Integrated analysis of multiple microarray studies to establish differential diagnostic models of Crohn's disease and ulcerative colitis based on a metalloproteinase-associated module.

Background: The ulcerative colitis (UC) and Crohn's disease (CD) subtypes of inflammatory bowel disease (IBD) are autoimmune diseases influenced by multiple complex factors. The clinical treatment strategies for UC and CD often differ, indicating the importance of improving their discrimination. Methods: Two methods, robust rank aggregation (RRA) analysis and merging and intersection, were applied to integrate data from multiple IBD cohorts, and the identified differentially expressed genes (DEGs) were used to establish a protein-protein interaction (PPI) network. Molecular complex detection (MCODE) was used to identify important gene sets. Two differential diagnostic models to distinguish CD and UC were established via a least absolute shrinkage and selection operator (LASSO) logistic regression, and model evaluation was performed in both the training and testing groups, including receiver operating characteristic (ROC) curves, calibration plots and decision curve analysis (DCA). The potential value of MMP-associated genes was further verified using different IBD cohorts and clinical samples. Results: Four datasets (GSE75214, GSE10616, GSE36807, and GSE9686) were included in the analysis. Both data integration methods indicated that the activation of the MMP-associated module was significantly elevated in UC. Two LASSO models based on continuous variable (Model_1) and binary variable (Model_2) MMP-associated genes were established to discriminate CD and UC. The results showed that Model_1 exhibited good discrimination in the training and testing groups. The calibration analysis and DCA showed that Model_1 exhibited good performance in the training group but failed in the testing group. Model_2 exhibited good discrimination, calibration and DCA results in the training and testing groups and exhibited greater diagnostic value. The effects of Model_1 and Model_2 were further verified in a new IBD cohort of GSE179285. The MMP genes exhibited high value as biomarkers for the discrimination of IBD patients using published cohort and immunohistochemistry (IHC) staining data. The MMP-associated gene levels were statistically significantly positively correlated with the levels of the differentially expressed cell types, indicating their potential value in differential diagnosis. The single-cell analysis confirmed that the expression of ANXA1 in UC was higher than that in CD. Conclusion: MMP-associated modules are the main differential gene sets between CD and UC. The established Model_2 overcomes batch differences and has good clinical applicability. Subsequent in-depth research investigating how MMPs are involved in the development of different IBD subtypes is necessary.

Recent Progress on Therapeutic Vaccines for Breast Cancer.

Breast cancer remains the most frequently diagnosed malignancy worldwide. Advanced breast cancer is still an incurable disease mainly because of its heterogeneity and limited immunogenicity. The great success of cancer immunotherapy is paving the way for a new era in cancer treatment, and therapeutic cancer vaccination is an area of interest. Vaccine targets include tumor-associated antigens and tumor-specific antigens. Immune responses differ in different vaccine delivery platforms. Next-generation sequencing technologies and computational analysis have recently made personalized vaccination possible. However, only a few cases benefiting from neoantigen-based treatment have been reported in breast cancer, and more attention has been given to overexpressed antigen-based treatment, especially human epidermal growth factor 2-derived peptide vaccines. Here, we discuss recent advancements in therapeutic vaccines for breast cancer and highlight near-term opportunities for moving forward.

Methylene blue photochemical treatment as a reliable SARS-CoV-2 plasma virus inactivation method for blood safety and convalescent plasma therapy for COVID-19.

