A Descriptive Study of Spanish and Ecuadorian Commercial Infant Cereals: Are They in Line with Current Recommendations?

Cereals are an important source of nutrients, especially used in complementary feeding. The objective of this study is to review the nutritional composition of cereal-based foods for infants from 4 months and toddlers that are offered in Spain and Ecuador, countries selected because of the opportunity to work in them, and due to their socio-economic differences (industrialized and developing countries, respectively). The number of these products was 105 cereals in Spain and 22 in Ecuador. The products were classified as gluten-free cereals, five cereals, eight cereals, multigrain cereals, and cookies. A 25 g serving was used to determine the percentage in which the samples analyzed can cover the Reference Nutrient Intake (RNI) for micronutrients in infants from 7 months and toddlers according to the European Food Safety Authority (EFSA). Nutritional information per 100 g of dry product was collected according to medium, minimum, and maximum units, and nutrient density was calculated. The age range in which these products are recommended is different in both countries. The nutritional composition presents some differences; Spanish cereals show a lower content of sodium, added sugars, hydrolyzed cereals, and maltodextrin than Ecuadorian cereals. Commercialized cereals could contribute to satisfying the nutritional needs of infants and toddlers; however, they can also be a source of non-recommended components.

The trade-off between grain weight and grain number in wheat is explained by the overlapping of the key phases determining these major yield components.

Enhancing grain yield is a primary goal in the cultivation of major staple crops, including wheat. Recent research has focused on identifying the physiological and molecular factors that influence grain weight, a critical determinant of crop yield. However, a bottleneck has arisen due to the trade-off between grain weight and grain number, whose underlying causes remain elusive. In a novel approach, a wheat expansin gene, TaExpA6, known for its expression in root tissues, was engineered to express in the grains of the spring wheat cultivar Fielder. This modification led to increases in both grain weight and yield without adversely affecting grain number. Conversely, a triple mutant line targeting the gene TaGW2, a known negative regulator of grain weight, resulted in increased grain weight but decreased grain number, potentially offsetting yield gains. This study aimed to evaluate the two aforementioned modified wheat genotypes (TaExpA6 and TaGW2) alongside their respective wild-type counterparts. Conducted in southern Chile, the study employed a Complete Randomized Block Design with four replications, under well-managed field conditions. The primary metrics assessed were grain yield, grain number, and average grain weight per spike, along with detailed measurements of grain weight and dimensions across the spike, ovary weight at pollination (Waddington's scale 10), and post-anthesis expression levels of TaExpA6 and TaGW2. Results indicated that both the TaExpA6 and the triple mutant lines achieved significantly higher average grain weights compared to their respective wild types. Notably, the TaExpA6 line did not exhibit a reduction in grain number, thereby enhancing grain yield per spike. By contrast, the triple mutant line showed a reduced grain number per spike, with no significant change in overall yield. TaExpA6 expression peaked at 10 days after anthesis (DAA), and its effect on grain weight over the WT became apparent after 15 DAA. In contrast, TaGW2 gene disruption in the triple mutant line increased ovary size at anthesis, leading to improved grain weight above the WT from the onset of grain filling. These findings suggest that the trade-off between grain weight and number could be attributed to the overlapping of the critical periods for the determination of these traits.

Arabinoxylans: A review on protocols for their recovery, functionalities and roles in food formulations.

Arabinoxylans (AXs) are compounds with high nutritional value and applicability, including prebiotics or supplementary ingredients, in food manufacturing industries. Unfortunately, the recovery of AXs may require advanced separation and integrated strategies. Here, an analysis of the emerging techniques to extract AXs from cereals and their by-products is discussed. This review covers distinct methods implemented over the last 2-3 years, identifying that the type of method, extraction source, AX physicochemical properties and pre-treatment conditions are the main factors influencing the recovery yield. Alkaline extraction is among the most used methods nowadays, mostly due to its simplicity and high recovery yield. Concurrently, recovered AXs applied in food applications is timely reviewed, such as potential bread ingredient, prebiotic and as a wall material for probiotic encapsulation, in beer and non-alcoholic beverage manufacturing, complementary ingredient in bakery products and cookies, improvers in Chinese noodles, 3D food printing and designing of nanostructures for delivery platforms.

