ABSTRACT
The World Health Organization (WHO) identifies several bunyaviruses as significant threats to global public health security. Developing effective therapies against these viruses is crucial to combat future outbreaks and mitigate their impact on patient outcomes. Here, we report the synthesis of some isoindol-1-one derivatives and explore their inhibitory properties over an indispensable metal-dependent cap-snatching endonuclease (Cap-ENDO) shared among evolutionary divergent bunyaviruses. The compounds suppressed RNA hydrolysis by Cap-ENDOs, with IC50 values predominantly in the lower µM range. Molecular docking studies revealed the interactions with metal ions to be essential for the 2,3-dihydro-6,7-dihydroxy-1H-isoindol-1-one scaffold activity. Calorimetric analysis uncovered Mn2+ ions to have the highest affinity for sites within the targets, irrespective of aminoacidic variations influencing metal cofactor preferences. Interestingly, spectrophotometric findings unveiled sole dinuclear species formation between the scaffold and Mn2+. Moreover, the complexation of two Mn2+ ions within the viral enzymes appears to be favourable, as indicated by the binding of compound 11 to TOSV Cap-ENDO (Kd = 28 ± 3 µM). Additionally, the tendency of compound 11 to stabilize His+ more than His- Cap-ENDOs suggests exploitable differences in their catalytic pockets relevant to improving specificity. Collectively, our results underscore the isoindolinone scaffold's potential as a strategic starting point for the design of pan-antibunyavirus drugs.
Subject(s)
Drug Design , Endonucleases , Molecular Docking Simulation , Endonucleases/metabolism , Endonucleases/antagonists & inhibitors , Isoindoles/chemical synthesis , Isoindoles/pharmacology , Isoindoles/chemistry , Structure-Activity Relationship , Molecular Structure , Antiviral Agents/pharmacology , Antiviral Agents/chemistry , Antiviral Agents/chemical synthesis , Enzyme Inhibitors/pharmacology , Enzyme Inhibitors/chemistry , Enzyme Inhibitors/chemical synthesis , Bunyaviridae/drug effects , Bunyaviridae/metabolism , Dose-Response Relationship, Drug , HumansABSTRACT
BACKGROUND: Severe Fever with Thrombocytopenia Syndrome (SFTS) is a tick-borne disease caused by the SFTS virus (SFTSV) which has the potential to become a pandemic and is currently a major public health concern. CASE PRESENTATION: We present the case of a 74-year-old female from an urban area of Chongqing, with leukocytopenia, thrombocytopenia, organ function, inflammatory, blood coagulation, and immune abnormalities. SFTSV infection was confirmed through molecular detection and metagenomic next-generation sequencing (mNGS) analysis, indicating a diagnosis of SFTS due to the patient's history of tick bites. The patient received symptomatic and supportive therapy, including antibiotics, antiviral treatment, and antifungal therapy, and finally discharged from the hospital on day 18. CONCLUSIONS: This study highlights the need for increased awareness, early diagnosis, and prompt treatment for tick-borne SFTS. It also provides a comprehensive understanding of the disease's characteristics, pathogenesis, detection methods, and available treatments.
Subject(s)
Phlebovirus , Severe Fever with Thrombocytopenia Syndrome , Humans , Female , Phlebovirus/genetics , Phlebovirus/isolation & purification , Severe Fever with Thrombocytopenia Syndrome/diagnosis , Severe Fever with Thrombocytopenia Syndrome/drug therapy , Aged , China , High-Throughput Nucleotide Sequencing , Tick Bites/complications , Tick-Borne Diseases/diagnosis , Tick-Borne Diseases/virology , Tick-Borne Diseases/drug therapy , Antiviral Agents/therapeutic useABSTRACT
The large Bunyavirales order includes several families of viruses with a segmented ambisense (-) RNA genome and a cytoplasmic life cycle that starts by synthesizing viral mRNA. The initiation of transcription, which is common to all members, relies on an endonuclease activity that is responsible for cap-snatching. In La Crosse virus, an orthobunyavirus, it has previously been shown that the cap-snatching endonuclease resides in the N-terminal domain of the L protein. Orthobunyaviruses are transmitted by arthropods and cause diseases in cattle. However, California encephalitis virus, La Crosse virus and Jamestown Canyon virus are North American species that can cause encephalitis in humans. No vaccines or antiviral drugs are available. In this study, three known Influenza virus endonuclease inhibitors (DPBA, L-742,001 and baloxavir) were repurposed on the La Crosse virus endonuclease. Their inhibition was evaluated by fluorescence resonance energy transfer and their mode of binding was then assessed by differential scanning fluorimetry and microscale thermophoresis. Finally, two crystallographic structures were obtained in complex with L-742,001 and baloxavir, providing access to the structural determinants of inhibition and offering key information for the further development of Bunyavirales endonuclease inhibitors.
