Atypical pulmonary thromboembolism caused by the mutation site SERPINC1 of the antithrombin III gene: A case report.

BACKGROUND: Deficiency of natural anticoagulant antithrombin was first reported as a genetic risk factor for venous thromboembolism, antithrombin III (AT III) is encoded by the serpin family C member 1 (SERPINC1) gene, consisting of 432 amino acids, including 3 disulfide bonds and 4 possible glycosylation sites. Studies have shown that hereditary AT deficiency increases the incidence of venous thromboembolism by up to 20 times. CASE PRESENTATION: The case presented a 27-year-old young man with no acquired risk factors and a sudden onset of right lower extremity venous thrombosis and pulmonary embolism. A heterozygous mutation in gene SERPINC1 of c.1154-14G>A was detected in the patient, which is a deleterious mutation resulting in reduced AT III activity and increased risk of thrombotic events. The patient received anticoagulant therapy for approximately 5 months, and the thrombus gradually dissolved and no recurrent thrombotic events occurred during follow-up. DISCUSSION: AT deficiency is a rare autosomal dominant genetic disease, they are mainly divided into 2 types according to the different effects on the structure or function of the encoded protein. The patient had a mutation in the SERPINC1 gene (c.1154-14G>A). Several cases of this type of mutation have been reported since 1991, and it is classified as AT deficiency type I. CONCLUSION: Thrombosis in patients with antithrombin deficiency is often unpredictable and can lead to fatal pulmonary embolism. Early genetic testing for hereditary thrombophilia in venous thromboembolism patients without obvious high-risk factors is critical. Long-term anticoagulation treatment is an effective treatment, for this type of type I AT III deficiency combined with pulmonary embolism patients, warfarin is an effective anticoagulant drug.

Analysis of AlphaFold and molecular dynamics structure predictions of mutations in serpins.

Serine protease inhibitors (serpins) include thousands of structurally conserved proteins playing key roles in many organisms. Mutations affecting serpins may disturb their conformation, leading to inactive forms. Unfortunately, conformational consequences of serpin mutations are difficult to predict. In this study, we integrate experimental data of patients with mutations affecting one serpin with the predictions obtained by AlphaFold and molecular dynamics. Five SERPINC1 mutations causing antithrombin deficiency, the strongest congenital thrombophilia were selected from a cohort of 350 unrelated patients based on functional, biochemical, and crystallographic evidence supporting a folding defect. AlphaFold gave an accurate prediction for the wild-type structure. However, it also produced native structures for all variants, regardless of complexity or conformational consequences in vivo. Similarly, molecular dynamics of up to 1000 ns at temperatures causing conformational transitions did not show significant changes in the native structure of wild-type and variants. In conclusion, AlphaFold and molecular dynamics force predictions into the native conformation at conditions with experimental evidence supporting a conformational change to other structures. It is necessary to improve predictive strategies for serpins that consider the conformational sensitivity of these molecules.

Long-range and real-time PCR identification of a large SERPINC1 deletion in a patient with antithrombin deficiency.

Congenital antithrombin (AT) or serpin C1 deficiency, caused by a SERPINC1 abnormality, is a high-risk factor for venous thrombosis. SERPINC1 is prone to genetic rearrangement, because it contains numerous Alu elements. In this study, a Japanese patient who developed deep vein thrombosis during pregnancy and exhibited low AT activity underwent SERPINC1 gene analysis using routine methods: long-range polymerase chain reaction (PCR) and real-time PCR. Sequencing using long-range PCR products revealed no pathological variants in SERPINC1 exons or exon-intron junctions, and all the identified variants were homozygous, suggesting a deletion in one SERPINC1 allele. Copy number quantification for each SERPINC1 exon using real-time PCR revealed half the number of exon 1 and 2 copies compared with controls. Moreover, a deletion region was deduced by quantifying the 5'-upstream region copy number of SERPINC1 for each constant region. Direct long-range PCR sequencing with primers for the 5'-end of each presumed deletion region revealed a large Alu-mediated deletion (∼13 kb) involving SERPINC1 exons 1 and 2. Thus, a large deletion was identified in SERPINC1 using conventional PCR methods.

