NH3 Electrosynthesis from N2 Molecules: Progresses, Challenges, and Future Perspectives.

Green ammonia (NH3), made by using renewable electricity to split nearly limitless nitrogen (N2) molecules, is a vital platform molecule and an ideal fuel to drive the sustainable development of human society without carbon dioxide emission. The NH3 electrosynthesis field currently faces the dilemma of low yield rate and efficiency; however, decoupling the overlapping issues of this area and providing guidelines for its development directions are not trivial because it involves complex reaction process and multidisciplinary entries (for example, electrochemistry, catalysis, interfaces, processes, etc.). In this Perspective, we introduce a classification scheme for NH3 electrosynthesis based on the reaction process, namely, direct (N2 reduction reaction) and indirect electrosynthesis (Li-mediated/plasma-enabled NH3 electrosynthesis). This categorization allows us to finely decouple the complicated reaction pathways and identify the specific rate-determining steps/bottleneck issues for each synthesis approach such as N2 activation, H2 evolution side reaction, solid-electrolyte interphase engineering, plasma process, etc. We then present a detailed overview of the latest progresses on solving these core issues in terms of the whole electrochemical system covering the electrocatalysts, electrodes, electrolytes, electrolyzers, etc. Finally, we discuss the research focuses and the promising strategies for the development of NH3 electrosynthesis in the future with a multiscale perspective of atomistic mechanisms, nanoscale electrocatalysts, microscale electrodes/interfaces, and macroscale electrolyzers/processes. It is expected that this Perspective will provide the readers with an in-depth understanding of the bottleneck issues and insightful guidance on designing the efficient NH3 electrosynthesis systems.

Development and Validation of a Nomogram for the Failed Conversion of Labor Analgesia to Cesarean Section Anesthesia.

Purpose: The conversion of epidural labor analgesia (ELA) to epidural surgical anesthesia (ESA) for intrapartum cesarean section (CS) often encounters failures. This study aimed to develop a nomogram for predicting the failure rate of this conversion. Patients and Methods: A retrospective analysis was conducted on data from the Fujian Maternity and Child Health Hospital. Pregnant women (n=214) who underwent cesarean section after receiving labor analgesia. We performed correlation heat map and Lasso regression in terms of exclusion confounding factors and screening independent variables. A nomogram was developed to predict the occurrence. Results: The developed nomogram incorporated variables such as pregnant history, weight, premature rupture of membranes (PROM), dural puncture epidural (DPE), anesthesiologist level of cesarean section (ALOCS), and Anesthesiologist level of labor analgesia (ALOLA). The model demonstrated good predictive performance, providing a practical tool for assessing the risk of failure in converting labor analgesia to cesarean section anesthesia. Conclusion: The nomogram can aid anesthesiologists in making informed decisions and optimizing patient care. By utilizing the nomogram, clinicians can estimate the probability of conversion failure based on individual patient characteristics and clinical factors.

Best-corrected visual acuity results facilitate molecular diagnosis of infantile nystagmus patients harboring FRMD7 mutations.

The visual function of patients with infantile nystagmus (IN) can be significantly decreased owing to constant eye movement. While, reaching a definitive diagnosis becomes a challenge due to genetic heterozygous of this disease. To address it, we investigated whether best-corrected visual acuity (BCVA) results can facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations. 200 patients with IN from 55 families and 133 sporadic cases were enrolled. Mutations were comprehensively screened by direct sequencing using gene-specific primers for FRMD7. We also retrieved related literature to verify the results based on our data. We found that the BCVA of patients with IN harboring FRMD7 mutations was between 0.5 and 0.7, which was confirmed by data retrieved from the literature. Our results showed that BCVA results facilitate the molecular diagnosis of patients with IN harboring FRMD7 mutations. In addition, we identified 31 FRMD7 mutations from the patients, including six novel mutations, namely, frameshift mutation c.1492_1493insT (p.Y498LfsTer14), splice-site mutation c.353C > G, three missense mutations [c.208C > G (p.P70A), c.234G > A (p.M78I), and c.1109G > A (p.H370R)], and nonsense mutation c.1195G > T (p.E399Ter). This study demonstrates that BCVA results may facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations.

San Huang Xiao Yan recipe modulates the HMGB1-mediated abnormal inflammatory microenvironment and ameliorates diabetic foot by activating the AMPK/Nrf2 signalling pathway.