Subject(s)
Antiviral Agents , Endonucleases , La Crosse virus , Triazines , La Crosse virus/drug effects , La Crosse virus/enzymology , Antiviral Agents/pharmacology , Antiviral Agents/chemistry , Endonucleases/antagonists & inhibitors , Endonucleases/metabolism , Endonucleases/chemistry , Dibenzothiepins , Morpholines/pharmacology , Morpholines/chemistry , Pyridones/pharmacology , Pyridones/chemistry , Enzyme Inhibitors/pharmacology , Enzyme Inhibitors/chemistry , Fluorescence Resonance Energy Transfer , Humans , Animals , Viral Proteins/antagonists & inhibitors , Viral Proteins/chemistry , Viral Proteins/metabolismABSTRACT
Portunid crabs are distributed worldwide and highly valued in aquaculture. Viral infections are the main limiting factor for the survival of these animals and, consequently, for the success of commercial-scale cultivation. However, there is still a lack of knowledge about the viruses that infect cultured portunid crabs worldwide. Herein, the genome sequence and phylogeny of Callinectes sapidus reovirus 2 (CsRV2) are described, and the discovery of a new bunyavirus in Callinectes danae cultured in southern Brazil is reported. The CsRV2 genome sequence consists of 12 dsRNA segments (20,909 nt) encode 13 proteins. The predicted RNA-dependent RNA polymerase (RdRp) shows a high level of similarity with that of Eriocheir sinensis reovirus 905, suggesting that CsRV2 belongs to the genus Cardoreovirus. The CsRV2 particles are icosahedral, measuring approximately 65 nm in diameter, and exhibit typical non-turreted reovirus morphology. High throughput sequencing data revealed the presence of an additional putative virus genome similar to bunyavirus, called Callinectes danae Portunibunyavirus 1 (CdPBV1). The CdPBV1 genome is tripartite, consisting of 6,654 nt, 3,120 nt and 1,656 nt single-stranded RNA segments that each encode a single protein. Each segment has a high identity with European shore crab virus 1, suggesting that CdPBV1 is a new representative of the family Cruliviridae. The putative spherical particles of CdPBV1 measure â¼120 nm in diameter and present a typical bunyavirus morphology. The results of the histopathological analysis suggest that these new viruses can affect the health and, consequently, the survival of C. danae in captivity. Therefore, the findings reported here should be used to improve prophylactic and pathogen control practices and contribute to the development and optimization of the production of soft-shell crabs on a commercial scale in Brazil.
Subject(s)
Brachyura , Genome, Viral , Phylogeny , Reoviridae , Animals , Brachyura/virology , Reoviridae/genetics , Reoviridae/classification , Orthobunyavirus/genetics , AquacultureABSTRACT
The Bunyavirales order includes at least fourteen families with diverse but related viruses, which are transmitted to vertebrate hosts by arthropod or rodent vectors. These viruses are responsible for an increasing number of outbreaks worldwide and represent a threat to public health. Infection in humans can be asymptomatic, or it may present with a range of conditions from a mild, febrile illness to severe hemorrhagic syndromes and/or neurological complications. There is a need to develop safe and effective vaccines, a process requiring better understanding of the adaptive immune responses involved during infection. This review highlights the most recent findings regarding T cell and antibody responses to the five Bunyavirales families with known human pathogens (Peribunyaviridae, Phenuiviridae, Hantaviridae, Nairoviridae, and Arenaviridae). Future studies that define and characterize mechanistic correlates of protection against Bunyavirales infections or disease will help inform the development of effective vaccines.