The clinical significance of TAT, PIC, TM, and t-PAIC in vascular events of BCR/ABL-negative myeloproliferative neoplasms.

Predicting the likelihood vascular events in patients with BCR/ABL1-negative myeloproliferative neoplasms (MPN) is essential for the treatment of the disease. However, effective assessment methods are lacking. Thrombin-antithrombin complex (TAT), plasmin-α2- plasmininhibitor complex (PIC), thrombomodulin (TM), and tissue plasminogen activator-inhibitor complex (t-PAIC) are the new direct indicators for coagulation and fibrinolysis. The aim of this study was to investigate the changes of these four new indicators in thrombotic and hemorrhagic events in BCR/ABL1-negative MPN. The study cohort of 74 patients with BCR/ABL negative myeloproliferative disorders included essential thrombocythemia, polycythemia vera, and primary myelofibrosis (PMF). A panel of 4 biomarkers, including TAT, PIC, TM, and t-PAIC were determined using Sysmex HISCL5000 automated analyzers, whereas fibrin/fibrinogen degradation products (FDP), D-dimer and Antithrombin III (ATIII) were analyzed using Sysmex CS5100 coagulation analyzer. A total of 24 (32.4%) patients experienced thrombotic events and hemorrhagic events occurred in 8 patients (10.8%). Compared to patients without hemorrhagic-thrombotic events, patients with thrombotic events had higher fibrinogen (FIB) level, FDP level and lower ATIII activity, while patients with hemorrhagic events had lower white blood cell count and hemoglobin level, higher FDP level (P < 0.05). Patients with a JAK2V617F mutation were more likely to experience thrombotic events (P < 0.05). In addtion, patients with thrombotic events had higher TAT, PIC, TM, and t-PAIC levels than patients without hemorrhagic-thrombotic events (P < 0.05), whereas patients with hemorrhagic events had a lower median value in TAT and TM (no statistical difference, P > 0.05). Patients with higher TAT, TM and t-PAIC were more likely to experience thrombotic events (P < 0.05), and only TAT was positively correlated with thrombotic events (Spearman r =0.287, P = 0.019). TAT, PIC, TM, and t-PAIC combined with ATIII and FDP have a certain value for predicting thrombosis in patients with BCR/ABL1-negative MPN. These 6 parameters are worth further exploration as predictive factors and prognostic markers for early thrombotic events.

Antithrombin deficiency caused by SERPINC1 gene mutation in white matter lesions: A case report.

RATIONALE: White matter lesions (WMLs) are structural changes in the brain that manifest as demyelination in the central nervous system pathologically. Vasogenic WMLs are the most prevalent type, primarily associated with advanced age and cerebrovascular risk factors. Conversely, immunogenic WMLs, typified by multiple sclerosis (MS), are more frequently observed in younger patients. It is crucial to distinguish between these 2 etiologies. Furthermore, in cases where multiple individuals exhibit WMLs within 1 family, genetic testing may offer a significant diagnostic perspective. PATIENT CONCERNS: A 25-year-old male presented to the Department of Neurology with recurrent headaches. He was healthy previously and the neurological examination was negative. Brain magnetic resonance imaging (MRI) showed widespread white matter hyperintensity lesions surrounding the ventricles and subcortical regions on T2-weighted and T2 fluid-attenuated inversion recovery images, mimicking immunogenic disease-MS. DIAGNOSES: The patient was diagnosed with a patent foramen ovale, which could explain his headache syndrome. Genetic testing unveiled a previously unidentified missense mutation in the SERPINC1 gene in the patient and his father. The specific abnormal laboratory finding was a reduction in antithrombin III activity, and the decrease may serve as the underlying cause for the presence of multiple intracranial WMLs observed in both the patient and his father. INTERVENTIONS: The patient received percutaneous patent foramen ovale closure surgery and took antiplatelet drug recommended by cardiologists and was followed up for 1 month and 6 months after operation. OUTCOMES: While the lesions on MRI remain unchanging during follow-up, the patient reported a significant relief in headaches compared to the initial presentation. LESSONS: This case introduces a novel perspective on the etiology of cerebral WMLs, suggesting that hereditary antithrombin deficiency (ATD) could contribute to altered blood composition and may serve as an underlying cause in certain individuals with asymptomatic WMLs.