BACKGROUND: In 2020, a new coronavirus, SARS-CoV-2, quickly spread worldwide within a few months. Although coronaviruses typically infect the upper or lower respiratory tract, the virus RNA can be detected in plasma. The risk of transmitting coronavirus via transfusion of blood products remains. As more asymptomatic infections are identified in COVID-19 cases, blood safety has become particularly important. Methylene blue (MB) photochemical technology has been proven to inactivate lipid-enveloped viruses with high efficiency and safety. The present study aimed to investigate the SARS-CoV-2 inactivation effects of MB in plasma. METHODS: The SARS-CoV-2 virus strain was isolated from Zhejiang University. The live virus was harvested from cultured VERO-E6 cells, and mixed with MB in plasma. The MB final concentrations were 0, 1, 2, and 4 µM. The "BX-1 AIDS treatment instrument" was used at room temperature, the illumination adjusted to 55,000 ± 0.5 million Lux, and the plasma was irradiated for 0, 2, 5, 10, 20, and 40 mins using light at a single wavelength of 630 nm. Virus load changes were measured using quantitative reverse transcription- PCR. RESULTS: BX-1 could effectively eliminate SARS-CoV-2 within 2 mins in plasma, and the virus titer declined to 4.5 log10 TCID50 (median tissue culture infectious dose)/mL. CONCLUSION: BX-1 is based on MB photochemical technology, which was designed to inactivate HIV-1 virus in plasma. It was proven to be safe and reliable in clinical trials of HIV treatment. In this study, we showed that BX-1 could also be applied to inactivate SARS-CoV-2. During the current outbreak, this technique it has great potential for ensuring the safety of blood transfusions, for plasma transfusion therapy in recovering patients, and for preparing inactivated vaccines.

The Active Components of Sunflower (Helianthus annuus L.) Calathide and the Effects on Urate Nephropathy Based on COX-2/PGE2 Signaling Pathway and the Urate Transporter URAT1, ABCG2, and GLUT9.

The sunflower (Helianthus annuus L.) calathide is gradually used as an alternative treatment for hyperuricemia; nevertheless, evidence regarding its main components and therapeutic capacity for urate nephropathy is lacking. Identification of sunflower calathide aqueous extract (SCE) was rapidly done by UPLC-ESI-Q-Orbitrap, and 32 water-soluble compounds with a comprehensive score >80 were discovered. Besides, yeast extract was administrated to induce high UA levels and hyperuricemic renal injury. We found that SCE treatment not only decreased UA levels to a comparable degree as allopurinol and benzbromarone, but also reduced the BUN levels and participated in kidney injury repair induced by uric acid. Moreover, it regulated the expression of URAT1 and ABCG2, especially inhibiting the GLUT9 in the normal kidney. Results were multifacetedly evaluated with a view to suggesting a possible mechanism of action as compared with those of allopurinol and benzbromarone by western blotting, H&E staining, and immunohistochemistry. However, the H&E staining showed histological changes in model, benzbromarone, and allopurinol groups rather than SCE treatments, and at the same time, the uric acid was identified as a cause of renal damage. The antiinflammatory effects and the regulations of COX-2/PGE2 signaling pathway were revealed on the LPS-induced RAW264.7 cells, indicating that the SCE not only increased cellular proliferation but also downregulated the COX-2, PGE2, NO, and IFN-γ cytokines in the RAW264.7 cells. To conclude, the SCE acts on urate transporters and contributes to prevent urate nephropathy via alleviating inflammatory process involving COX-2/PGE2 signaling pathway. It is available to develop SCE as food supplemental applications for hyperuricemia and nephritic inflammation.

Transcriptional regulation of galF by RcsAB affects capsular polysaccharide formation in Klebsiella pneumoniae NTUH-K2044.

RcsAB is an atypical two-component regulatory system that can regulate exopolysaccharide biosynthesis and is involved in the virulence of K. pneumoniae. The gene galF is well known as a gene involved in the biosynthesis of capsular polysaccharide (CPS). The specific DNA identification sequence for transcriptional regulation of RcsAB was found to be present in the promoter region of galF. This study aimed to detect the function of RcsAB in virulence and in biofilm and CPS formation. In addition, the transcriptional regulation of the galF gene in K. pneumoniae was studied. To determine the function of rcsAB gene, the wild-type K. pneumoniae strain NTUH-K2044 and the rcsAB knockout and complemented strains were used. The results showed decreased virulence, biofilm formation, and CPS levels in the rcsAB knockout strain. Complementation of the knockout by introducing an rcsAB fragment on an expression plasmid partially restored the virulence, biofilm, and CPS functions of the knockout strain. It indicated that the rcsAB genes might affect CPS formation and virulence of K. pneumonia. RT-qPCR, EMSA and DNase I footprinting assays were conducted to identify the transcriptional regulation of galF by RcsAB. RcsAB was seen to bind to the galF promoter-proximal region, and the binding site was further identified to be located from -177 bp to -152 bp upstream of the galF promoter. In conclusion, RcsAB could regulate the transcription of the galF gene positively by binding to the galF promoter DNA directly, and then affects the CPS formation of K. pneumonia.