Subject(s)
Arenaviridae , RNA Viruses , Vaccines , Humans , Adaptive ImmunityABSTRACT
Determination of the infectious titer is a central requirement when working with pathogenic viruses. The plaque or focus assay is a commonly used but labor- and time-consuming approach for determining the infectious titer of orthohantavirus samples. We have developed an optimized virus quantification approach that relies on the fluorescence-based detection of the orthohantavirus nucleocapsid protein (N) in infected cells with high sensitivity. We present the use of flow cytometry but highlight fluorescence microscopy in combination with automated data analysis as an attractive alternative to increase the information retrieved from an infection experiment. Additionally, we offer open-source software equipped with a user-friendly graphical interface, eliminating the necessity for advanced programming skills.
Subject(s)
Hantavirus Infections , Humans , Flow Cytometry/methods , Workflow , SoftwareABSTRACT
Phenuiviridae nucleoprotein is the main structural and functional component of the viral cycle, protecting the viral RNA and mediating the essential replication/transcription processes. The nucleoprotein (N) binds the RNA using its globular core and polymerizes through the N-terminus, which is presented as a highly flexible arm, as demonstrated in this article. The nucleoprotein exists in an `open' or a `closed' conformation. In the case of the closed conformation the flexible N-terminal arm folds over the RNA-binding cleft, preventing RNA adsorption. In the open conformation the arm is extended in such a way that both RNA adsorption and N polymerization are possible. In this article, single-crystal X-ray diffraction and small-angle X-ray scattering were used to study the N protein of Toscana virus complexed with a single-chain camelid antibody (VHH) and it is shown that in the presence of the antibody the nucleoprotein is unable to achieve a functional assembly to form a ribonucleoprotein complex.
Subject(s)
Nucleoproteins , Sandfly fever Naples virus , Nucleoproteins/chemistry , Sandfly fever Naples virus/genetics , Sandfly fever Naples virus/metabolism , Nucleocapsid Proteins/chemistry , Models, Molecular , RNA, Viral/chemistry , RNA, Viral/metabolismABSTRACT
One-third of the nine WHO shortlisted pathogens prioritized for research and development in public health emergencies belong to the Bunyavirales order. Several Bunyavirales species carry an NSm protein that acts as a virulence factor. We predicted the structures of these NSm proteins and unexpectedly found that in two families, their cytosolic domain was inferred to have a similar fold to that of the cytosolic domain of the viral envelope-forming glycoprotein N (Gncyto) encoded on the same genome fragment. We show that although the sequence identity between the NSmcyto and the Gncyto domains is low, the conservation of the two zinc finger-forming CysCysHisCys motifs explains the predicted structural conservation. Importantly, our predictions provide a first glimpse into the long-unknown structure of NSm. Also, these predictions suggest that NSm is the result of a gene duplication event in the Bunyavirales Nairoviridae and Peribunyaviridae families and that such events may be common in the recent evolutionary history of RNA viruses.
Subject(s)
Gene Duplication , RNA Viruses , Humans , Biological Evolution , Public Health , Viral Envelope Proteins/genetics , Virulence Factors/geneticsABSTRACT
Tulasviridae is a family of ambisense RNA viruses with genomes of about 12.2 kb that have been found in fungi. The tulasvirid genome is nonsegmented and contains three open reading frames (ORFs) that encode a nucleoprotein (NP), a large (L) protein containing an RNA-directed RNA polymerase (RdRP) domain, and a protein of unknown function (X). This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Tulasviridae, which is available at ictv.global/report/tulasviridae.
Subject(s)
RNA Viruses , Viruses , Genome, Viral , Viruses/genetics , RNA Viruses/genetics , Phylogeny , Nucleoproteins/genetics , Virus ReplicationABSTRACT
The Oropouche virus (OROV) is a member of the family Peribunyaviridae (order Bunyavirales) and the cause of a dengue-like febrile illness transmitted mainly by biting midges and mosquitoes. In this study, we aimed to explore acylphloroglucinols and xanthohumol from hops (Humulus lupulus L.) as a promising alternative for antiviral therapies. The evaluation of the inhibitory potential of hops compounds on the viral cycle of OROV was performed through two complementary approaches. The first approach applies cell-based assay post-inoculation experiments to explore the inhibitory potential on the latest steps of the viral cycle, such as genome translation, replication, virion assembly, and virion release from the cells. The second part covers in silico methods evaluating the ability of those compounds to inhibit the activity of the endonuclease domain, which is essential for transcription, binding, and cleaving RNA. In conclusion, the beta acids showed strongest inhibitory potential in post-treatment assay (EC50 = 26.7 µg/mL). Xanthohumol had the highest affinity for OROV endonuclease followed by colupulone and cohumulone. This result contrasts with that observed for docking and MM/PBSA analysis, where cohumulone was found to have a higher affinity. Finally, among the three tested ligands, Lys92 and Arg33 exhibited the highest affinity with the protein.