Essential oils: An eco-friendly alternative for controlling toxigenic fungi in cereal grains.

Fungi are widely disseminated in the environment and are major food contaminants, colonizing plant tissues throughout the production chain, from preharvest to postharvest, causing diseases. As a result, grain development and seed germination are affected, reducing grain quality and nutritional value. Some fungal species can also produce mycotoxins, toxic secondary metabolites for vertebrate animals. Natural compounds, such as essential oils, have been used to control fungal diseases in cereal grains due to their antimicrobial activity that may inhibit fungal growth. These compounds have been associated with reduced mycotoxin contamination, primarily related to reducing toxin production by toxigenic fungi. However, little is known about the mechanisms of action of these compounds against mycotoxigenic fungi. In this review, we address important information on the mechanisms of action of essential oils and their antifungal and antimycotoxigenic properties, recent technological strategies for food industry applications, and the potential toxicity of essential oils.

How Do Brazilian Consumers Understand Food Groups in the Food-based Dietary Guidelines?

In the Food-based Dietary Guidelines (FBDGs), food classification is based on food groups and nutrient sources. Much research has already investigated multiple aspects of consumer understanding of the information described in these documents. However, no study has evaluated consumer understanding of all food items contained in the groups described in the FBDGs. This study aimed to assess Brazilian consumers' understanding of food classification according to food groups in the concepts of the FBDGs. Therefore, an instrument, Consumer Understanding of Food Groups (UFG), was constructed and validated to assess consumer understanding of food groups. The instrument comprised 44 items approved by experts (agreement > 80%). A total of 894 Brazilians from all regions participated in this study. The results suggest that 48.9% of the participants believe it is easier to classify food according to food groups. The classification of food groups is based on the origin of the food (animal and vegetable). Although consumers easily recognize foods according to their origin, we still identify asymmetries regarding including food items from the animal kingdom and species from the plant kingdom. This exploratory study highlights important information that can contribute to improving the FBDGs. It is essential to consider consumers' understanding and guide them regarding choices from a technical point of view.

Novel immobilization method of Lactiplantibacillus plantarum in grains for dry food products.

This study aimed to assess the potential use of grains (amaranth, millet, and quinoa) as immobilizing matrices on the metabolic activity of Lactiplantibacillus plantarum and evaluate the viability of the probiotic immobilized in millet during simulated oro-gastrointestinal digestion (OGI) and storage. Firstly, different grains, sterilization and immobilization times were assessed. Secondly, Lp. plantarum was immobilized in millet and its viability and metabolic activity were assessed during non-refrigerated long-term storage and OGI. Metabolic activity was higher with 15 min. of grain sterilization and 72 h of immobilization. Lp. plantarum in millet showed the highest count. Millet grains were able to maintain the high population (>7 log CFU/g) and the metabolic activity of Lp. plantarum during up to 150 d of storage and conferred a protective effect on entrapped probiotic cells during OGI. Millet is a promising immobilizing matrix for the addition of probiotics in dry food products.

Sustainable production of naturally colored extruded breakfast cereals from blends of broken rice and vegetable flours.

There is a growing demand for practical and healthy food products. Obtaining naturally colored breakfast cereals with the incorporation of functional ingredients is a promising alternative for consumers that are looking for healthiness. This study aimed to evaluate the feasibility of using vegetable flours, rich in pigments, to obtain naturally colored breakfast cereals through thermoplastic extrusion. Vegetables considered "unsuitable for the retail market", classified as "type B", were used to prepare different flours from carrot (CF), spinach (SF) and beetroot (BF). Extrudates were produced from a mixture of 90% broken rice (BR) and 10% vegetable flour (CF, SF or BF). Besides giving the extrudates a natural color, the use of vegetable flours also provided nutritional and functional enrichment due to increased mineral, protein, lipid, fiber and phenolic compound contents, and greater antioxidant capacity. However, some of these components, such as fibers, affect extrudate physical structure and technological characteristics, evidenced by reduced expansion, hardness, paste viscosity and greater interaction with water present in milk under consumption conditions. In general, the evaluated flours proved to be an alternative for imparting a natural color to extruded breakfast cereals, in addition to positively contributing to their nutritional and functional value.

