Marfan syndrome: whole-exome sequencing reveals de novo mutations, second gene and genotype-phenotype correlations in the Chinese population.

Marfan syndrome (MFS) is a dominant monogenic disease caused by mutations in fibrillin 1 (FBN1). Cardiovascular complications are the leading causes of mortality among MFS. In the present study, a whole-exome sequencing of MFS in the Chinese population was conducted to investigate the correlation between FBNI gene mutation and MFS. Forty-four low-frequency harmful loci were identified for the FBN1 gene in HGMD database. In addition, 38 loci were identified in the same database that have not been related to MFS before. A strict filtering and screening protocol revealed two patients of the studied group have double mutations in the FBN1 gene. The two patients harboring the double mutations expressed a prominent, highly pathological phenotype in the affected family. In addition to the FBN1 gene, we also found that 27 patients had mutations in the PKD1 gene, however these patients did not have kidney disease, and 16 of the 27 patients expressed aortic related complications. Genotype-phenotype analysis showed that patients with aortic complications are older in the family, aged between 20 and 40 years.

A nonsense variant in FBN1 caused autosomal dominant Marfan syndrome in a Chinese family: a case report.

BACKGROUND: Marfan syndrome (MFS) is a common autosomal dominant inherited disease, and the occurrence rate is around 0.1-0.2‰. The causative variant of FNB1 gene accounts for approximately 70-80% of all MFS cases. In this study, we found a heterozygous c.3217G > T (p.Glu1073*) nonsense variant in the FBN1 gene. This finding extended the variant spectrum of the FBN1 gene and will provide a solution for patients to bear healthy offspring by preimplantation genetic testing or prenatal diagnosis. CASE PRESENTATION: The patient was treated due to tachycardia during excitement in a hospital. Echocardiography showed dilatation of the ascending aorta and main pulmonary artery, mitral regurgitation (mild), tricuspid regurgitation (mild), and abnormal left ventricular filling. Electrocardiograph showed sinus rhythm. In addition, flutters of shadows in front of his eyes and vitreous opacity were present in the patient. Genomic DNA was extracted from peripheral blood samples from members of the family and 100 unrelated controls. Potential variants were screened out by next-generation sequencing and confirmed by MLPA & Sanger sequencing. Real-time fluorescence quantitative PCR (RT-qPCR) was performed to detect the relative mRNA quantitation in the patient. A heterozygous nonsense variant c.3217G > T of the FBN1 gene, which resulted in p. Glu1073Term, was identified in both patients. Only wild type bases were found in the cDNA sequence of the patient. Real-time fluorogenic quantitative PCR results showed that the relative expression level of FBN1 cDNA in the patient was only about 21% compared to that of normal individuals. This variant c.3217G > T of the FBN1 gene introduces a Stop codon in the cb-EGF12 domain. We speculated that a premature translational-termination codon (PTC) was located in the mRNA and the target mRNA was disintegrated through a process known as nonsense-mediated mRNA decay (NMD), which led to a significant decrease of the fibrillin-1 protein, eventually causing clinical symptoms in the patient. CONCLUSIONS: In this study, we found a heterozygous c.3217G > T (p.Glu1073*) nonsense variant in the FBN1 gene, which eventually led to Marfan syndrome in a Chinese family.

Detection of ten novel FBN1 mutations in Chinese patients with typical or incomplete Marfan syndrome and an overview of the genotype-phenotype correlations.

OBJECTIVE: The aim of this study is to identify the mutation spectrum of FBN1 in patients with Marfan syndrome (MFS) or Marfan-Like Phenotypes and to analyze the genotype-phenotype correlations of existing literature. METHODS AND RESULTS: A total of 21 unrelated patients with a definite or suspected clinical diagnosis of MFS were recruited for research. Eleven FBN1 mutations were identified in 12 patients who strictly fulfilled the Ghent criteria for MFS, and 1 FBN1 mutations were detected in 9 patients with suspected MFS by screening the mutations of FBN1. These FBN1 mutations include 10 novel mutations (c.357 C>A, c.493 C>T, c.1374 T>A, c.4143 delG, c. 6987 C>G, c.7238 G>A, c. 7765 A>G, c.8200 A>G, c. 8431 G>A, c.8547 T>G,) and 2 previously reported mutations (c.4567 C>T, c.4615 C>T). By searching PubMed and Embase (from 1990 up to December 2018), twenty nine studies (including the present study) with 890 subjects with MFS or Marfan-like phenotypes were included to analyze the genotype-phenotype correlations. Several genotype-phenotype correlations were founded. Firstly, mutations of premature termination codons (PTC) were associated with an increased risk of major cardiovascular involvements. Secondly, the frequency of patients with major cardiovascular involvement in exons 43-65 group was as high as that in exons 24-32 group (71.4% vs. 77.0%; p = 0.238). Finally, cysteine missense mutations might be associated with major cardiovascular involvements. CONCLUSIONS: These results extended the FBN1 mutation spectrum of this rare disease and revealed the genotype-phenotype correlations in MFS by analyzing existing literature.

Cross-ancestry genome-wide association analysis of corneal thickness strengthens link between complex and Mendelian eye diseases.