ABSTRACT
Bunyaviruses are enveloped negative or ambisense single-stranded RNA viruses with a genome divided into several segments. The canonical view depicts each viral particle packaging one copy of each genomic segment in one polarity named the viral strand. Several opposing observations revealed nonequal ratios of the segments, uneven number of segments per virion, and even packaging of viral complementary strands. Unfortunately, these observations result from studies often addressing other questions, on distinct viral species, and not using accurate quantitative methods. Hence, what RNA segments and strands are packaged as the genome of any bunyavirus remains largely ambiguous. We addressed this issue by first investigating the virion size distribution and RNA content in populations of the tomato spotted wilt virus (TSWV) using microscopy and tomography. These revealed heterogeneity in viral particle volume and amount of RNA content, with a surprising lack of correlation between the two. Then, the ratios of all genomic segments and strands were established using RNA sequencing and qRT-PCR. Within virions, both plus and minus strands (but no mRNA) are packaged for each of the three L, M, and S segments, in reproducible nonequimolar proportions determined by those in total cell extracts. These results show that virions differ in their genomic content but together build up a highly reproducible genetic composition of the viral population. This resembles the genome formula described for multipartite viruses, with which some species of the order Bunyavirales may share some aspects of the way of life, particularly emerging properties at a supravirion scale.
Subject(s)
Orthobunyavirus , Tospovirus , Orthobunyavirus/genetics , RNA, Viral/genetics , Tospovirus/genetics , Genome, Viral/genetics , Virion/geneticsABSTRACT
The documentation of endogenous viral elements (EVEs; virus-derived genetic material integrated into the genome of a nonviral host) has offered insights into how arthropods respond to viral infection via RNA interference pathways. Small non-coding RNAs derived from EVE loci serve to direct RNAi pathways in limiting replication and infection from cognate viruses, thus benefiting the host's fitness and, potentially, vectorial capacity. Here we use informatic approaches to analyze nine available genome sequences of hard ticks (Acari: Ixodidae; Rhipicephalus sanguineus, R. microplus, R. annulatus, Ixodes ricinus, I. persulcatus, I. scapularis, Hyalomma asiaticum, Haemaphysalis longicornis, and Dermacentor silvarum) to identify endogenous viral elements and to illustrate the shared ancestry of all elements identified. Our results highlight a broad diversity of viral taxa as having given rise to 1234 identified EVEs in ticks, with Mononegavirales (specifically Rhabdoviridae) well-represented in this subset of hard ticks. Further investigation revealed extensive adintovirus integrations in several Ixodes species, the prevalence of Bunyavirales EVEs (notably not observed in mosquitoes), and the presence of several elements similar to known emerging human and veterinary pathogens. These results will inform subsequent work on current and past associations with tick species with regard to the viruses from which their "viral fossils" are derived and may serve as a reference for quality control of various tick-omics data that may suffer from misidentification of EVEs as viral genetic material.
Subject(s)
Arthropods , Ixodes , Ixodidae , RNA Viruses , Viruses , Animals , Humans , Ixodidae/geneticsABSTRACT
The family Phenuiviridae comprises viruses with 2-8 segments of negative-sense or ambisense RNA, comprising 8.1-25.1 kb in total. Virions are typically enveloped with spherical or pleomorphic morphology but can also be non-enveloped filaments. Phenuivirids infect animals including livestock and humans, birds, plants or fungi, as well as arthropods that serve as single hosts or act as biological vectors for transmission to animals or plants. Phenuivirids include important pathogens of humans, livestock, seafood and agricultural crops. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Phenuiviridae, which is available at ictv.global/report/phenuiviridae.