Residuos de glifosato en cereales de desayuno de origen internacional y nacional comercializados en Saltillo, Coahuila / Glyphosate residues in breakfast cereals of national and international origin marketed in Saltillo, Coahuila

Resumen Objetivo: Detectar y cuantificar residuos de glifosato en cereales de desayuno comercializados en la ciudad de Saltillo, Coahuila. Materiales y Métodos: Se analizaron tres muestras de 12 marcas de cereal distintas. Para la extracción de plaguicidas se utilizó un equipo Soxhlet y la cuantificación se realizó por medio de Cromatografía Líquida de Alta Eficiencia (HPLC), utilizando un equipo marca Agillent modelo 1100 Series acoplado a un detector UV-Vis. Resultados: Se detectó glifosato en el 100% de las muestras analizadas, se obtuvieron concentraciones de entre 170 a 2 400 mg/kg, las muestras que presentaron mayores concentraciones fueron las de marcas internacionales. Conclusiones: Se detectaron residuos de glifosato en las 24 muestras analizadas de cereales de desayuno, las cuales sobrepasaron los LMR establecidos en el CODEX ALIMENTARIUS, por lo que es importante realizar más estudios con el fin de monitorear y asegurar la inocuidad de los productos procesados que son consumidos.

Abstract Objective: To detect and quantify glyphosate residues in breakfast cereals marketed in the city of Saltillo, Coahuila. Materials and Methods: Two samples of 12 different cereal brands were analyzed. A Soxhlet apparatus was used for pesticide extraction and quantification was performed by High Performance Liquid Chromatography (HPLC) using an Agillent model 1100 Series equipment coupled to a UV- Vis detector. Results: Glyphosate was detected in 100% of the samples analyzed, with concentrations ranging from 170 to 2 400 mg/kg; the samples with the highest concentrations were those of international brands. Conclusions: All the concentrations detected in the commercial cereal samples exceeded the MRLs established in CODEX ALIMENTARIUS, so it is important to carry out more studies in order to monitor and ensure the safety of the processed products that are consumed.

Biophysical, Nutraceutical, and Technofunctional Features of Specialty Cereals: Pigmented Popcorn and Sorghum.

Different pigmented corn and sorghum types were evaluated to characterize their biophysical, nutraceutical, and technofunctional properties for the first time. Commercially pigmented (blue, purple, red, black, and yellow) popcorn (Zea mays var. everta) and sorghum (Sorghum bicolor L.) of yellow and red colors were analyzed. Biophysical and proximal analyses were performed using official methods. The nutraceutical profile included the total phenolic and anthocyanin content. In addition, rheological, structural, and morphological studies were conducted. The results demonstrated significant differences between the popcorn samples and grain types, especially in terms of their biophysical and proximate features. The nutraceutical profile revealed that these specialty grains contained higher concentrations of antioxidant compounds (up to 3-fold when compared with the other grains). The rheological analysis demonstrated that sorghum grains developed higher peak viscosities than popcorn. According to the structural assessments, the type A pattern displayed peaks at the interplanar spaces corresponding to the crystalline and amorphous regions in all the samples. The data obtained in this study provides a base to further investigate the products obtained using these biomaterials.

Multivariate Analysis on the Properties of Intact Cereal Kernels and Their Association with Viscoelasticity at Different Moisture Contents.

The viscoelastic properties of cereal kernels are strongly related to their quality, which can be applied to the development of a more selective and objective classification process. In this study, the association between the biophysical and viscoelastic properties of wheat, rye, and triticale kernels was investigated at different moisture contents (12% and 16%). A uniaxial compression test was performed under a small strain (5%), and the increase in viscoelasticity at 16% moisture content corresponded to proportional increases in biophysical properties such as the appearance and geometry. The biophysical and viscoelastic behaviors of triticale were between those of wheat and rye. A multivariate analysis showed that the appearance and geometric properties significantly influenced kernel features. The maximum force showed strong correlations with all viscoelastic properties, and it can be used to distinguish between cereal types and moisture contents. A principal component analysis was performed to discriminate the effect of the moisture content on different types of cereals and to evaluate the biophysical and viscoelastic properties. The uniaxial compression test under a small strain and the multivariate analysis can be considered a simple and non-destructive tool for assessing the quality of intact cereal kernels.

Deoxynivalenol and zearalenone in Brazilian barley destined for brewing.