BACKGROUND: Diabetic foot (DF) is one of the serious complications of diabetes and lacks of therapeutic drugs. Abnormal and chronic inflammation promoting foot infection and wound healing delay are the main pathogenesis of DF. The traditional prescription San Huang Xiao Yan Recipe (SHXY) has been used in the clinical treatment of DF for several decades as approved hospital experience prescription and showed remarkable therapeutic effect, but the mechanisms by which SHXY treats DF are still unclear. PURPOSE: Objectives of this study were to investigate SHXY anti-inflammatory effect on DF and explore the molecular mechanism for SHXY. METHODS: We detected the effects of SHXY on DF in C57 mouse and SD rat DF models. Animal blood glucose, weight and wound area were detected every week. Serum inflammatory factors were detected by ELISA. H&E and Masson's trichrome were used to observe tissue pathology. Single-cell sequencing data reanalysis revealed the role of M1 macrophages in DF. Venn analysis showed the co-target genes between DF M1 macrophages and compound-disease network pharmacology. Western blotting was used to explored target protein expression. Meanwhile, RAW264.7 cells were treated with drug-containing serum of SHXY to further unravel the roles of target proteins during high glucose-induced inflammation in vitro. The Nrf2 inhibitor ML385 was used on RAW 264.7 cells to further explore the relationship between Nrf2, AMPK and HMGB1. The main components of SHXY were analysed by HPLC. Finally, the treatment effect of SHXY on DF were detected on rat DF model. RESULTS: In vivo, SHXY can ameliorate inflammatory, accelerate wound healing and upregulate expression of Nrf2, AMPK and downregulate of HMGB1. Bioinformatic analysis showed that M1 macrophages were the main inflammatory cell population in DF. Moreover, the Nrf2 downstream proteins HO-1 and HMGB1 were potential DF therapeutic targets for SHXY. In vitro, we also found that SHXY increased AMPK and Nrf2 protein levels and downregulated HMGB1 expression in RAW264.7 cells. Inhibiting the expression of Nrf2 impaired the inhibition effect of SHXY on HMGB1. SHXY promoted Nrf2 translocation into the nucleus and increased the phosphorylation of Nrf2. SHXY also inhibited HMGB1 extracelluar release under high glucose. In rat DF models, SHXY also exhibited significant anti-inflammatory effect. CONCLUSION: The SHXY activated AMPK/Nrf2 pathway to suppress abnormal inflammation on DF via inhibiting HMGB1 expression. These findings provide novel insight into the mechanisms by which SHXY treats DF.

Carbon dots with hydrogen bond-controlled aggregation behavior.

Here, hydrophilic carbon dots (H-CDs) are prepared by a facile room temperature method. The strength of hydrogen bonds can be controlled by introducing proton and aprotic solvents, respectively, so as to realize the tunable aggregation state of H-CDs. Because of the ultrasensitive response to dimethyl sulfoxide (DMSO), H-CDs can serve as optical probes for detecting DMSO in a linear range of 0.005% to 0.75% and with a detection limit of 0.001%.

Progressive abdominal pain with acute exacerbation due to retroperitoneal follicular dendritic cell sarcoma: a case report with targeted genomic sequencing analysis.

BACKGROUND: Follicular dendritic cell sarcoma (FDCS) is a rare malignancy that arises from follicular dendritic cells and typically presents as a slow-growing painless mass without specific symptoms. Here we report an unusual case of a 55-year-old female with retroperitoneal FDCS who presented with progressive abdominal pain onset and acute exacerbation. METHODS: On CTA, a middle-upper abdominal mass (58*40 mm) was shown with multiple enlarged lymph nodes. After en-bloc resection of the tumor, the patient recovered completely from her symptoms and was discharged without complication. One month later, the patient returned for follow-up and the relevant tests were completed. RESULTS: In this case, CA724 elevated significantly and seemed to be associated with tumor progression. The results of positron emission tomography/computed tomography (PET/CT) and radiological examinations, including magnetic resonance imaging (MRI) and computed tomography angiography (CTA), were discussed to improve our understanding of diagnostic tools on FDCS. Targeted genomic sequencing analysis revealed three novel gene mutations, EPHA3 (nonsense mutation), DDR2 (SNV), and BIRC3 (InDel). CONCLUSION: We reported an unusual case of retroperitoneal FDCS with acute exacerbated abdominal pain. The interpretations of CA724, PET/CT, as well as imaging results deserve further investigation in FDCS. Genomic sequencing revealed three novel gene mutations in FDCS, including EPHA3 (nonsense mutation), DDR2 (SNV), and BIRC3 (InDel).

