Generative Modeling of RNA Sequence Families with Restricted Boltzmann Machines.

In this chapter, we discuss the potential application of Restricted Boltzmann machines (RBM) to model sequence families of structured RNA molecules. RBMs are a simple two-layer machine learning model able to capture intricate sequence dependencies induced by secondary and tertiary structure, as well as mechanisms of structural flexibility, resulting in a model that can be successfully used for the design of allosteric RNA such as riboswitches. They have recently been experimentally validated as generative models for the SAM-I riboswitch aptamer domain sequence family. We introduce RBM mathematically and practically, providing self-contained code examples to download the necessary training sequence data, train the RBM, and sample novel sequences. We present in detail the implementation of algorithms necessary to use RBMs, focusing on applications in biological sequence modeling.

A Computational Approach for Designing Synthetic Riboswitches for Next-Generation RNA Therapeutics.

Riboswitches are naturally occurring regulatory segments of RNA molecules that modulate gene expression in response to specific ligand binding. They serve as a molecular 'switch' that controls the RNA's structure and function, typically influencing the synthesis of proteins. Riboswitches are unique because they directly interact with metabolites without the need for proteins, making them attractive tools in synthetic biology and RNA-based therapeutics. In synthetic biology, riboswitches are harnessed to create biosensors and genetic circuits. Their ability to respond to specific molecular signals allows for the design of precise control mechanisms in genetic engineering. This specificity is particularly useful in therapeutic applications, where riboswitches can be synthetically designed to respond to disease-specific metabolites, thereby enabling targeted drug delivery or gene therapy. Advancements in designing synthetic riboswitches for RNA-based therapeutics hinge on sophisticated computational techniques, which are described in this chapter. The chapter concludes by underscoring the potential of computational strategies in revolutionizing the design and application of synthetic riboswitches, paving the way for advanced RNA-based therapeutic solutions.

Cotranscriptional Folding of a 5' Stem-loop in the Escherichia coli tbpA Riboswitch at Single-nucleotide Resolution.

Transcription elongation is one of the most important processes in the cell. During RNA polymerase elongation, the folding of nascent transcripts plays crucial roles in the genetic decision. Bacterial riboswitches are prime examples of RNA regulators that control gene expression by altering their structure upon metabolite sensing. It was previously revealed that the thiamin pyrophosphate-sensing tbpA riboswitch in Escherichia coli cotranscriptionally adopts three main structures leading to metabolite sensing. Here, using single-molecule FRET, we characterize the transition in which the first nascent structure, a 5' stem-loop, is unfolded during transcription elongation to form the ligand-binding competent structure. Our results suggest that the structural transition occurs in a relatively abrupt manner, i.e., within a 1-2 nucleotide window. Furthermore, a highly dynamic structural exchange is observed, indicating that riboswitch transcripts perform rapid sampling of nascent co-occurring structures. We also observe that the presence of the RNAP stabilizes the 5' stem-loop along the elongation process, consistent with RNAP interacting with the 5' stem-loop. Our study emphasizes the role of early folding stem-loop structures in the cotranscriptional formation of complex RNA molecules involved in genetic regulation.

Optimization of Exon-Skipping Riboswitches and Their Applications to Control Mammalian Cell Fate.

Mammalian riboswitches that can regulate transgene expression via RNA-small molecule interaction have promising applications in medicine and biotechnology, as they involve no protein factors that can induce immunogenic reactions and are not dependent on specially engineered promoters. However, the lack of cell-permeable and low-toxicity small molecules and cognate aptamers that can be exploited as riboswitches and the modest switching performance of mammalian riboswitches have limited their applications. In this study, we systematically optimized the design of a riboswitch that regulates exon skipping via an RNA aptamer that binds ASP2905. We examined two design strategies to modulate the stability of the aptamer base stem that blocks the 5' splice site to fine-tune the riboswitch characteristics. Furthermore, an optimized riboswitch was used to generate a mouse embryonic stem cell line that can be chemically induced to differentiate into myogenic cells by activating Myod1 expression and a human embryonic kidney cell line that can be induced to trigger apoptosis by activating BAX expression. The results demonstrate the tight chemical regulation of transgenes in mammalian cells to control their phenotype without exogenous protein factors.