Genome-wide identification of genes regulated by RcsA, RcsB, and RcsAB phosphorelay regulators in Klebsiella pneumoniae NTUH-K2044.

Rcs phosphorelay system is a two-component signal transduction system, which can regulate the transcription of capsule polysaccharide and biofilm related genes in Enterobacteriaceae. In this study, microarray technology was used to investigate the overall genes regulated by RcsA, RcsB, and RcsAB and the regulation mechanism in Klebsiella pneumoniae, then COG analysis was performed to explore the functions of the differentially expressed genes. According to the microarray data result, a total of 45, 223 and 217 genes regulated by RcsA, RcsB, and RcsAB were screened. The result of COG analysis suggested that inorganic ion transport and metabolism related genes have a majority in RcsA regulating genes. Most of RcsB regulated genes were showed involved in energy production and conversion process. Besides Carbohydrate transport and metabolism genes were identified as the major components of the RcsAB regulated genes. 15 differentially expressed genes were confirmed by quantitative real-time PCR (RT-qPCR). The RT-qPCR results indicated that 13 genes consistent with microarray data. The results of this study provided important evidence for further research to investigate the influence of RcsA, RcsB, RcsAB regulators and further efforts to address the diseased caused by K.pneumoniae, such as pneumonia, bacteremia, and urinary tract infection.

The KP1_4563 gene is regulated by the cAMP receptor protein and controls type 3 fimbrial function in Klebsiella pneumoniae NTUH-K2044.

Klebsiella pneumoniae (K. pneumoniae) is an opportunistic pathogen that can adhere to host cells or extracellular matrix via type 1 and type 3 fimbriae. KP1_4563 is a gene encoding a hypothetical protein in K. pneumoniae NTUH-K2044. KP1_4563 is located between the type 1 and type 3 fimbrial gene clusters and is likely associated with fimbrial function given its putative conserved domains of unknown function (DUF1471). Cyclic AMP receptor protein (CRP) regulates virulence-related gene expression and is a crucial transcriptional regulator in many bacteria. The predicted DNA recognition motif of CRP is present in the KP1_4563 promoter region. This study aimed to investigate the function of KP1_4563 in fimbriae and its transcriptional regulation mechanism by CRP. We generated Kp-Δ4563 mutant and complementation strains. We utilized phenotype and adhesion assays to evaluate the role of KP1_4563 in fimbriae. We conducted quantitative RT-PCR (qRT-PCR), LacZ fusion, electrophoretic mobility shift, and DNase I footprinting assays to study the transcriptional regulation of KP1_4563 gene by CRP. We found that KP1_4563 negatively regulates the function of type 3 fimbriae. Compared with NTUH-K2044, the absence of KP1_4563 enhanced the ability of Kp-Δ4563 to adhere to A549 cells. CRP negatively regulates KP1_4563 by directly binding to its promoter region. KP1_4563 plays an important role in type 3 fimbrial function. This novel insight will assist in the development of strategies for preventing K. pneumoniae infection.

Risk factors of lower respiratory tract infection in patients after tracheal intubation under general anesthesia in the Chinese health care system: A meta-analysis.