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Recent advances in multidisciplinary therapy for adenocarcinoma of the esophagus and esophagogastric junction.

Esophageal adenocarcinoma (EAC) and adenocarcinoma of the esophagogastric junction (EGJA) have long been associated with poor prognosis. With changes in the spectrum of the disease caused by economic development and demographic changes, the incidence of EAC and EGJA continues to increase, making them worthy of more attention from clinicians. For a long time, surgery has been the mainstay treatment for EAC and EGJA. With advanced techniques, endoscopic therapy, radiotherapy, chemotherapy, and other treatment methods have been developed, providing additional treatment options for patients with EAC and EGJA. In recent decades, the emergence of multidisciplinary therapy (MDT) has enabled the comprehensive treatment of tumors and made the treatment more flexible and diversified, which is conducive to achieving standardized and individualized treatment of EAC and EGJA to obtain a better prognosis. This review discusses recent advances in EAC and EGJA treatment in the surgical-centered MDT mode in recent years.

Visible-light-driven PhSSPh-catalysed regioselective hydroborylation of α,ß-unsaturated carbonyl compounds with NHC-boranes.

A photo-induced transition-metal-free regioselective hydroborylation of α,ß-unsaturated carbonyl compounds is developed. The PhSSPh reagent was employed as the photocatalyst, and NHC-BH3 was used as the boron source. This transformation shows a broad substrate scope and provides a wide range of α-borylcarbonyl molecules in good to excellent yields.

Comparison of the efficacy and safety of sedation protocols with the use of dexmedetomidine-remifentanil and propofol-remifentanil during percutaneous closure of atrial septal defects: a randomized clinical trial.

BACKGROUND: The study was aimed to compare the efficacy and safety of different sedation protocols of dexmedetomidine-remifentanil and propofol-remifentanil for percutaneous closure of atrial septal defects (ASD) under transthoracic echocardiography (TTE) guidance. MATERIAL AND METHODS: From March 2020 to January 2021, of 114 patients screened, 59 ASD patients scheduled for percutaneous closure under TTE guidance were randomly allocated into the dexmedetomidine-remifentanil (D-R) group (n = 29) and the propofol-remifentanil (P-R) group (n = 30). The incidence of hemodynamic and respiratory adverse events, arterial blood gas analysis, induction and recovery time, pain score, infusion rate of remifentanil, satisfaction of the surgeon and patient, additional sedatives were collected for analysis and comparison. RESULTS: The induction time was longer in the D-R group than that in the P-R group (17.66 ± 2.65 min vs 11.43 ± 1.48 min; difference, 6.22 min; 95% CI 5.10 to 7.35; P < 0.001). No differences were observed in the 2 groups in terms of the additional sedatives, infusion rate of remifentanil, pain score, recovery time (P > 0.05). There was no difference between the two groups regarding the incidence of cardiovascular adverse events (6 [20.7%] vs 4 [13.3%]; difference, 7.4%; 95% CI - 11.7 to 26.5%; P = 0.506). Respiratory adverse events occurred in 1 patient (3.4%) in the D-R group, and 8 patients (26.7%) in the P-R group (difference, 23.3%; 95% CI 6.2 to 40.5%; P = 0.026). The incidence of hypercapnia was significantly lower in the D-R group (4 [13.8%]) than in the P-R group (13 [43.3%]; difference, 29.5%; 95% CI 7.8 to 51.2%; P = 0.012). CONCLUSIONS: Except for more rapid the induction time and higher the surgeon satisfaction score in the propofol-remifentanil protocol, the efficacy was similar between two sedation protocols. The hemodynamic stability was comparable, the dexmedetomidine-remifentanil protocol had superior airway security due to fewer hypercapnia and respiratory adverse events.

Vascular endothelial growth factor-A level in human breast milk after intravitreal injection of ranibizumab: a case report.