Bifidobacterium bifidum SAM-VI Riboswitch Conformation Change Requires Peripheral Helix Formation.

The Bifidobacterium bifidum SAM-VI riboswitch undergoes dynamic conformational changes that modulate downstream gene expression. Traditional structural methods such as crystallography capture the bound conformation at high resolution, and additional efforts would reveal details from the dynamic transition. Here, we revealed a transcription-dependent conformation model for Bifidobacterium bifidum SAM-VI riboswitch. In this study, we combine small-angle X-ray scattering, chemical probing, and isothermal titration calorimetry to unveil the ligand-binding properties and conformational changes of the Bifidobacterium bifidum SAM-VI riboswitch and its variants. Our results suggest that the SAM-VI riboswitch contains a pre-organized ligand-binding pocket and stabilizes into the bound conformation upon binding to SAM. Whether the P1 stem formed and variations in length critically influence the conformational dynamics of the SAM-VI riboswitch. Our study provides the basis for artificially engineering the riboswitch by manipulating its peripheral sequences without modifying the SAM-binding core.

Suppression of toxic transgene expression by optimized artificial miRNAs increases AAV vector yields in HEK-293 cells.

Adeno-associated virus (AAV) vectors have become the leading platform for gene delivery in both preclinical research and therapeutic applications, making the production of high-titer AAV preparations essential. To date, most AAV-based studies use constitutive promoters (e.g., CMV, CAG), which are also active in human embryonic kidney (HEK)-293 producer cells, thus leading to the expression of the transgene already during production. Depending on the transgene's function, this might negatively impact producer cell performance and result in decreased AAV vector yields. Here, we evaluated a panel of diverse microRNA (miRNA)-based shRNA designs to identify a highly potent artificial miRNA for the transient suppression of transgenes during AAV production. Our results demonstrate that insertion of miRNA target sites into the 3' UTR of the transgene and simultaneous expression of the corresponding miRNA from the 3' UTR of conventional AAV production plasmids (rep/cap, pHelper) enabled efficient silencing of toxic transgene expression, thereby increasing AAV vector yields up to 240-fold. This strategy not only allows to maintain the traditional triple-transfection protocol, but also represents a universally applicable approach to suppress toxic transgenes, thereby boosting vector yields with so far unprecedented efficiency.

Structural idiosyncrasies of glycyl T-box riboswitches among pathogenic bacteria.

T-box riboswitches are widespread bacterial regulatory noncoding RNAs that directly interact with tRNAs and switch conformations to regulate the transcription or translation of genes related to amino acid metabolism. Recent studies in Bacilli have revealed the core mechanisms of T-boxes that enable multivalent, specific recognition of both the identity and aminoacylation status of the tRNA substrates. However, in-depth knowledge on a vast number of T-boxes in other bacterial species remains scarce, although a remarkable structural diversity, particularly among pathogens, is apparent. In the present study, analysis of T-boxes that control the transcription of glycyl-tRNA synthetases from four prominent human pathogens revealed significant structural idiosyncrasies. Nonetheless, these diverse T-boxes maintain functional T-box:tRNAGly interactions both in vitro and in vivo. Probing analysis not only validated recent structural observations, but also expanded our knowledge on the substantial diversities among T-boxes and suggest interesting distinctions from the canonical Bacilli T-boxes. Surprisingly, some glycyl T-boxes seem to redirect the T-box trajectory in the absence of recognizable K-turns or contain Stem II modules that are generally absent in glycyl T-boxes. These results consolidate the notion of a lineage-specific diversification and elaboration of the T-box mechanism and corroborate the potential of T-boxes as promising species-specific RNA targets for next-generation antibacterial compounds.

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

Cell-Free Biosensors Based on Modular Eukaryotic Riboswitches That Function in One Pot at Ambient Temperature.