BACKGROUND: Lower respiratory tract infection (LRTI) after tracheal intubation under general anesthesia poses a serious threat to worldwide health care systems, especially those in developing countries. However, a significant number of studies have found inconsistent results in their investigation of the corresponding risk factors. METHODS: Relevant articles published up to September 2015 were retrieved from PubMed, Ovid, Embase, China National Knowledge Infrastructure, Chinese Biological Medical Database, China Science and Technology Journal Database, and Wanfang Data. The z test was used to determine the significance of the pooled odds ratio (OR). ORs and 95% confidence intervals were used to compare the risk factors of LRTI after intubation under general anesthesia. RESULTS: Fifteen case-control studies that included 27,304 participants were identified. We identified the following variables as independent risk factors: duration of general anesthesia >3 hours (OR, 2.45), age >60 years (OR, 2.35), normal endotracheal tube (OR, 1.63), deep intubation (OR, 2.66), unpracticed intubation (OR, 2.61), postoperative extubation time >2 hours (OR, 3.76), smoking history (OR, 3.02), chronic respiratory disease history (OR, 2.30), incomplete extubation indication (OR, 3.54), thoracic or craniocerebral surgery (OR, 1.90), and emergent surgery (OR, 2.54). CONCLUSIONS: Eleven risk factors, including surgery, anesthesia, and health condition, were related to LRTI after intubation under general anesthesia. Given the limitations of this study, well-designed epidemiologic studies with a large sample size should be performed in the future.

Inhibition of cyclophilin A suppresses H2O2-enhanced replication of HCMV through the p38 MAPK signaling pathway.

Human cytomegalovirus (HCMV) infection can be accelerated by intracellular and extracellular hydrogen peroxide (H2O2) stimulation, mediated by the activation of the p38 mitogen-activated protein kinase (MAPK) pathway. However, it remains unknown whether host gene expression is involved in H2O2-upregulated HCMV replication. Here, we show that the expression of the host gene, cyclophilin A (CyPA), could be facilitated by treatment with H2O2 in a dose-dependent manner. Experiments with CyPA-specific siRNA, or with cyclosporine A, an inhibitor of CyPA, confirmed that H2O2-mediated upregulation of HCMV replication is specifically mediated by upregulation of CyPA expression. Furthermore, depletion or inhibition of CyPA reduced H2O2-induced p38 activation, consistent with that of H2O2-upregulated HCMV lytic replication. These results show that H2O2 is capable of activating ROS-CyPA-p38 MAPK interactions to enhance HCMV replication.

Influence of cAMP receptor protein (CRP) on bacterial virulence and transcriptional regulation of allS by CRP in Klebsiella pneumoniae.

cAMP receptor protein (CRP) is one of the most important transcriptional regulators, which can regulate large quantities of operons in different bacteria. The gene allS was well-known as allantoin-utilizing capability and involving in bacterial virulence in Klebsiella pneumoniae (K. pneumoniae). The specific DNA recognition motif of transcription regulator CRP was found in allS promoter region. Therefore, this study is aimed to investigate the function of CRP on virulence and its transcriptional regulation mechanism to gene allS in K. pneumoniae. The wild-type (WT) K. pneumoniae NTUH-2044, crp knockout (Kp-Δcrp) and the complemented knockout (KpC-Δcrp) strains were used to determine the function of crp gene. The lacZ fusion, qRT-PCR, electrophoretic mobility shift and DNase I footprinting assays were performed to study the transcriptional regulation of CRP on allS. The result showed a decreased virulence in crp knockout strain. Complement through supplementing crp fragment in expression plasmid partially restore virulence of knockout bacteria. The CRP could bind to the allS promoter-proximal region and the binding site was further refined to be located from 60bp to 94bp upstream of the allS promoter. Based on these results, we proposed that CRP is an essential virulence regulator and knock out of crp gene will result in reduced virulence in K. pneumoniae. In the meantime, the transcription of gene allS is positively regulated by CRP via directly binding to upstream of allS promoter.

A novel electrochemical immunosensor for highly sensitive detection of aflatoxin B1 in corn using single-walled carbon nanotubes/chitosan.