[Phenotypic and genetic analysis of a Chinese pedigree affected with Hereditary antithrombin deficiency due to a novel variant of SERPINC1 gene].

OBJECTIVE: To analyze the clinical phenotype and genetic characteristics of a Chinese pedigree affected with Hereditary antithrombin deficiency. METHODS: A pedigree diagnosed at the the Second Affiliated Hospital of Wenzhou Medical University, Yuying Children's Hospital in June, 2020 was selected as the study subject. Plasma prothrombin time (PT), activated partial thromboplastin time (APTT), fibrinogen (FIB), and thrombin time (TT) of the probands and their pedigree members were determined using a STA-R automatic coagulation analyzer. Antithrombin activity (AT: A) and antithrombin antigen (AT: Ag) in plasma were determined with chromogenic substrate and immunonephelometry assays. All exons and flanking sequences of the anticoagulant protein gene SERPINC1 were amplified by PCR and subjected to Sanger sequencing. Candidate variants were verified with bioinformatic tools (PolyPhen-2, SIFT, Mutation Taster and PYMOL) to explore their effect on the function and structural conformation of the protein. RESULTS: The probands (II-2, II-10), their brother (II-5) and sons (III-1, III-8) had shown normal PT, APTT, FIB, and TT, but significantly decreased AT: A and AT: Ag, with their levels being 34%, 57%, 56%, 48%, 53% and 13.51 mg/dL, 13.44 mg/dL, 18.39 mg/dL, 17.36 mg/dL, 17.71 mg/dL, respectively. The remaining pedigree members had normal values. Sanger sequencing revealed that the probands and all affected pedigree members had harbored a heterozygous c.851T>C (p.Met284Thr) missense variant in exon 5 of the SERPINC1 gene. Bioinformatic analysis and simulation suggested that the variant has resulted in alteration of hydrogen bonds at the c.851 position, which may affect the structure of the protein. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was classified as pathogenic (PS1+PM1+PM5+PP1+PP4). CONCLUSION: The probands and other affected members were all diagnosed with type I hereditary AT deficiency, for which the c.851T>C (p.Met284Thr) variant of the SERPINC1 gene may be accountable.

Effect of prothrombin Belgrade mutation, causing antithrombin resistance, on fibrin clot properties.

INTRODUCTION: Prothrombin Belgrade mutation is the result of the c.1787G>A substitution in the prothrombin gene. It is located in the antithrombin and sodium binding site and leads to impaired inactivation of thrombin by antithrombin, resulting in antithrombin resistance and thrombotic disorders. However, it negatively affects sodium binding and may have hypocoagulant effects. Considering that prothrombin Belgrade mutation mechanism is still not fully elucidated and that sodium binding is important for thrombin affinity towards fibrinogen, our aim was to determine whether this mutation affects fibrin clot formation and lysis. METHODS: Using HEK293T cell line, recombinant wild type and mutated prothrombin were generated by transient transfection. Samples that correspond to plasma of a non-carrier, heterozygous and homozygous carriers were reconstituted using prothrombin deficient plasma and recombinant proteins. Reconstituted samples were used in OHP assay (Overall Hemostasis Potential) to determine kinetic profiles of coagulation and fibrinolysis. Clot turbidity assay was performed to observe kinetics of clot formation and lysis more closely. Fibrin clots formed in reconstituted plasma samples were analyzed by confocal microscopy to determine density of fibrin network. Fibrin clots were additionally observed using electron microscopy to determine thickness of individual fibrin fibers. RESULTS: No significant difference found in OHP, OCP, OFP, and fibrin network density between wild type, heterozygous, and homozygous carrier reconstituted plasma samples. There were significant differences between samples for slope and slope time parameters in kinetic profiles and fibrin fiber thickness. CONCLUSIONS: Results indicate that prothrombin Belgrade mutation has no significant impact on fibrinolysis, however it may affect kinetics of clot formation and its architecture.