Artificial riboswitches responsive to user-defined analytes can be constructed by successfully inserting in vitro selected aptamers, which bind to the analytes, into untranslated regions of mRNA. Among them, eukaryotic riboswitches are more promising as biosensors than bacterial ones because they function well at ambient temperature. In addition, cell-free expression systems allow the broader use of these riboswitches as cell-free biosensors in an environmentally friendly manner without cellular limitations. The current best cell-free eukaryotic riboswitch regulates eukaryotic canonical translation initiation through self-cleavage mediated by an implanted analyte-responsive ribozyme (i.e., an aptazyme, an aptamer-ribozyme fusion). However, it has critical flaws as a sensor: due to the less-active ribozyme used, self-cleavage and translation reactions must be conducted separately and sequentially, and a different aptazyme has to be selected to change the analyte specificity, even if an aptamer for the next analyte is available. We here stepwise engineered novel types of cell-free eukaryotic riboswitches that harness highly active self-cleavage and thus require no reaction partitioning. Despite the single-step and one-pot reaction, these riboswitches showed higher analyte dose dependency and sensitivities than the current best cell-free eukaryotic riboswitch requiring multistep reactions. In addition, the analyte specificity can be changed in an extremely facile way, simply by aptamer substitution (and the subsequent simple fine-tuning for giant aptamers). Given that cell-free systems can be lyophilized for storage and transport, the present one-pot and thus easy-to-handle cell-free biosensors utilizing eukaryotic riboswitches are expected to be widely used for on-the-spot sensing of analytes at ambient temperature.

Corrin Ring Modifications Reveal the Chemical and Spatial Requirements for the B12-btuB Riboswitch Interaction.

The btuB riboswitch is a regulatory RNA sequence controlling gene expression of the outer membrane B12 transport protein BtuB by specifically binding coenzyme B12 (AdoCbl) as its natural ligand. The B12 sensing riboswitch class is known to accept various B12 derivatives, leading to a division into two riboswitch subclasses, dependent on the size of the apical ligand. Here we focus on the role of side chains b and e on affinity and proper recognition, i. e. correct structural switch of the btuB RNA, which belongs to the AdoCbl-binding class I. Chemical modification of these side chains disturbs crucial hydrogen bonds and/or electrostatic interactions with the RNA, its effect on both affinity and switching being monitored by in-line probing. Chemical modifications at sidechain b of vitamin B12 show larger effects indicating crucial B12-RNA interactions. When introducing the same modification to AdoCbl the influence of any side-chain modification tested is reduced. This renders the impact of the adenosyl-ligand for B12-btuB riboswitch recognition clearly beyond the known role in affinity.

Development and validation of a generic methyltransferase enzymatic assay based on an SAH riboswitch.

Methylation of proteins and nucleic acids plays a fundamental role in epigenetic regulation, and discovery of methyltransferase (MT) inhibitors is an area of intense activity. Because of the diversity of MTs and their products, assay methods that detect S-adenosylhomocysteine (SAH) - the invariant product of S-adenosylmethionine (SAM)-dependent methylation reactions - offer some advantages over methods that detect specific methylation events. However, direct, homogenous detection of SAH requires a reagent capable of discriminating between SAH and SAM, which differ by a single methyl group. Moreover, MTs are slow enzymes and many have submicromolar affinities for SAM; these properties translate to a need for detection of SAH at low nanomolar concentrations in the presence of excess SAM. To meet these needs, we leveraged the exquisite molecular recognition properties of a naturally occurring SAH-sensing RNA aptamer, or riboswitch. By splitting the riboswitch into two fragments, such that SAH binding induces assembly of a trimeric complex, we engineered sensors that transduce binding of SAH into positive fluorescence polarization (FP) and time resolved Förster resonance energy transfer (TR-FRET) signals. The split riboswitch configuration, called the AptaFluor™ SAH Methyltransferase Assay, allows robust detection of SAH (Z' > 0.7) at concentrations below 10 nM, with overnight signal stability in the presence of typical MT assay components. The AptaFluor assay tolerates diverse MT substrates, including histones, nucleosomes, DNA and RNA, and we demonstrated its utility as a robust, enzymatic assay method for several methyltransferases with SAM Km values < 1 µM. The assay was validated for HTS by performing a pilot screen of 1,280 compounds against the SARS-CoV-2 RNA capping enzyme, nsp14. By enabling direct, homogenous detection of SAH at low nanomolar concentrations, the AptaFluor assay provides a universal platform for screening and profiling MTs at physiologically relevant SAM concentrations.