Subject(s)
Arthropods , RNA Viruses , Animals , Humans , RNA Viruses/genetics , Virion , RNAABSTRACT
Trichoderma genus includes soil-inhabiting fungi that provide important ecosystem services in their interaction with plants and other fungi, as well as biocontrol of fungal plant diseases. A collection of Trichoderma isolates from Sardinia has been previously characterized, but here we selected 113 isolates, representatives of the collection, and characterized their viral components. We carried out high-throughput sequencing of ribosome-depleted total RNA following a bioinformatics pipeline that detects virus-derived RNA-directed RNA polymerases (RdRps) and other conserved viral protein sequences. This pipeline detected seventeen viral RdRps with two of them corresponding to viruses already detected in other regions of the world and the remaining fifteen representing isolates of new putative virus species. Surprisingly, eight of them are from new negative-sense RNA viruses, a first in the genus Trichoderma. Among them is a cogu-like virus, closely related to plant-infecting viruses. Regarding the positive-sense viruses, we report the presence of an 'ormycovirus' belonging to a recently characterized group of bisegmented single-stranded RNA viruses with uncertain phylogenetic assignment. Finally, for the first time, we report a bisegmented member of Mononegavirales which infects fungi. The proteins encoded by the second genomic RNA of this virus were used to re-evaluate several viruses in the Penicillimonavirus and Plasmopamonavirus genera, here shown to be bisegmented and encoding a conserved polypeptide that has structural conservation with the nucleocapsid domain of rhabdoviruses.
ABSTRACT
In April 2023, following the annual International Committee on Taxonomy of Viruses (ICTV) ratification vote on newly proposed taxa, the phylum Negarnaviricota was amended and emended. The phylum was expanded by one new family, 14 new genera, and 140 new species. Two genera and 538 species were renamed. One species was moved, and four were abolished. This article presents the updated taxonomy of Negarnaviricota as now accepted by the ICTV.
Subject(s)
Negative-Sense RNA Viruses , RNA Viruses , RNA Viruses/genetics , RNA-Dependent RNA Polymerase/geneticsABSTRACT
Ticks in the family Ixodidae are important vectors of zoonoses, including Lyme disease (LD), which is caused by spirochete bacteria from the Borreliella (Borrelia) burgdorferi sensu lato complex. The blacklegged tick (Ixodes scapularis) continues to expand across Canada, creating hot spots of elevated LD risk at the leading edge of its expanding range. Current efforts to understand the risk of pathogen transmission associated with I. scapularis in Canada focus primarily on targeted screens, while natural variation in the tick microbiome remains poorly understood. Using multiomics consisting of 16S metabarcoding and ribosome-depleted, whole-shotgun RNA transcriptome sequencing, we examined the microbial communities associated with adult I. scapularis (n = 32), sampled from four tissue types (whole tick, salivary glands, midgut, and viscera) and three geographical locations within a LD hot spot near Kingston, Ontario, Canada. The communities consisted of both endosymbiotic and known or potentially pathogenic microbes, including RNA viruses, bacteria, and a Babesia sp. intracellular parasite. We show that ß-diversity is significantly higher between the bacterial communities of individual tick salivary glands and midguts than that of whole ticks. Linear discriminant analysis effect size (LEfSe) determined that the three potentially pathogenic bacteria detected by V4 16S rRNA sequencing also differed among dissected tissues only, including a Borrelia strain from the B. burgdorferi sensu lato complex, Borrelia miyamotoi, and Anaplasma phagocytophilum. Importantly, we find coinfection of I. scapularis by multiple microbes, in contrast to diagnostic protocols for LD, which typically focus on infection from a single pathogen of interest (B. burgdorferi sensu stricto). IMPORTANCE As a vector of human health concern, blacklegged ticks (Ixodes scapularis) transmit pathogens that cause tick-borne diseases (TBDs), including Lyme disease (LD). Several hot spots of elevated LD risk have emerged across Canada as I. scapularis expands its range. Focusing on a hot spot in southeastern Ontario, we used high-throughput sequencing to characterize the microbiome of whole ticks and dissected salivary glands and midguts. Compared with whole ticks, salivary glands and midguts were more diverse and associated with distinct bacterial communities that are less dominated by Rickettsia endosymbiont bacteria and are enriched for pathogenic bacteria, including a B. burgdorferi sensu lato-associated Borrelia sp., Borrelia miyamotoi, and Anaplasma phagocytophilum. We also found evidence of coinfection of I. scapularis by multiple pathogens. Overall, our study highlights the challenges and opportunities associated with the surveillance of the microbiome of I. scapularis for pathogen detection using metabarcoding and metatranscriptome approaches.