Clinical and functional characterization of rare compound heterozygous mutations in the SERPINC1 gene causing severe thrombophilia.

INTRODUCTION: Hereditary antithrombin (AT) deficiency is a rare autosomal dominant disorder with significant clinical heterogeneity. In the study, we identified a patient with AT deficiency caused by compound heterozygous mutations in the SERPINC1 gene. METHODS: A total of 9 individuals from three generations were investigated. The mutations were identified by direct sequencing of SERPINC1. Multiple in silico tools were programmed to predict the conservation of mutations and the effect on the AT structure. The coagulation state was evaluated by the thrombin generation assay. Recombinant AT was overexpressed in HEK293T cells; the mRNA level was determined using RT-qPCR. Western blotting, ELISA, and immunocytofluorescence were applied to characterize the recombinant AT protein. RESULTS: The proband was a 26-year-old male who experienced recurrent venous thrombosis. He presented the type I deficiency with 33 % AT activity and a synchronized decrease in AT antigen. Genetic screening revealed that he carried a heterozygous c.318_319insT (p.Asn107*) in exon 2 and a heterozygous c.922G > T (p.Gly308Cys) in exon 5, both of which were completely conserved in homologous species and resulted in enhanced thrombin generation capability. Hydrophobicity analysis suggested that the p.Gly308Cys mutation may interfere with the hydrophobic state of residues 307-313. In vitro expression studies indicated that the levels of the recombinant protein AT-G308C decreased to 46.98 % ± 2.94 % and 41.35 % ± 1.48 % in transfected cell lysates and media, respectively. After treatment with a proteasome inhibitor (MG132), the quantity of AT-G308C protein in the cytoplasm was replenished to a level comparable to that of the wild type. The mRNA level of AT-N107* was significantly reduced and the recombinant protein AT-N107* was not detected in either the lysate or the culture media. CONCLUSION: These two mutations were responsible for the AT defects and clinical phenotypes of the proband. The p.Gly308Cys mutation could lead to proteasome-dependent degradation of the AT protein in the cytoplasm by altering local residue hydrophobicity. The c.318_319insT could eliminate aberrant transcripts by triggering nonsense-mediated mRNA degradation. Both mutations resulted in type I AT deficiency.

Functional analysis of two abnormal antithrombin proteins with different intracellular kinetics.

INTRODUCTION: Hereditary antithrombin (AT) deficiency type I causes venous thrombosis due to decreased levels of AT antigen in the blood. We identified one novel and one known abnormal variant in two unrelated Japanese families with venous thrombosis. In this study, we analyzed the mechanism by which these abnormal variants cause type I AT deficiency. MATERIALS AND METHODS: Wild-type and variant AT expression vectors were constructed and transiently expressed in human embryonic kidney 293 cells, and AT antigen levels and N-glycosylation of cell lysates and culture medium were evaluated by western blot analysis. Subcellular co-localization of AT was also examined using confocal microscopy, and chase experiments with cycloheximide and MG132 were performed to investigate the degradation pathway of AT variants. RESULTS: Genetic analysis identified a novel variant, c.613delC (p.Leu205Trpfs⁎79), and the known variant c.283T>C (p.Tyr95His). These AT variants exhibited significantly reduced extracellular secretion compared with the wild-type; N-glycosylation of the AT protein was normal. Co-localization analysis suggested that the transport of these abnormal AT proteins to the Golgi apparatus was impaired. The c.613delC variant was degraded early by the proteasome, suggesting that the c.283T>C variant is stored in the endoplasmic reticulum (ER). CONCLUSIONS: The AT variants identified here synthesize abnormal AT proteins that exhibit suppressed secretion and impaired transport from the ER to the Golgi apparatus. These results provide clues that could help elucidate the mechanism of type I AT deficiency and facilitate therapy development.