A sensitive electrochemical immunosensor for aflatoxin B1 (AFB1) detection based on single-walled carbon nanotubes/chitosan was presented. The immunosensor was based on an indirect competitive binding to a fixed amount of anti-AFB1 between free AFB1 and AFB1-bovine serum albumin, which conjugate immobilized on covalently functionalized nanotubes/chitosan laid on the glass carbon electrode. Then, the anti-mouse immunoglobulin G secondary antibody labeled with alkaline phosphatase was bound to the electrode surface through reacting with primary antibody. Finally, alkaline phosphatase catalyzes the hydrolysis of the substrate α-naphthyl phosphate, which produced electrochemical signal. Compared with conventional methods, the established immunosensor was more sensitive and simple. Under optimal conditions, this method could quantitatively detect AFB1 from 0.01 to 100 ng mL(-1) with a detection limit of 3.5 pg mL(-1). Moreover, the immunosensor was successfully applied to assay AFB1 in corn powder, which showed good correlation with the results obtained from high performance liquid chromatography.

Noncoding RNAs in breast cancer.

The mammalian transcriptome has recently been revealed to encompass a large number of noncoding RNAs (ncRNAs) that play a variety of important regulatory roles in gene expression and other biological processes. MicroRNAs (miRNAs), the best studied of the short noncoding RNAs (sncRNAs), have been extensively characterized with regard to their biogenesis, function and importance in tumorigenesis. Another class of sncRNAs called piwi-interacting RNAs (piRNAs) has also gained attention recently in cancer research owing to their critical role in stem cell regulation. Long noncoding RNAs (lncRNAs) of >200 nucleotides in length have recently emerged as key regulators of developmental processes, including mammary gland development. lncRNA dysregulation has also been implicated in the development of various cancers, including breast cancer. In this review, we describe and discuss the roles of sncRNAs (including miRNAs and piRNAs) and lncRNAs in the initiation and progression of breast tumorigenesis, with a focus on outlining the molecular mechanisms of oncogenic and tumor-suppressor ncRNAs. Moreover, the current and potential future applications of ncRNAs to clinical breast cancer research are also discussed, with an emphasis on ncRNA-based diagnosis, prognosis and future therapeutics.

Interferon-Inducible Transmembrane Protein 3 Genetic Variant rs12252 and Influenza Susceptibility and Severity: A Meta-Analysis.

BACKGROUND: The pandemic influenza A (H1N1) pdm09 virus, avian influenza A (H5N1) virus, and influenza A (H7N9) virus induced severe morbidity and mortality throughout the world. Previous studies suggested a close association between the interferon-induced transmembrane protein-3 (IFITM3) genetic variant rs12252 and influenza. Here, we explored the correlation between the rs12252 and influenza susceptibility and severity using meta-analysis. METHODS: Relevant studies published before May 22, 2014 were retrieved from PubMed, ISI web of knowledge, EBSCO, and Cochrane central register of controlled trials databases. Association between rs12252 and influenza susceptibility and severity were determined using statistical analysis of odds ratios (ORs). RESULTS: A total of four studies consisting of 445 cases and 4180 controls were included in our analysis. Generally, there is increased risk of influenza in subjects carrying rs12252 in the recessive model (CC vs. CT+TT: OR = 2.35, 95% CI: 1.49-3.70, P<0.001), the dominant model (CC+CT vs. TT: OR=1.60, 95% CI: 1.18-2.22, P=0.003), the homozygote comparison (CC vs. TT: OR=4.11, 95% CI: 2.15-7.84, P<0.001), and the allele contrast (C vs. T: OR=1.67, 95% CI: 1.32-2.13, P<0.001). Stratification analysis of ethnicity and severity revealed a significant increase in influenza susceptibility by IFITM3-SNP rs12252 among both Asian and Caucasian population. SNP rs12252 shows significant impact on severe infections (P<0.05), but not on mild influenza. Besides, our result also associated rs12252 with influenza severity (severe vs. mild: OR=2.37, 95% CI: 1.32-4.25, P=0.004), (severe vs. control: OR=2.70, 95% CI: 1.85-3.94, P<0.001). CONCLUSION: Our meta-analysis suggests a significant association between a minor IFITM3 allele (SNP rs12252-C) with severe influenza susceptibility, but not in mild influenza subjects, in both UK Caucasians and Han Chinese population. The rs12252-C allele causes a 23.7% higher chance of infection and also constitutes a risk factor for more severe influenza.