BACKGROUND: Ranibizumab is one of intravitreal anti-vascular endothelial growth factor agents. It is applied in the treatments of choroidal neovascularization, age-related macular degeneration, diabetic macular edema, and macular edema secondary to retinal vein occlusion. Preliminary evidence suggests that intravitreal ranibizumab may enter the plasma and human breast milk in very low-level concentration. As a precaution, breastfeeding is not recommended during the treatment of intravitreal injection of ranibizumab. There are limited data regarding the change of anti-vascular endothelial growth factor concentration in human breast milk after intravitreal injection of ranibizumab, especially in the first 24 h after injection. The purpose of this report is to analyse the concentration change of vascular endothelial growth factor-A in human breast milk with time, in the short term after intravitreal injection of ranibizumab. CASE PRESENTATION: In June 2018, a 30-year-old patient breastfeeding a six-month-old baby was diagnosed with choroidal neovascularization of left eye in Eye Hospital of Wenzhou Medical University. She received four administrations of 0.5 mg intravitreal injection of ranibizumab of the left eye, and breast milk was collected just before the injection, and 1-3, 6, 12, 24, 48, and 72 h after intravitreal injection, and assessed for vascular endothelial growth factor-A concentration. The change in vascular endothelial growth factor-A concentration in human breast milk showed the same trend after each injection, decreasing significantly within 6-12 h (about 20-30% lower), and increasing to pre-injection level by 24 h after injection. CONCLUSIONS: The concentration of vascular endothelial growth factor-A in human breast milk of a mother who continues lactating dropped initially and rose to pre-injection level about 24 h after intravitreal injection of ranibizumab. The data may offer more information to evaluate the impact of anti-vascular endothelial growth factor agent intravitreal injection of lactating mothers and their breastfed infants.

Mutational screening of AGRN, SLC39A5, SCO2, P4HA2, BSG, ZNF644, and CPSF1 in a Chinese cohort of 103 patients with nonsyndromic high myopia.

Purpose: High myopia (HM) is one of the leading causes of irreversible vision loss in the world. Many myopia loci have been uncovered with linkage analysis, genome-wide association studies, and sequencing analysis. Numerous pathogenic genes within these loci have been detected in a portion of HM cases. In the present study, we aimed to investigate the genetic basis of 103 patients with nonsyndromic HM, focusing on the reported causal genes. Methods: A total of 103 affected individuals with nonsyndromic HM were recruited, including 101 patients with unrelated sporadic HM and a mother and son pair. All participants underwent comprehensive ophthalmic examinations, and genomic DNA samples were extracted from the peripheral blood. Whole exome sequencing was performed on the mother and son pair as well as on the unaffected father. Sanger sequencing was used to identify mutations in the remaining 101 patients. Bioinformatics analysis was subsequently applied to verify the mutations. Results: An extremely rare mutation in AGRN (c.2627A>T, p.K876M) was identified in the mother and son pair but not in the unaffected father. Another two mutations in AGRN (c.4787C>T, p.P1596L/c.5056G>A, p.G1686S) were identified in two unrelated patients. A total of eight heterozygous variants potentially affecting the protein function were detected in eight of the remaining 99 patients, including c.1350delC, p.V451Cfs*76 and c.1023_1024insA, p.P342Tfs*41 in SLC39A5; c.244_246delAAG, p.K82del in SCO2; c.545A>G, p.Y182C in P4HA2; c.415C>T, p.P139S in BSG; c.3266A>G, p.Y1089C in ZNF644; and c.2252C>T, p.S751L and c.1708C>T, p.R570C in CPSF1. Multiple bioinformatics analyses were conducted, and a comparison to a group with geographically matched controls was performed, which supported the potential pathogenicity of these variants. Conclusions: We provide further evidence for the potential role of AGRN in HM inheritance and enlarged the current genetic spectrum of nonsyndromic HM by comprehensively screening the reported causal genes.

Mechanical stretching of pulmonary vein stimulates matrix metalloproteinase-9 and transforming growth factor-ß1 through stretch-activated channel/MAPK pathways in pulmonary hypertension due to left heart disease model rats.

Pulmonary hypertension due to left heart disease (PH-LHD) is a momentous pulmonary hypertension disease, and left heart disease is the most familiar cause. Mechanical stretching may be a crucial cause of vascular remodeling. While, the underlining mechanism of mechanical stretching-induced in remodeling of pulmonary vein in the early stage of PH-LHD has not been completely elucidated. In our study, the PH-LHD model rats were successfully constructed. After 25 days, doppler echocardiography and hemodynamic examination were performed. In addition, after treatment, the levels of matrix metalloproteinase-9 (MMP-9) and transforming growth factor-ß1 (TGF-ß1) were determined by ELISA, immunohistochemistry and western blot assays in the pulmonary veins. Moreover, the pathological change of pulmonary tissues was evaluated by H&E staining. Our results uncovered that left ventricular insufficiency and interventricular septal shift could be observed in PH-LHD model rats, and the right ventricular systolic pressure (RVSP) and mean left atrial pressure (mLAP) were also elevated in PH-LHD model rats. Meanwhile, we found that MMP-9 and TGF-ß1 could be highly expressed in PH-LHD model rats. Besides, we revealed that stretch-activated channel (SAC)/mitogen-activated protein kinases (MAPKs) signaling pathway could be involved in the upregulations of MMP-9 and TGF-ß1 mediated by mechanical stretching in pulmonary vein. Therefore, current research revealed that mechanical stretching induced the increasing expressions of MMP-9 and TGF-ß1 in pulmonary vein, which could be mediated by activation of SAC/MAPKs signaling pathway in the early stage of PH-LHD.

