual Atherosclerotic Cardiovascular Disease Risk Prediction Model for Statin Treated Patients With Known Cardiovascular Disease.

Despite statin therapy, many patients with atherosclerotic cardiovascular disease (ASCVD) still suffer from ASCVD events. Predictors of residual ASCVD risk are not well-delineated. We aimed to develop an ASCVD risk prediction model for patients with previous ASCVD on statin use. We utilized statin-treated patients with ASCVD from the AIM-HIGH trial cohort. A 5-year risk score for subsequent ASCVD events with known ASCVD was developed using Cox regression, including potential risk factors with age, sex, and race forced in the model. Internal discrimination and calibration were evaluated. We included 3,271 patients with ASCVD (85.4% male, mean age 63.6 years, 65% on moderate- and 24% on high-intensity statin) with complete risk factor data and mean follow-up of 4.18 years. Overall, the estimated 5-year ASCVD risk was 21.1%: 10.2% of patients had a 5-year risk of >30%, and 38.8% had risk of between 20% and 30%. In the model, male sex, hemoglobin A1c, alcohol use (inversely), family history of cardiovascular disease, homocysteine, history of carotid artery disease, and lipoprotein(a) best predicted residual ASCVD risk. Niacin treatment status did not enter the model. A C-statistic of 0.59 was obtained, with the Greenwood-Nam-D'Agostino test showing excellent calibration. We developed a risk prediction risk model for predicting 5-year residual ASCVD risk in statin-treated patients with known ASCVD that may help in identifying such persons at the highest risk of recurrent events. Validation in larger samples with patients on high-intensity statin is needed.

Development of a Risk Score for Atrial Fibrillation in Adults With Diabetes Mellitus (from the ACCORD Study).

We aimed to develop a novel risk score predicting 5-year atrial fibrillation (AF) risk for diabetes mellitus (DM) patients. We included subjects from the Action to Control Cardiovascular Risk in Diabetes study cohort without AF at baseline. Potential risk factor and demographic predictors were collected at baseline and incident AF was defined from ECG during follow-up. A 5-year risk score for incident AF was developed using Cox regression with internal validation. We studied 9,240 subjects with DM (62% male, mean age 62.6 years) of which 1.8% (n = 165) developed AF over a median follow-up of 4.9 years. Subjects developing AF were more likely male, of white ethnicity and with more obesity and poorer kidney function, but with lower diastolic blood pressure and low density-lipoprotein cholesterol. In the risk prediction model, age, gender, race, body mass index, heart failure, diastolic blood pressure, triglycerides, hemoglobin A1c, duration of DM, serum creatinine and hypertension medication were included as important predictors. The Harrell's C-statistic was 0.79 with excellent internal calibration (goodness-of-fit test p = 0.99 and calibration slope = 1.01). Our risk model may be useful for assess future AF risk in DM patients.

Impact of parental smoking on adipokine profiles and cardiometabolic risk factors in Chinese children.

BACKGROUND AND AIMS: The mechanisms by which passive smoking leads to cardiometabolic risks, and the tissues involved still require elucidation. We aimed to evaluate the association of parental smoking exposure (PSE) with the secretion of adipocyte-derived hormones and cardiometabolic risk factors in Chinese children. METHODS: We included 3150 school children aged 6-18 years from the Beijing Child and Adolescent Metabolic Syndrome (BCAMS) study. Data on PSE and potential confounders were collected. Six adipokines related to insulin resistance and metabolic syndrome (MetS) were measured. RESULTS: PSE was reported in nearly two-thirds of the children. After adjusting for covariates, including age, sex, pubertal stages, lifestyle factors, and family history, PSE was independently associated with increases of 39.2% in leptin and 3.9% in retinol binding protein-4 and decreases of 11.4% in fibroblast growth factor 21 and 4.6% in adiponectin levels (p < 0.05 for all), plus risks for central obesity (OR 1.59, 95% CI 1.33-1.90), elevated blood pressure (1.22, 1.02-1.46) and MetS (1.43, 1.11-1.85). However, the associations of PSE with hypertension and MetS were abolished when adjusted for adiposity parameters or the above-mentioned adipokine profiles. CONCLUSIONS: PSE was associated with dysregulation of adipokine levels, which might mediate the development of MetS in early life.