Fluorescent riboswitch-controlled biosensors for the genome scale analysis of metabolic pathways.

Fluorescent detection in cells has been tremendously developed over the years and now benefits from a large array of reporters that can provide sensitive and specific detection in real time. However, the intracellular monitoring of metabolite levels still poses great challenges due to the often complex nature of detected metabolites. Here, we provide a systematic analysis of thiamin pyrophosphate (TPP) metabolism in Escherichia coli by using a TPP-sensing riboswitch that controls the expression of the fluorescent gfp reporter. By comparing different combinations of reporter fusions and TPP-sensing riboswitches, we determine key elements that are associated with strong TPP-dependent sensing. Furthermore, by using the Keio collection as a proxy for growth conditions differing in TPP levels, we perform a high-throughput screen analysis using high-density solid agar plates. Our study reveals several genes whose deletion leads to increased or decreased TPP levels. The approach developed here could be applicable to other riboswitches and reporter genes, thus representing a framework onto which further development could lead to highly sophisticated detection platforms allowing metabolic screens and identification of orphan riboswitches.

Characterization of the dual regulation by a c-di-GMP riboswitch Bc1 with a long expression platform from Bacillus thuringiensis.

A riboswitch generally regulates the expression of its downstream genes through conformational change in its expression platform (EP) upon ligand binding. The cyclic diguanosine monophosphate (c-di-GMP) class I riboswitch Bc1 is widespread and conserved among Bacillus cereus group species. In this study, we revealed that Bc1 has a long EP with two typical ρ-independent terminator sequences 28 bp apart. The upstream terminator T1 is dominant in vitro, while downstream terminator T2 is more efficient in vivo. Through mutation analysis, we elucidated that Bc1 exerts a rare and incoherent "transcription-translation" dual regulation with T2 playing a crucial role. However, we found that Bc1 did not respond to c-di-GMP under in vitro transcription conditions, and the expressions of downstream genes did not change with fluctuation in intracellular c-di-GMP concentration. To explore this puzzle, we conducted SHAPE-MaP and confirmed the interaction of Bc1 with c-di-GMP. This shows that as c-di-GMP concentration increases, T1 unfolds but T2 remains almost intact and functional. The presence of T2 masks the effect of T1 unwinding, resulting in no response of Bc1 to c-di-GMP. The high Shannon entropy values of EP region imply the potential alternative structures of Bc1. We also found that zinc uptake regulator can specifically bind to the dual terminator coding sequence and slightly trigger the response of Bc1 to c-di-GMP. This work will shed light on the dual-regulation riboswitch and enrich our understanding of the RNA world.IMPORTANCEIn nature, riboswitches are involved in a variety of metabolic regulation, most of which preferentially regulate transcription termination or translation initiation of downstream genes in specific ways. Alternatively, the same or different riboswitches can exist in tandem to enhance regulatory effects or respond to multiple ligands. However, many putative conserved riboswitches have not yet been experimentally validated. Here, we found that the c-di-GMP riboswitch Bc1 with a long EP could form a dual terminator and exhibit non-canonical and incoherent "transcription-translation" dual regulation. Besides, zinc uptake regulator specifically bound to the coding sequence of the Bc1 EP and slightly mediated the action of Bc1. The application of SHAPE-MaP to the dual regulation mechanism of Bc1 may establish the foundation for future studies of such complex untranslated regions in other bacterial genomes.

Magnesium ions mitigate metastable states in the regulatory landscape of mRNA elements.