Subject(s)
Anaplasma phagocytophilum , Borrelia burgdorferi , Borrelia , Coinfection , Ixodes , Lyme Disease , Microbiota , Animals , Humans , Ixodes/genetics , Ixodes/microbiology , Ixodes/parasitology , Ontario/epidemiology , Multiomics , RNA, Ribosomal, 16S/genetics , Coinfection/epidemiology , Disease Hotspot , Borrelia/genetics , Borrelia burgdorferi/genetics , Anaplasma phagocytophilum/geneticsABSTRACT
Enveloped RNA viruses are rare among plant viruses. Fimoviridae is a newly founded family of plant viruses within the Bunyavirales order that inflicts diverse crop losses worldwide. The fig mosaic virus (FMV), the representative member of the Fimoviridae family, was shown to be a causative agent for the fig mosaic disease. Like all bunyaviruses, FMV has a segmented, negative-sense, single-stranded RNA (ssRNA) genome that is encapsulated by the viral nucleoprotein (N). Here, we present high-resolution crystal structures of FMV N in its RNA-free and RNA-bound forms, revealing a "paper fortune teller" structural transition between the two states. The tightly packed tetramer of FNV N is similar to the structures of other N proteins of different members of the Bunyavirales order. In its RNA-bound form, the tetramer reorganizes to adopt a more open state that allows the accommodation of the RNA. Despite the low sequence similarity to N proteins of animal-infecting bunyaviruses, there is a striking structural resemblance between FMV N and nucleoproteins from members of the Peribunyaviridae, an animal-infecting family of viruses. This structural homology implies that enveloped plant viruses and animal-infecting viruses might have a common ancestor from which they diverged. IMPORTANCE Most insect-born viruses circulate within the Animalia kingdom, whereas plant-infecting RNA viruses are cross-kingdom pathogens. Many plant-infecting viruses cause devastating crop damage that leads to food security endangerment. The evolutionary crossroads of interkingdom circulation and infection are poorly understood. Thus, we took the structural approach to understand the similarities and differences between interkingdom-infecting viruses and viruses that circulate within one kingdom of life. Using our structures of FMV N in its free form and in complex with a single-stranded RNA (ssRNA), we dissected the mechanism by which FMV N binds to the RNA and revealed the conformational changes associated with the binding. The resemblance of our structure to N proteins from members of the Peribunyaviridae family and their recently published ribonucleoprotein (RNP) pseudoatomic resolution assembly model suggests that the FMV genome is similarly encapsulated. Thus, our finding unveils yet another bridge by which plant- and animal-infecting viruses are interconnected.
Subject(s)
RNA Viruses , RNA , Animals , Nucleoproteins/genetics , RNA Viruses/genetics , Biological Evolution , Plants/geneticsABSTRACT
Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.
ABSTRACT
The official classification of newly discovered or long-known unassigned viruses by the International Committee on Taxonomy of Viruses (ICTV) requires the deposition of coding-complete or -near-complete virus genome sequences in GenBank to fulfill a requirement of the taxonomic proposal (TaxoProp) process. However, this requirement is fairly new; thus, genomic sequence information is fragmented or absent for many already-classified viruses. As a result, taxon-wide modern phylogenetic analyses are often challenging, if not impossible. This problem is particularly eminent among viruses with segmented genomes, such as bunyavirals, which were frequently classified solely based on single-segment sequence information. To solve this issue for one bunyaviral family, Hantaviridae, we call on the community to provide additional sequence information for incompletely sequenced classified viruses by mid-June 2023. Such sequence information may be sufficient to prevent their possible declassification during the ongoing efforts to establish a coherent, consistent, and evolution-based hantavirid taxonomy.