Network Pharmacology-Based Analysis of the Pharmacological Mechanisms of Aloperine on Cardiovascular Disease.

BACKGROUND: Aloperine is an active component of Sophora alopecuroides Linn, which has been extensively applied for the treatment of cardiovascular disease (CVD). However, our current understanding of the molecular mechanisms supporting the effects of aloperine on CVD remains unclear. METHODS: Systematic network pharmacology was conducted to provide testable hypotheses about pharmacological mechanisms of the protective effects of aloperine against CVD. Detailed structure was obtained from Traditional Chinese Medicines Integrated Database (TCMID). Target genes of aloperine against CVD were collected from SwissTargetPrediction, DrugBank database, and Online Mendelian Inheritance in Man (OMIM) database. Gene Ontology (GO) enrichment analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway performance, and network construction were adopted to explore common target genes. RESULTS: Our findings showed that 25 candidate targets were the interacting genes between aloperine and CVD. GO analysis revealed biological process, cellular component, and molecular function of these target genes. More importantly, the majority of enrichment pathways was found to be highly associated with the nitrogen metabolism by KEGG analysis. Core genes particularly in nitrogen metabolism pathway including carbonic anhydrase (CA) III, CA IV, CA VA, CA VB, CA VI, CA VII, CA IX, CA XII, and CA XIV can be modulated by aloperine in the nitrogen metabolism. CONCLUSION: Our work revealed the pharmacological and molecular mechanisms of aloperine against CVD and provided a feasible tool to identify the pharmacological mechanisms of single active ingredient of traditional Chinese medicines.

Expanding the Phenotypic and Genotypic Landscape of Nonsyndromic High Myopia: A Cross-Sectional Study in 731 Chinese Patients.

Purpose: High myopia (HM) is defined as a refractive error worse than -6.00 diopter (D). This study aims to update the phenotypic and genotypic landscape of nonsyndromic HM and to establish a biological link between the phenotypic traits and genetic deficiencies. Methods: A cross-sectional study involving 731 participants varying in refractive error, axial length (AL), age, myopic retinopathy, and visual impairment. The phenotypic traits were analyzed by four ophthalmologists while mutational screening was performed in eight autosomal causative genes. Finally, we assessed the clinical relevance of identified mutations under the guidance of the American College of Medical Genetics and Genomics. Results: The relationship between refractive error and AL varied in four different age groups ranging from 3- to 85-years old. In adult groups older than 21 years, 1-mm increase in AL conferred 10.84% higher risk of pathologic retinopathy (Category ≥2) as well as 7.35% higher risk of low vision (best-corrected visual acuities <0.3) with P values < 0.001. The prevalence rates of pathologic retinopathy and low vision both showed a nonlinear positive correlation with age. Forty-five patients were confirmed to harbor pathogenic mutations, including 20 novel mutations. These mutations enriched the mutational pool of nonsyndromic HM to 1.5 times its previous size and enabled a statistically significant analysis of the genotype-phenotype correlation. Finally, SLC39A5, CCDC111, BSG, and P4HA2 were more relevant to eye elongation, while ZNF644, SCO2, and LEPREL1 appeared more relevant to refracting media. Conclusions: Our findings shed light on how multiple HM-related phenotypes are associated with each other and their link with gene variants.

Mutation of IPO13 causes recessive ocular coloboma, microphthalmia, and cataract.