Residing in the 5' untranslated region of the mRNA, the 2'-deoxyguanosine (2'-dG) riboswitch mRNA element adopts an alternative structure upon binding of the 2'-dG molecule, which terminates transcription. RNA conformations are generally strongly affected by positively charged metal ions (especially Mg2+). We have quantitatively explored the combined effect of ligand (2'-dG) and Mg2+ binding on the energy landscape of the aptamer domain of the 2'-dG riboswitch with both explicit solvent all-atom molecular dynamics simulations (99 µsec aggregate sampling for the study) and selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) experiments. We show that both ligand and Mg2+ are required for the stabilization of the aptamer domain; however, the two factors act with different modalities. The addition of Mg2+ remodels the energy landscape and reduces its frustration by the formation of additional contacts. In contrast, the binding of 2'-dG eliminates the metastable states by nucleating a compact core for the aptamer domain. Mg2+ ions and ligand binding are required to stabilize the least stable helix, P1 (which needs to unfold to activate the transcription platform), and the riboswitch core formed by the backbone of the P2 and P3 helices. Mg2+ and ligand also facilitate a more compact structure in the three-way junction region.

Probing RNA structure and dynamics using nanopore and next generation sequencing.

It has become increasingly evident that the structures RNAs adopt are conformationally dynamic; the various structured states that RNAs sample govern their interactions with other nucleic acids, proteins, and ligands to regulate a myriad of biological processes. Although several biophysical approaches have been developed and used to study the dynamic landscape of structured RNAs, technical limitations have limited their application to all classes of RNA due to variable size and flexibility. Recent advances combining chemical probing experiments with next-generation- and direct sequencing have emerged as an alternative approach to exploring the conformational dynamics of RNA. In this review, we provide a methodological overview of the sequencing-based techniques used to study RNA conformational dynamics. We discuss how different techniques have enabled us to better understand the propensity of RNAs from a variety of different classes to sample multiple conformational states. Finally, we present examples of the ways these techniques have reshaped how we think about RNA structure.

Direct fluoride monitoring using a fluorogenic RNA-based biosensor.

Fluorinated compounds, whether naturally occurring or from anthropogenic origin, have been extensively exploited in the last century. Degradation of these compounds by physical or biochemical processes is expected to result in the release of fluoride. Several fluoride detection mechanisms have been previously described. However, most of these methods are not compatible with high- and ultrahigh-throughput screening technologies, lack the ability to real-time monitor the increase of fluoride concentration in solution, or rely on costly reagents (such as cell-free expression systems). Our group recently developed "FluorMango" as the first completely RNA-based and direct fluoride-specific fluorogenic biosensor. To do so, we merged and engineered the Mango-III light-up RNA aptamer and the fluoride-specific aptamer derived from a riboswitch, crcB. In this chapter, we explain how this RNA-based biosensor can be produced in large scale before providing examples of how it can be used to quantitatively detect (end-point measurement) or monitor in real-time fluoride release in complex biological systems by translating it into measurable fluorescent signal.

Molecular dynamics in multidimensional space explains how mutations affect the association path of neomycin to a riboswitch.

Riboswitches are messenger RNA (mRNA) fragments binding specific small molecules to regulate gene expression. A synthetic N1 riboswitch, inserted into yeast mRNA controls the translation of a reporter gene in response to neomycin. However, its regulatory activity is sensitive to single-point RNA mutations, even those distant from the neomycin binding site. While the association paths of neomycin to N1 and its variants remain unknown, recent fluorescence kinetic experiments indicate a two-step process driven by conformational selection. This raises the question of which step is affected by mutations. To address this, we performed all-atom two-dimensional replica-exchange molecular dynamics simulations for N1 and U14C, U14C[Formula: see text], U15A, and A17G mutants, ensuring extensive conformational sampling of both RNA and neomycin. The obtained neomycin association and binding paths, along with multidimensional free-energy profiles, revealed a two-step binding mechanism, consisting of conformational selection and induced fit. Neomycin binds to a preformed N1 conformation upon identifying a stable upper stem and U-turn motif in the riboswitch hairpin. However, the positioning of neomycin in the binding site occurs at different RNA-neomycin distances for each mutant, which may explain their different regulatory activities. The subsequent induced fit arises from the interactions of the neomycin's N3 amino group with RNA, causing the G9 backbone to rearrange. In the A17G mutant, the critical C6-A17/G17 stacking forms at a closer RNA-neomycin distance compared to N1. These findings together with estimated binding free energies coincide with experiments and elucidate why the A17G mutation decreases and U15A enhances N1 activity in response to neomycin.