[Distribution of the of nosocomial infection pathogens among general hospital in China: a Meta analysis].

OBJECTIVE: To provide basic and direction for nosocomial infection prevention and control through evaluation the distribution of nosocomial infection pathogens and understand current situation of pathogens among general hospital in China. METHODS: Articles were searched and collected from CBM, CNKI,VIP database and Wanfang database published between creating database to March. 2013 about investigation of nosocomial infection. Those literatures were screened and extracted according to the inclusion and exclusion criteria by two reviewers independently. The analysis of pathogens distribution was performed by using comprehensive Meta analysis software and stratified by factor as year, hospital level and region of the study. The distribution rate of different pathogens were merged according to statistical tests for the heterogeneity test. RESULTS: The 345 trials were included. The results show 1)the pooled distribution rates of common pathogens in 1987-2000 were as follows:18.6% (95% CI:13.7%-24.9%), 18.1% (95% CI:15.4%-21.0%), 14.8% (95% CI: 12.2%-17.9%), 5.2% (95%CI:4.1%-6.6%) for Fungus, Staphylococcus, Pseudomonas, and Klebsiella respectively;the pooled rates of common pathogens in 2001-2012 were as follows:17.6% (95% CI: 16.4%-18.8%), 15.0% (95% CI:14.2%-15.8%), 13.9% (95% CI:13.1%-14.7%), 10.4% (95% CI: 9.9%-11.0%)for Fungus, Staphylococcus, Pseudomonas, and Klebsiella respectively. 2)The pooled distribution rates of pathogens in second and below grade hospital were 3.2% (95%CI:0.3%-29.9%), 4.7% (95% CI:3.4%-6.3%), 7.2% (95% CI:1.7%-26.1%)for Mycoplasma, Shigella and Alkaligenes respectively;the pooled distribution rates of pathogens in third grade hospital were 1.1% (95% CI: 0.1%-15.4%), 1.8% (95%CI:0.6%-5.1%), 4.3% (95%CI:2.3%-8.0%)for Mycoplasma, Shigella and Alkaligenes respectively. 3)The pooled rate of Mycoplasma for Yangtze River Economic Area was 14.3% (95%CI:2.0%-58.1%)and for Southwest Economic Area was 0.3% (95%CI:0.1%-1.1%). The pooled rate of Corynebacterium for Yangtze River Economic Area was 0.4% (95%CI:0.1%-1.4%)and for Southeast Economic Area was 9.5% (95% CI:2.4%-31.1%). The pooled rate of Haemophilus for Northern Economic Area was 0.5% (95%CI:0.2%-0.9%)and for Southeast Economic Area was 9.2% (95% CI:7.3%-11.6%). The pooled rate of Salmonella for Yangtze River Economic Area was 6.3% (95% CI:4.6%-8.6% ) and for Southeast Economic Area was 0.4% (95% CI:0.1%-3.0% ). CONCLUSION: The common nosocomial infection pathogens were Fungus, Staphylococcus, Pseudomonas and Escherichia among general hospitals in China. A remarkable note is that Klebsiella was increased significantly in recent years and becomes one of the most common pathogens. There were differences in the distribution rate of nosocomial infection pathogens among general hospitals between levels and regions in China.

[Infection of the mononuclear cell subpopulations in murine bone marrow with murine cytomegalovirus].