Barley is an important cereal worldwide. However, fungal contamination during pre and postharvest is a recurrent problem for barley production, causing a direct impact on the quality of the grains and their by-products due to spoilage and mycotoxin accumulation. The Fusarium graminearum species complex is the main contaminant during preharvest and some species can produce deoxynivalenol and zearalenone, important mycotoxins that represent a risk to human and animal health. This study evaluated the fungal diversity and the levels of DON and ZEN in barley grains produced in Brazil. The results showed high frequency (60%) of Fusariumcontamination in barley grains. Additionally, mycotoxin levels ranged from 46 to 2074 µg/kg for DON and from 74 to 556 µg/kg for ZEN. Co-occurrence of DON and ZEN was observed in 40% of the samples and 30% of barley samples had DON and ZEN levels higher than the maximum levels established by Brazilian and European legislations. .

(In)segurança da rotulagem de alimentos infantis à base de cereais em relação à legislação brasileira vigente / (In)safety of labeling of cereal-based infant foods in relation to current brazilian legislation

Introdução: Os cereais sãoamplamente utilizados na alimentação das crianças. Objetivo: avaliar a composição nutricional e a rotulagem de alimentos infantis à base de cereais, em relação à legislação vigente. Material e Métodos: Estudo transversal, analítico e descritivo que avaliou alimentos à base de cereais, bem como a conformidade da rotulagem em relação à legislação brasileira vigente. Resultados: Avaliaram-se 72 amostras de alimentos: cereal para alimentação infantil; mistura para o preparo de mingaus e farinha de cereais; 100% das amostras apresentaram alguma não conformidade em relação à legislação, incluindo a presença de falso conceito de vantagem e segurança, ilustrações não permitidas, ausência de advertências obrigatórias e ausência da idade mínima para consumo do produto. Nas análises bromatológicas e de rotulagem, o teor de carboidratos de todas as categorias ultrapassou 80% do valor energético total do produto. Os teores de proteínas, lipídios, carboidratos e energia da categoria cereal para alimentação infantil mostraram diferenças significativas, sendo, respectivamente, p=0,015, p<0,001, p=0,013 e p<0,001. A categoria "mistura para preparo de mingaus" também mostrou diferenças significativas para proteínas, lipídios, carboidratos e energia (p<0,001). Na categoria de farinhas de cereais, somente o teor de proteínas apresentou diferença (p=0,05). Conclusão: Considerando o universo amostral do estudo, é possível concluir que mesmo na vigência de legislações específicas, ainda encontramos não conformidades legais na rotulagem de alimentos à base de cereais destinados à alimentação infantil, sendo que esses alimentos apresentam composição nutricional diferente das informações apresentadas em seus rótulos, impactando negativamente a segurança alimentar de crianças.

Introduction: Cereals are widely used in children's nutrition. Objective: to evaluate the nutritional composition and labeling of cereal-based infant foods, in relation to current legislation. Material and Methods: cross-sectional, analytical and descriptive study that evaluated cereal-based foods, as well as labeling compliance with current Brazilian legislation. Results: 72 food samples were evaluated: cereal for baby food; mixture for the preparation of porridge and cereal flour. One hundred percent of the samples showed some non-compliance with the legislation, including the presence of a false concept of advantage and safety, illustrations not allowed, absence of mandatory warnings and, absence of the minimum age for consumption of the product. In bromatological and labeling analyses, the carbohydrate content of all categories exceeded 80% of the total energy value of the product. The protein, lipid, carbohydrate and energy contents of the cereal category for infant feeding showed significant differences, being, respectively, p=0.015, p<0.001, p=0.013 and p<0.001. The mix category for porridge preparation also showed significant differences for proteins, lipids, carbohydrates and energy (p<0.001). In the category of cereal flours, only the protein content showed a difference (p=0.05). Conclusion: considering the sample universe of the study, it is possible to conclude that even in the presence of specific legislation, we still find legal non-conformities in the labeling of cereal-based foods intended for infant feeding, and these foods have a nutritional composition different from the information presented on their labels, negatively impacting children's food safety.

Occurrence of Mycotoxins in Foods: Unraveling the Knowledge Gaps on Their Persistence in Food Production Systems.