Insulin resistance, beta-cell function, adipokine profiles and cardiometabolic risk factors among Chinese youth with isolated impaired fasting glucose versus impaired glucose tolerance: the BCAMS study.

OBJECTIVE: Impaired fasting glucose (IFG) and impaired glucose tolerance (IGT) may convey disparate risks of metabolic consequences. Fasting plasma glucose (FPG), while an expedient screening procedure, may not adequately assess metabolic risk, particularly among youths. In order to inform a strategy for screening Chinese youth for pre-diabetes, we examined the relative value of IFG versus IGT to define metabolic risk by assessing their association with insulin resistance, beta-cell dysfunction, adverse adipokine profiles and other cardiometabolic risk factors. RESEARCH DESIGN AND METHODS: We recruited 542 subjects (age 14-28 years) from the Beijing Child and Adolescent Metabolic Syndrome study for an in-depth assessment of cardiometabolic risk factors, including a 2-hour oral glucose tolerance test, liver ultrasound and serum levels of four adipokines. RESULTS: FPG failed to identify nearly all (32/33) youths with IGT, whereas 2-hour plasma glucose (2 h PG) missed 80.8% (21/26) of subjects with IFG. Impaired beta-cell function was evident from decreased oral disposition indices in those with isolated impaired fasting glucose (iIFG) or isolated impaired glucose tolerance (iIGT) versus normal glucose tolerance (NGT) (all p<0.001), whereas reduced insulin sensitivity (Matsuda) index was most pronounced in the iIGT group (p<0.01). Moreover, alterations in adipokine levels (fibroblast growth factor 21, adiponectin and leptin/adiponectin ratio) were associated with iIGT (p<0.05) but not iIFG. Youths with iIGT had a 2-fold to 32-fold increased incidence of hypertriglyceridemia, hypertension and metabolic syndrome (MetS) compared with those with NGT. In addition, subgroup analyses of participants with normal FPG revealed that the odds of having IGT increased 3-fold to 18-fold among those with elevated TGs, hypertension, moderate-to-severe non-alcoholic fatty liver disease or MetS. CONCLUSIONS: Chinese youth with iIGT exhibit a higher cardiometabolic risk profile than those with iIFG. Thus, 2 h PG is preferred over FPG to identify the pre-diabetes phenotype at greatest risk of subsequent development of cardiovascular disease. TRIAL REGISTRATION NUMBER: NCT03421444.

Multisite atherosclerosis in subjects with metabolic syndrome and diabetes and relation to cardiovascular events: The Multi-Ethnic Study of Atherosclerosis.

BACKGROUND AND AIMS: The extent and relation of multisite atherosclerosis to cardiovascular disease (CVD) in metabolic syndrome (MetS) and diabetes (DM) are not well documented. We examined the extent of multisite atherosclerosis and its prognostic value for CVD events in MetS and DM. METHODS: In CVD-free subjects from the Multi-Ethnic Study of Atherosclerosis, multisite atherosclerosis was measured as: (1) the number of arterial beds involved (coronary calcium>0, abdominal aortic calcium>0, carotid intima-media thickness ≥1 mm and ankle brachial index<1 or ≥1.4); (2) a composite score summing the quartile rank for each atherosclerosis measure. Hazard ratios (HRs) and c-statistics were calculated for incident CVD and coronary heart disease (CHD) over 10.6 years. RESULTS: Of 1675 individuals (mean age 64 years, 51% male), 33.4% had MetS and 15.9% had DM. The number of atherosclerotic sites was higher in those with DM (mean ±â€¯SD = 1.67 ±â€¯1.15) and MetS (1.49 ±â€¯1.12) versus neither MetS/DM (1.09 ±â€¯1.09) (p < 0.0001). CVD rates per 1000 person-years ranged from 3.5, 8.2, and 10.0 in those with 0 sites positive to 35.1, 79.6 and 103.4 in those with 4 sites positive among neither DM/MetS, MetS and DM groups, respectively. HRs (95% CI) for CVD comparing those with 4 vs. 0 atherosclerotic sites were 4.0 (0.8-19.1), 4.9 (2.0-12.0), and 14.4 (3.6-57.6), respectively. C-statistics adding multisite atherosclerosis measures increased over models without the measures and with CIMT or ABI but not CAC. CONCLUSIONS: Multisite atherosclerosis is greater with MetS or DM, and predicts CVD and CHD events. Risk prediction is improved over CIMT and ABI but not CAC.