This study was aimed to explore the infection characteristics of murine mononuclear cell subpopulations in bone marrow with murine cytomegalovirus (MCMV). Subpopulations of mononuclear cells, including lin(+), lin(-), lin(-)CD117(+) and lin(-)CD117(-) cells, were infected with MCMV after being separated by MACS, and induced to differentiation by adding cytokines or inducer, then nucleic acid and proteins were detected. The results indicated that the MCMV DNA, IE transcripts and IE protein could be detected in the lin(+) cells infected with MCMV; no virus products were detected in infected lin(-) cells without adding any stimulating factors, while IE and E transcripts and proteins were detected after adding GM-CSF, rhEPO or phorbol ester in the lin(-) cells infected with MCMV. Furthermore, no IE or E gene transcripts were detected in the lin(-)CD117(+) and lin(-)CD117(-) cells, but the cell colony formation of lin(-)CD117(+) hematopoietic stem and progenitor cells was inhibited after MCMV infection and expression of CD117 antigen on cell surface of the lin(-) cells was downregulated. It is concluded that MCMV can latently infect subpopulations of mononuclear cells in the murine bone marrow. Cells which are of characteristics of primitive stem and progenitor cells are not susceptible to MCMV, but infection of these cells with MCMV can inhibit functions of cells and downregulate the expression of antigen on cells surface.

Human cytomegalovirus-encoded chemokine receptor homolog US28 stimulates the major immediate early gene promoter/enhancer via the induction of CREB.

The major immediate early (MIE) gene of cytomegalovirus plays a key role in determining the activation and replication of cytomegalovirus, which represents the most important event signaling the onset of virus-induced disease relapse. The viral-encoded chemokine receptor homolog US28 can constitutively activate many cellular transcription factors, which can bind to the promoter/enhancer of the MIE gene and activate its transcription. Using reporter gene assays in HEK293 cells, we found that US28 enhanced the transcription efficiency of MIE and other genes via cAMP response element-binding protein (CREB). Inhibition of CREB partially blocked the effect of US28, whereas forskolin enhanced this effect. There was a direct correlation between CREB and transcription of MIE gene. These data, together with the broad-spectrum effect of cellular transcription factors, suggest that US28 may be involved in the very early transcription of the host cell during virus activation.

[Human cytomegalovirus-encoded US28 stimulates the CREB related transcriptional activity].

AIM: To observe the effect of the human cytomegalovirus(HCMV)-encoded chemokine receptor homolog US28 on the human transcription factor CREB related transcriptional activity. METHODS: The US28 gene was cloned from DNA of HCMV-infected fibroblast at 72 h post infection. The amplified gene fragment was subsequently cloned into pcDNA3.1 eukaryotic expression vector. The recombinant plasmid was selected and identified by sequence analysis. US28-pcDNA3.1 was added to the Dual-Luciferase Reporter Assay System. The immunoreactive bands of phospho-CREB(p-CREB)and luminescence values were observed. RESULTS: The constructed recombinant vector was verified by PCR analysis and DNA sequencing. US28 enhanced the transcriptional efficiency of CRE driving gene via p-CREB. CONCLUSION: HCMV could enhance the transcriptional activity of CRE driving gene via p-CREB. CREB might be involved in the very early reprogramming of the host cell during virus activation.

[Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus].

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.

[The effect of methylene blue/photochemical method for virus inactivation on plasma components].

Virus inactivation of plasma can be achieved by methylene blue/photochemical method. To investigate the effect of this method on immunological properties and biochemical functions of plasma components, the virus-inactivation method was performed on single-donor plasma that was exposed to visible light (40,000 lux) at room temperature for 1 h in the presence of 1 micro mol/L methylene blue. The results showed that activities of the factor VIII, PT and APTT were decreased to a certain degree while most of other plasma proteins were not affected significantly. Human plasma components including albumin, glucose and minerals as well as plasma pH were also not affected. By using different electrophoreses and immunochemical techniques, no neoantigens were found in photodynamically treated plasma and electrophoretic mobility revealed identical patterns for untreated and treated plasma. In conclusion, methylene blue/photochemical method dose not considerably influence the properties of major of plasma components.