In this review, the intricate issue about the occurrence levels of mycotoxins in foods is discussed aiming to underline the main knowledge gaps on the persistence of these toxicants in the food production system. Mycotoxins have been a key challenge to the food industry, economic growth, and consumers' health. Despite a breadth of studies over the past decades, the persistence of mycotoxins in foods remain an overlooked concern that urges exploration. Therefore, we aimed to concisely underline the matter and provide possible biochemical and metabolic details that can be relevant to the food sector and overall public health. We also stress the application of computational modeling, high-throughput omics, and high-resolution imaging approaches, which can provide insights into the structural and physicochemical characteristics and the metabolic activities which occur in a stored cereal grain's embryo and endosperm and their relationship with storage fungi and mycotoxins on a cellular level. In addition, there is a need for extensive collaborative network and funding, which will play a key role in finding effective solutions against the persistence of mycotoxins at the genetic and molecular to metabolic levels in the food system.

Agronomic feasibility of wheat and triticale cultivars in the semiarid of Minas Gerais state, Brazil / Viabilidade agronômica de cultivares de trigo e triticale na região semiárida do estado de Minas Gerais, Brasil

The production of winter cereals is becoming increasingly important in Brazil, largely due to advanced techniques that enable considerable qualitative and quantitative gains. This is due to plant breeding under different soil and climate conditions combined with proper management. The present study aims to assess the agronomic feasibility of growing wheat and triticale cultivars with two sowing times in the semiarid region of northern Minas Gerais State, Brazil. The experiment was conducted in 2018 at the Instituto de Ciências Agrárias (Institute of Agricultural Sciences) of Universidade Federal de Minas Gerais, Montes Claros campus. A randomized block design was used, with four replications and an 8 × 2 factorial arrangement consisting of eight genotypes (six wheat and two triticale cultivars) and two sowing times (April 21 and May 12, 2018). The irrigated production of wheat and triticale was agronomically feasible in the semi-arid region of Minas Gerais state and sowing time affected the main agronomic traits of interest of winter cereals. However, it is essential to study the economic feasibility of the crop. Sowing in April was the most indicated for wheat and triticale, with IPR Potyporã, IPR 144 and IPR 111 as the recommended cultivars.Key words: Agronomic traits. Triticum. aestivum L. X Triticosecale wittimack. Winter cereals.

A produção brasileira de cereais de inverno está ganhando cada vez mais importância, principalmente pelo uso de técnicas avançadas, o que permite um ganho qualitativo e quantitativo considerável. Isso ocorre em função do melhoramento genético nas diferentes condições edafoclimáticas associado ao manejo adequado dessas plantas. Assim, esse trabalho objetivou avaliar a viabilidade agronômica de cultivares de trigo e triticale em duas épocas de semeadura na região semiárida do estado de Minas Gerais, Brasil. O experimento foi conduzido no delineamento de blocos casualizados com quatro repetições, em arranjo fatorial 8 × 2, composto por oito genótipos (6 cultivares de trigo e 2 cultivares de triticale) e duas épocas de semeadura (21 de abril e 12 de maio de 2018). A produção irrigada de trigo e triticale no semiárido mineiro foi agronomicamente viável, e a época de semeadura afetou as principais características de interesse agronômico dos cereais de inverno. Porém, é fundamental estudar a viabilidade econômica para a indicação da cultura. A semeadura em abril foi a mais indicada para trigo e triticale, nesse caso, recomenda-se o uso das cultivares IPR Potyporã, IPR 144 e IPR 111.

Laboratory Evaluation of Storage Bags for Infestations in Wheat Caused by Rhyzopertha dominica F. (Coleoptera: Bostrichidae) and Trogoderma granarium Everts (Coleoptera: Dermestidae) and Their Control Using Phosphine Fumigation.