Ocular coloboma is a developmental structural defect of the eye that often occurs as complex ocular anomalies. However, its genetic etiology remains largely unexplored. Here we report the identification of mutation (c.331C>T, p.R111C) in the IPO13 gene in a consanguineous family with ocular coloboma, microphthalmia, and cataract by a combination of whole-exome sequencing and homozygosity mapping. IPO13 encodes an importin-B family protein and has been proven to be associated with the pathogenesis of coloboma and microphthalmia. We found that Ipo13 was expressed in the cornea, sclera, lens, and retina in mice. Additionally, the mRNA expression level of Ipo13 decreased significantly in the patient compared with its expression in a healthy individual. Morpholino-oligonucleotide-induced knockdown of ipo13 in zebrafish caused dose-dependent microphthalmia and coloboma, which is highly similar to the ocular phenotypes in the patient. Moreover, both visual motor response and optokinetic response were impaired severely. Notably, these ocular phenotypes in ipo13-deficient zebrafish could be rescued remarkably by full-length ipo13 mRNA, suggesting that the phenotypes observed in zebrafish were due to insufficient ipo13 function. Altogether, our findings demonstrate, for the first time, a new role of IPO13 in eye morphogenesis and that loss of function of IPO13 could lead to ocular coloboma, microphthalmia, and cataract in humans and zebrafish.

Novel mutations in PDE6B causing human retinitis pigmentosa.

AIM: To identify the genetic defects of a Chinese patient with sporadic retinitis pigmentosa (RP). METHODS: Ophthalmologic examinations were performed on the sporadic RP patient, 144 genes associated with retinal diseases were scanned with capture next generation sequencing (CNGS) approach. Two heterozygous mutations in PDE6B were confirmed in the pedigree by Sanger sequencing subsequently. The carrier frequency of PDE6B mutations of reported PDE6B mutations based on the available two public exome databases (1000 Genomes Project and ESP6500 Genomes Project) and one in-house exome database was investigated. RESULTS: We identified compound heterozygosity of two novel nonsense mutations c.1133G>A (p.W378X) and c.2395C>T (p.R799X) in PDE6B, one reported causative gene for RP. Neither of the two mutations in our study was presented in three exome databases. Two mutations (p.R74C and p.T604I) in PDE6B have relatively high frequencies in the ESP6500 and in-house databases, respectively, while no common dominant mutation in each of the database or across all databases. CONCLUSION: We demonstrates that compound heterozygosity of two novel nonsense mutations in PDE6B could lead to RP. These results collectively point to enormous potential of next-generation sequencing in determining the genetic etiology of RP and how various mutations in PDE6B contribute to the genetic heterogeneity of RP.

Three-dimensional plasmonic stereoscopic prints in full colour.

Metal nanostructures can be designed to scatter different colours depending on the polarization of the incident light. Such spectral control is attractive for applications such as high-density optical storage, but challenges remain in creating microprints with a single-layer architecture that simultaneously enables full-spectral and polarization control of the scattered light. Here we demonstrate independently tunable biaxial colour pixels composed of isolated nanoellipses or nanosquare dimers that can exhibit a full range of colours in reflection mode with linear polarization dependence. Effective polarization-sensitive full-colour prints are realized. With this, we encoded two colour images within the same area and further use this to achieve depth perception by realizing three-dimensional stereoscopic colour microprint. Coupled with the low cost and durability of aluminium as the functional material in our pixel design, such polarization-sensitive encoding can realize a wide spectrum of applications in colour displays, data storage and anti-counterfeiting technologies.

The E3 ubiquitin ligase SIAH2 is a prosurvival factor overexpressed in oral cancer.

BACKGROUND: This study aimed at investigating the expression and functional significance of seven in absentia homologues 2 (SIAH2), an E3 ubiquitin ligase, in oral squamous cell carcinoma (OSCC). MATERIALS AND METHODS: Comparative genomic hybridization and real-time PCR were performed to examine the amplification of SIAH2 gene in clinical specimens of OSCC tissues. Expression of SIAH2 mRNA and protein was examined by quantitative reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemical assays, respectively. Apoptosis was examined by annexing V staining and Poly (ADP-ribose) polymerase (PARP) cleavage, with or without sienna-mediated SIAH2 knockdown. The expression of p53 was analyzed by immunoblotting. RESULTS: Levels of SIAH2 DNA and mRNA were significantly greater in clinical OSCC specimens and in cultured OSCC cells, which also stained positively for the SAIH2 protein. Knockdown of SIAH2 led to growth suppression and apoptosis induction in a p53-independent mechanism. CONCLUSION: These results revealed a tight correlation of SIAH2 overexpression with OSCC and suggest an oncogenic role of SIAH2 in oral cancer.