Impact of Increased Activated Protein-C Resistance, Decreased Antithrombin III Activity and Hypocomplementemia on the Gestational Outcomes of Pregnancies with MTHFR Polymorphisms.

OBJECTIVE: To evaluate the impact of increased Activated Protein C (APC) resistance, decreased antithrombin III activity and hypocomplementemia on the pregnancy outcomes of the patients with methylentetrahydrofolate reductase (MTHFR) polymorphisms. METHODS: This study was composed of 83 pregnancies with MTHFR polymorphisms. Increased APC resistance, decreased antithrombin III activity and hypocomplementemia were accepted as risk factors for poor gestational outcome. RESULTS: Having at least one risk factor resulted in significantly higher rates of "APGAR score of<7" at the first ten minutes (p=0.009). Composite adverse outcome rate was also higher in patients with at least one of the defined risk factors despite lack of statistical significance (p=0.241). Rate of newborn with an "APGAR score of<7" at first ten minutes was significantly higher at patients with hypocomplementemia (p=0.03). CONCLUSION: Hypocomplementemia is a risk factor for poor gestational outcome in pregnancies with MTHFR polymorphisms.

Human induced pluripotent stem cells derived from a patient with a mutation of SERPINC1 c.236G>A (p.R79H).

Mutation of SERPINC1 is related to the incidence of Inherited antithrombin (AT) deficiency. In this study, we generated a human induced pluripotent stem cell (iPSC) line from peripheral blood mononuclear cells of a patient with a mutation of SERPINC1 c.236G>A (p.R79H). The generated iPSCs express pluripotent cell markers with no mycoplasma contamination. Besides, it has a normal female karyotype and could differentiate into all three germ layers in vitro.

Antithrombin, Protein C, and Protein S: Genome and Transcriptome-Wide Association Studies Identify 7 Novel Loci Regulating Plasma Levels.

BACKGROUND: Antithrombin, PC (protein C), and PS (protein S) are circulating natural anticoagulant proteins that regulate hemostasis and of which partial deficiencies are causes of venous thromboembolism. Previous genetic association studies involving antithrombin, PC, and PS were limited by modest sample sizes or by being restricted to candidate genes. In the setting of the Cohorts for Heart and Aging Research in Genomic Epidemiology consortium, we meta-analyzed across ancestries the results from 10 genome-wide association studies of plasma levels of antithrombin, PC, PS free, and PS total. METHODS: Study participants were of European and African ancestries, and genotype data were imputed to TOPMed, a dense multiancestry reference panel. Each of the 10 studies conducted a genome-wide association studies for each phenotype and summary results were meta-analyzed, stratified by ancestry. Analysis of antithrombin included 25 243 European ancestry and 2688 African ancestry participants, PC analysis included 16 597 European ancestry and 2688 African ancestry participants, PSF and PST analysis included 4113 and 6409 European ancestry participants. We also conducted transcriptome-wide association analyses and multiphenotype analysis to discover additional associations. Novel genome-wide association studies and transcriptome-wide association analyses findings were validated by in vitro functional experiments. Mendelian randomization was performed to assess the causal relationship between these proteins and cardiovascular outcomes. RESULTS: Genome-wide association studies meta-analyses identified 4 newly associated loci: 3 with antithrombin levels (GCKR, BAZ1B, and HP-TXNL4B) and 1 with PS levels (ORM1-ORM2). transcriptome-wide association analyses identified 3 newly associated genes: 1 with antithrombin level (FCGRT), 1 with PC (GOLM2), and 1 with PS (MYL7). In addition, we replicated 7 independent loci reported in previous studies. Functional experiments provided evidence for the involvement of GCKR, SNX17, and HP genes in antithrombin regulation. CONCLUSIONS: The use of larger sample sizes, diverse populations, and a denser imputation reference panel allowed the detection of 7 novel genomic loci associated with plasma antithrombin, PC, and PS levels.

Impact of SERPINC1 mutation on thrombotic phenotype in children with congenital antithrombin deficiency-first analysis of the International Society on Thrombosis and Haemostasis pediatric antithrombin deficiency database and biorepository.