Bag storage of wheat is common in Asian countries, and common types of such bags include jute bags, woven plastic bags, and hermetic plastic bags. In order to assess infestation by two serious pests, namely Rhyzopertha dominica (Coleoptera: Bostrichidae) and Trogoderma granarium (Coleoptera: Dermestidae) in these bags, two experiments were performed. In the first experiment, three popular wheat varieties, namely Akbar, Dilkash, and Bakhar star were filled in above-mentioned miniature-size bags which were then placed in jars with three replicates per bag type and variety. Forty insects (adults for R. dominica and larvae for T. granarium) were released in the center of the jars for a period of 30 d in two different setups for both species. Data were recorded twice: after 15 d and 30 d. Results showed insects entered the jute bags only (made invasions due to its loose fibers and openings). Inside the bags, R. dominica caused more weight loss and live insects in Dilkash and Akbar varieties, while T. granarium preferred Bakhar star and Dilkash compared with their third variety. In the second experiment, only two bags, namely woven plastic bags and hermetic plastic bags filled with one variety, were tested to check damage (penetrations because no openings are present in these bags as in jute bags) to the bags. Results showed both species created holes in woven plastic bags but not in hermetic plastic bags. These results showed hermetic plastic bags remained safe from external infestation compared with the other two bags. Sometimes if insects are already present in the grains inside the bags, fumigation is needed from outside to kill the pests inside. To evaluate this, all three bags were filled with a wheat variety and were also infested with both insect species and placed in a fumigation container with nine replicates per bag type. A phosphine tablet (3.0 g) wrapped in muslin cloth was placed in a container which was then sealed, and the fumigation-induced mortality after 24 h was recorded. Results showed mortality was >95% to 100% in woven and jute bags, respectively, while mortality in hermetic plastic bags remained very low (<3%). These results revealed the least fumigant gas permeation in hermetic plastic bags compared with jute and woven plastic bags. Results of all three experiments demand immediate alteration in creation of all three bags to curtail infestation from outside (jute and woven plastic bags) as well as to generate maximum fumigation efficacy when the source of infestation is with the grains (hermetic bags).

First report of maize rayado fino virus in corn fields in Santa Catarina, Brazil.

Maize (Zea mays L.) is the main cereal food of humans and animals in Brazil. In 2020 and 2021, a severe infestation of corn leafhoppers (Dalbulus maidis; Hemiptera: Cicadellidae) was observed in Santa Catarina State (South of Brazil). Subsequently, symptoms of chlorotic stripes limited in leaf veins started to appear in maize plants. Given the similarity of symptoms and the presence of high populations of corn leafhoppers in corn production areas, 30 plants in reproductive stage showing systemic symptoms were collected in summer and autumn from commercial fields of five municipalities in Santa Catarina: Campos Novos (27°23'18.0"S, 51°12'52.7"W), Lages (27°47'17.8"S, 50°18'16.9"W), Mafra (26°06'42"S, 49°48'25"W), Fraiburgo (27°01'36"S, 50°55'19"W), and Abelardo Luz (26°34'02"S, 52°20'02"W). The young leaves of these samples were used for molecular analyses targeting the maize rayado fino virus (MRFV; Tymoviridae: Marafivirus). Total nucleic acids were extracted using TRIzol® (Invitrogen, USA), following the manufacturer's instructions. These were used as a template for cDNA synthesis with the enzyme MMLV-RT (Promega, USA), following the manufacturer's instructions. The polymerase chain reaction (PCR) was performed using Gotaq® DNA polymerase (Promega, USA) and MRFV-09/MRFV-10 primers (Hammond et al. 1997). All PCR products were subjected to electrophoresis in 1% agarose gel and were visualized under ultraviolet light. Twenty-eight of the 30 tested plants were MRFV-positive, showing a fragment with an expected size of ~633 bp. To confirm our results, all MRFV-positive samples were sent for sequencing (GenBank accession numbers OM763708 - OM763710 and ON730784 - ON730806) and submitted to BLASTn search (https://blast.ncbi.nlm.nih.gov/Blast.cgi), resulting in identities ranging from 96.21% to 99.21% with the isolate "Brazil 26" of MRFV, which was detected in 2005 in São Paulo, Brazil (GenBank accession nº: AF186178) (Hammond and Bedendo 2005). A second set of primers was used to validate the first PCR, confirming MRFV infection (data not shown).Moreover, whitish streaks and leaf reddening were observed on the leaves of some plants; therefore, the identification for phytoplasmas (Candidatus Phytoplasma asteris) and spiroplasmas (Spiroplasma kunkelii) from the corn stunt complex was performed. For this, previously extracted nucleic acids from each sample were used as templates for a multiplex PCR using the primers CSSR6/CSSF2 and R16F2n/R16R2 (Gundersen and Lee 1996; Barros et al. 2001). Two plants were infected with only spiroplasma, 17 samples were infected with Spiroplasma and MRFV, and three samples were infected by these three pathogens. An increasing incidence of corn stunt has been observed in commercial fields in Santa Catarina in recent years. Mollicutes are commonly found and mostly studied as causal agents of corn stunt disease. On the contrary, despite being present in Brazil since the 1970s, the virus is less studied because its contribution to the corn stunt complex is still unknown (Hammond and Bedendo 2001). In this report, indications that the virus is expanding to different regions in southern Brazil were observed, which raises an opportunity for further evaluation and its consideration in monitoring programs. Moreover, to the best of our knowledge, this is the first report of MRFV in Santa Catarina, Brazil.