Vitamin D levels are associated with metabolic syndrome in adolescents and young adults: The BCAMS study.

BACKGROUND AND AIMS: The relationship between vitamin D deficiency and metabolic syndrome (MS) remains controversial with relatively sparse data among youth. Therefore, we attempted to explicate the association of 25-hydroxyvitamin D [25(OH)D] levels with MS in Chinese adolescents and young adults. METHODS: A cohort of 559 subjects at elevated risk of MS were recruited at 14-28 years of age as a follow-up to the Beijing Child and Adolescent Metabolic Syndrome Study. Subjects underwent clinical assessment including a 2h-oral glucose tolerance test. The concentrations of 25(OH)D, glucose, insulin and lipids were determined. MS was defined using the 2009 harmonized definition. RESULTS: The prevalence of vitamin D deficiency (< 20 ng/ml) was 78.3%. After adjusting for age, gender and season, 25(OH)D concentrations were negatively correlated with neck circumference, percent body fat, LDL cholesterol, fasting and 2h-glucose levels (all P < 0.05). 25(OH)D levels were significantly lower in participants with obesity, high triglycerides, type 2 diabetes, or MS, compared to their respective counterparts (all P < 0.05). After adjusting for potential confounders (e.g., body mass index), participants in the lowest 25(OH)D tertile were 2.5 times more likely to exhibit MS than were those in the highest tertile (Odds Ratio: 2.48; 95% CI: 1.13-5.45, P < 0.05). CONCLUSIONS: Vitamin D deficiency was very common in this young Chinese population at risk for MS. Given this association between low vitamin D levels and MS, the role of vitamin D supplementation in Chinese youths needs further examination, particular in those at risk for MS.

The Evolving Cardiovascular Disease Risk Scores for Persons with Diabetes Mellitus.

PURPOSE OF REVIEW: We briefly introduce the concept and use of cardiovascular disease (CVD) risk scores and review the methodology for CVD risk score development and validation in patients with diabetes. We also discuss CVD risk scores for diabetic patients that have been developed in different countries. RECENT FINDINGS: Patients with diabetes have a gradient of CVD risk that needs to be accurately assessed. Numerous CVD risk scores for diabetic patients have been created in various settings. The methods to develop risk scores are highly diverse and each choice has its own pros and cons. A well-constructed risk score for diabetic patients may be advocated by guidelines and adopted by healthcare providers to help determine preventive strategies. New risk factors are being investigated in order to improve the predictive accuracy of current risk scores. A suitable CVD risk score for the diabetes population should be accurate, low-cost, and beneficial to outcome. While the performance (accuracy) has all been internally validated, validation on external populations is still needed. Cost-effectiveness and clinical trials demonstrating improvement in outcomes are limited and should be the target of future research.

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.

RATIONALE: Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation. PATIENT CONCERNS: A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia. DIAGNOSES: She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome. INTERVENTIONS: The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing. OUTCOMES: A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability. LESSONS: Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.