BACKGROUND: The natural history and genotype-phenotype correlation of congenital antithrombin (AT) deficiency in children are unknown. OBJECTIVES: To describe the clinical presentation of congenital AT deficiency in children and evaluate its correlation to specific mutations in SERPINC1. METHODS: In 2017, a prospective pediatric database and DNA biorepository for congenital AT deficiency was established. During the pilot phase, the database was opened at 4 tertiary care centers in Canada and US. Approval from research ethics board was obtained at each participating center. Written consent/assent was obtained from guardians/subjects who met eligibility. Demographic/clinical data were uploaded into a database. DNA extraction and SERPINC1 sequencing were centralized for US centers. Standard statistical methods were used to summarize parameters. Probability of VTE-free survival was assessed using the Kaplan-Meier method. RESULTS: Overall, 43 participants (25 females) from 31 unique kindreds were enrolled. Median age (range) at enrollment was 14.8 years (1-21 years). Median AT activity was 52% (24%-87%), and median AT antigen (n = 20) was 55% (38%-110%). Nineteen (44%) participants had a history of venous thromboembolism (VTE). Median age at VTE diagnosis was 12.8 years (0.1-19.2 years). SERPINC1 sequencing was completed for 31 participants and 21 unique mutations were identified, including 5 novel variants. Probability of 5-year VTE-free survival (95% CI) for carriers of missense mutations (92.0% [95% CI: 71.6%-97.9%]) was significantly higher compared with carriers of null mutations (66.7% [95% CI: 19.5%-90.4%]); p = .0012. CONCLUSION: To our knowledge, this is the first pediatric study to document a severe thrombotic phenotype in carriers of null mutations in SERPINC1, when compared with carriers of missense mutations; underscoring the importance of genetic testing.

Identification and functional analysis of three novel genetic variants resulting in premature termination codons in three unrelated patients with hereditary antithrombin deficiency.

Hereditary antithrombin (AT) deficiency is an autosomal dominant inherited thrombophilia. In three pedigrees of hereditary type I AT deficiency, we identified novel variants c.126delC (p.Lys43Serfs*7), c.165C > G (p.Tyr55*), and c.546delA (p.Lys182Asnfs*102) in the open reading frame encoding AT in each patient. Each of these aberrant variants leads to premature termination of AT protein synthesis. To investigate whether these abnormal variants are involved in the pathogenesis of type I AT deficiency, we analyzed the function of these variants in HEK293 cells. Results of western blot analysis and immunofluorescence microscopy showed that all abnormal variants were expressed intracellularly, but p.Lys43Serfs*7 and p.Tyr55* protein were aggregated in the cells. These three variants were not detected in the spent culture medium, indicating that these novel variants affect protein secretion. In summary, we suggest that these variants in the AT-encoding gene are translated in the cell, but form abnormal proteins that form aggregates and/or inhibit secretion. These results provide insight into novel mechanisms of type I AT deficiency and potential therapies for the condition.

Assessment of breast cancer progression and metastasis during a hypercoagulable state induced by silencing of antithrombin in a xenograft mouse model.

Local coagulation activation has been shown to impact both primary tumor growth and metastasis in mice. It is well known that components of the blood clotting cascade such as tissue factor and thrombin play a role in tumor progression by activating cellular receptors and local formation of fibrin. However, whether venous thromboembolism (VTE) or a hypercoagulable state has a direct impact on cancer progression is unknown. Here we have combined an orthotopic murine breast cancer model, using female Nod-SCID mice, with siRNA-mediated silencing of antithrombin (siAT) leading to the induction of a systemic hypercoagulable state. We show that, compared to control siRNA-treated (not experiencing a hypercoagulable state) tumor-bearing mice, siAT treated tumor-bearing mice do not show enhanced tumor growth nor enhanced metastasis. We conclude that, in this murine model for hypercoagulability, induction of a hypercoagulable state does not contribute to breast cancer progression.

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report.

RATIONALE: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. PATIENT CONCERNS: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. DIAGNOSES: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). INTERVENTIONS: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. OUTCOMES: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. LESSONS: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.