Reformulating Bread Using Sprouted Pseudo-cereal Grains to Enhance Its Nutritional Value and Sensorial Attributes.

Sprouting is an effective treatment for improving nutritional and bioactive properties as well as lowering the anti-nutritional compounds in pseudo-cereals. Enhancing nutritional properties when using sprouted pseudo-cereals flours as a baking ingredient requires tailored formulation. Simplex centroid designs and response surface methodology has been applied in the present study to define the ideal proportions of ternary blends of sprouted kiwicha (SKF), cañihua (SCF) and wheat flours (WF) to simultaneously enhance the content in bioactive compounds (γ-aminobutyric acid, GABA, total soluble phenolic compounds and TSPC), as well as sensory (odor, color, taste and texture) and functional attributes (antioxidant activity, AA) while reducing phytic acid (PA) content of bread. The effect of gastric and intestinal digestion on bioactive compounds, AA, PA and starch hydrolysis was also evaluated. Mixture design allowed for the identification of optimal formulation (5% SKF, 23.1% SCF, 71.9% WF) that can be used to obtain breads with higher content of GABA, TSPC, AA, overall sensorial acceptability (scores > 7) and reduced PA content and glycemic index. Moreover, this study demonstrated that these nutritional and health benefits provided by the replacement of WF by sprouted pseudo-cereal flours remained upon digestion. The results of this study indicated that WF replacement with SKF and SCF is sensory acceptable and improved the nutritional quality of bread.

Mycotoxin Exposure in Children through Breakfast Cereal Consumption in Chile.

Mycotoxins are unavoidable contaminants produced by fungi in food, especially grains. This study aimed to measure the occurrence and levels of total aflatoxins (AFs); ochratoxin A (OTA); zearalenone (ZEN); fumonisins B1, B2, and B3 (FUM); deoxynivalenol (DON); and T-2/HT-2 toxins in the four most commonly consumed breakfast cereals in Chile and to assess mycotoxin exposure and risk in children aged 2 to 13 years due to cereal consumption. In this study, a total of 110 batches with three subsamples of the four brands were sampled in supermarkets from November 2019 to June 2021. Samples were analyzed by Veratox® ELISA (Neogen). Exposure was assessed by estimated daily intake (EDI) considering the levels found in a modified lower bound (mLB) and upper bound (UB). Risk was estimated by margin of exposure (MOE) in the case of OTA and AFs and hazard quotient (HQ) for the rest of the mycotoxins. No T2/HT2 toxins were detected. Few samples had quantifiable levels of ZEN, FUM, and DON except for brand 1, with a mean (standard deviation, SD) of 54 (20), 1552 (351), and 706 (218) ng/g, respectively. In addition, three FUM samples and one DON sample had values over the Chilean regulation. Brands 2, 3, and 4 had quantifiable levels of AFs, with mean (SD) values of 1.3 (0.1), 2.1 (0.6), and 1.9 (0.4) ng/g, respectively. Brand 3 had quantifiable levels of OTA, with a mean (SD) of 2.3 (0.4) ng/g. Estimated exposure indicated a risk of AFs in all scenarios, and of FUM for brand 1 consumption, OTA and DON for brand 3 consumption, and OTA for brand 4 consumption in the mLB worst-case scenario. In general, mycotoxin levels were below the Chilean regulatory limits, but most of them were above the EU regulation for processed cereal-based food in young children. Because the risk was higher in the 2- to 5-year-old children, we recommend special regulations for this group in Chile.

First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay.

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.