A hybrid RNA-protein biosensor for high-throughput screening of adenosylcobalamin biosynthesis.

Genetically encoded circuits have been successfully utilized to assess and characterize target variants with desirable traits from large mutant libraries. Adenosylcobalamin is an essential coenzyme that is required in many intracellular physiological reactions and is widely used in the pharmaceutical and food industries. High-throughput screening techniques capable of detecting adenosylcobalamin productivity and selecting superior adenosylcobalamin biosynthesis strains are critical for the creation of an effective microbial cell factory for the production of adenosylcobalamin at an industrial level. In this study, we developed an RNA-protein hybrid biosensor whose input part was an endogenous RNA riboswitch to specifically respond to adenosylcobalamin, the inverter part was an orthogonal transcriptional repressor to obtain signal inversion, and the output part was a fluorescent protein to be easily detected. The hybrid biosensor could specifically and positively correlate adenosylcobalamin concentrations to green fluorescent protein expression levels in vivo. This study also improved the operating concentration and dynamic range of the hybrid biosensor by systematic optimization. An individual cell harboring the hybrid biosensor presented over 20-fold higher fluorescence intensity than the negative control. Then, using such a biosensor combined with fluorescence-activated cell sorting, we established a high-throughput screening platform for screening adenosylcobalamin overproducers. This study demonstrates that this platform has significant potential to quickly isolate high-productive strains to meet industrial demand and that the framework is acceptable for various metabolites.

Riboswitch-controlled IL-12 gene therapy reduces hepatocellular cancer in mice.

Hepatocellular carcinoma (HCC) and solid cancers with liver metastases are indications with high unmet medical need. Interleukin-12 (IL-12) is a proinflammatory cytokine with substantial anti-tumor properties, but its therapeutic potential has not been realized due to severe toxicity. Here, we show that orthotopic liver tumors in mice can be treated by targeting hepatocytes via systemic delivery of adeno-associated virus (AAV) vectors carrying the murine IL-12 gene. Controlled cytokine production was achieved in vivo by using the tetracycline-inducible K19 riboswitch. AAV-mediated expression of IL-12 led to STAT4 phosphorylation, interferon-γ (IFNγ) production, infiltration of T cells and, ultimately, tumor regression. By detailed analyses of efficacy and tolerability in healthy and tumor-bearing animals, we could define a safe and efficacious vector dose. As a potential clinical candidate, we characterized vectors carrying the human IL-12 (huIL-12) gene. In mice, bioactive human IL-12 was expressed in a vector dose-dependent manner and could be induced by tetracycline, suggesting tissue-specific AAV vectors with riboswitch-controlled expression of highly potent proinflammatory cytokines as an attractive approach for vector-based cancer immunotherapy.

Parageobacillus thermoglucosidasius Strain Engineering Using a Theophylline Responsive RiboCas for Controlled Gene Expression.

The relentless increase in atmospheric greenhouse gas concentrations as a consequence of the exploitation of fossil resources compels the adoption of sustainable routes to chemical and fuel manufacture based on biological fermentation processes. The use of thermophilic chassis in such processes is an attractive proposition; however, their effective exploitation will require improved genome editing tools. In the case of the industrially relevant chassis Parageobacillus thermoglucosidasius, CRISPR/Cas9-based gene editing has been demonstrated. The constitutive promoter used, however, accentuates the deleterious nature of Cas9, causing decreased transformation and low editing efficiencies, together with an increased likelihood of off-target effects or alternative mutations. Here, we rectify this issue by controlling the expression of Cas9 through the use of a synthetic riboswitch that is dependent on the nonmetabolized, nontoxic, and cheap inducer, theophylline. We demonstrate that the riboswitches are dose-dependent, allowing for controlled expression of the target gene. Through their use, we were then able to address the deleterious nature of Cas9 and produce an inducible system, RiboCas93. The benefits of RiboCas93 were demonstrated by increased transformation efficiency of the editing vectors, improved efficiency in mutant generation (100%), and a reduction of Cas9 toxicity, as indicated by a reduction in the number of single nucleotide polymorphisms (SNPs) observed. This new system provides a quick and efficient way to produce mutants in P. thermoglucosidasius.