Central corneal thickness (CCT) is a highly heritable trait associated with complex eye diseases such as keratoconus and glaucoma. We perform a genome-wide association meta-analysis of CCT and identify 19 novel regions. In addition to adding support for known connective tissue-related pathways, pathway analyses uncover previously unreported gene sets. Remarkably, >20% of the CCT-loci are near or within Mendelian disorder genes. These included FBN1, ADAMTS2 and TGFB2 which associate with connective tissue disorders (Marfan, Ehlers-Danlos and Loeys-Dietz syndromes), and the LUM-DCN-KERA gene complex involved in myopia, corneal dystrophies and cornea plana. Using index CCT-increasing variants, we find a significant inverse correlation in effect sizes between CCT and keratoconus (r = -0.62, P = 5.30 × 10-5) but not between CCT and primary open-angle glaucoma (r = -0.17, P = 0.2). Our findings provide evidence for shared genetic influences between CCT and keratoconus, and implicate candidate genes acting in collagen and extracellular matrix regulation.

Increased frequency of FBN1 truncating and splicing variants in Marfan syndrome patients with aortic events.

PURPOSE: Marfan syndrome is a systemic disorder that typically involves FBN1 mutations and cardiovascular manifestations. We investigated FBN1 genotype-phenotype correlations with aortic events (aortic dissection and prophylactic aortic surgery) in patients with Marfan syndrome. METHODS: Genotype and phenotype information from probands (n = 179) with an FBN1 pathogenic or likely pathogenic variant were assessed. RESULTS: A higher frequency of truncating or splicing FBN1 variants was observed in Ghent criteria-positive patients with an aortic event (n = 34) as compared with all other probands (n = 145) without a reported aortic event (79 vs. 39%; P < 0.0001), as well as Ghent criteria-positive probands (n = 54) without an aortic event (79 vs. 48%; P = 0.0039). Most probands with an early aortic event had a truncating or splicing variant (100% (n = 12) and 95% (n = 21) of patients younger than 30 and 40 years old, respectively). Aortic events occurred at a younger median age in patients with truncating/splicing variants (29 years) as compared with those with missense variants (51 years). A trend toward a higher frequency of truncating/splicing variants in patients with aortic dissection (n = 21) versus prophylactic surgery (n = 13) (85.7 vs. 69.3%; not significant) was observed. CONCLUSION: These aortic event- and age-associated findings may have important implications for the management of Marfan syndrome patients with FBN1 truncating and splicing variants.Genet Med 17 3, 177-187.

Circulating transforming growth factor ß-1 level in Japanese patients with Marfan syndrome.

Marfan syndrome (MFS) is an inherited connective tissue disorder mainly caused by the fibrillin-1 mutation. Deficient fibrillin-1 is thought to result in the failed sequestration of transforming growth factor ß (TGFß) and subsequent activation of the TGFß signaling pathway, suggesting that the circulating TGFß level may be elevated in MFS, although its accurate measurement is complex due to ex vivo release from platelet stores upon platelet activation. We measured the plasma TGFß1 levels of 32 Japanese MFS patients (22 medically untreated, 10 treated, 20 males, 30.1 ± 9.6 years old) and 30 healthy volunteers (19 males, 29.5 ± 5.8 years old) by ruthenium-based electrochemiluminescence platform (ECL). PF4 was also measured by enzyme immunoassay (EIA) as a platelet degranulation marker. There was no significant difference in the mean plasma TGFß1 level between the MFS group (1.31 ± 0.40 ng/mL) and controls (1.17 ± 0.33 ng/mL) (P = 0.16, NS). Also, there was no significant difference between the untreated (1.24 ± 0.37 ng/mL) and treated (1.46 ± 0.45 ng/mL) MFS patients (P = 0.15, NS). We also measured PF4, which showed wide deviations but no significant difference between the two groups (P = 0.50). A difference in circulating TGFß1 levels between MFS patients and controls was not detected in this Japanese population. Circulating TGFß1 is not a diagnostic and therapeutic marker for Japanese MFS patients, although our findings do not eliminate the possible association of TGFß with the pathogenesis of MFS.

[Two novel mutations of FBN1 gene in the patients with MFS among Han population].

To detect the mutations of fibrillin-1 (FBN1) gene in the patients with Marfan syndrome (MFS), polymerase chain reaction (PCR) and denaturing high-performance liquid chromatography (DHPLC) were conducted to screen for the mutations in FBN1 gene. Sequence analyses were carried out when the DNA amplification fragments of the DHPLC elution profiles showed difference from the corresponding normal elution profile. Two novel mutations were detected in two families with MFS, respectively. One was a multiplex mutation in exon 55 containing a deletion mutation c.6862_6871delGGCTGTGTAG (p.Gly2288MetfsX109), a synonymous mutation (c.6861A>G) and an intronic mutation c.[6871+1_6871+11delGTAAGAGGATC; 6871+34dupCATCAGAAGTGACAGTGGACA], and the other was a missense mutation in exon 20 c.2462G>A (p.Cys821Tyr). The results indicated that the deletion mutation c.[6862_6871delGGCTGT GTAG; 6871+1_6871+11delGTAAGAGGATC] (p.Gly2288MetfsX109) and the missense mutation c.2462G>A (p.Cys821Tyr) of FBN1 gene may cause the two family patients with MFS respectively.

Clinical and genetic analysis of Korean patients with Marfan syndrome: possible ethnic differences in clinical manifestation.

Marfan syndrome (MFS) is an autosomal dominant disorder of the fibrous connective tissue caused by mutations in the fibrillin-1 (FBN1) gene. Although clinical and genetic analyses have been performed in various populations, there have been few studies in Korea. The aim of this study was to investigate the clinical characteristics and genetic background of Korean patients with MFS. In 39 Korean patients with MFS who met the Ghent criteria, the most common clinical finding was aortic dilatation and/or dissection (94.9%), whereas only 35.9% of patients had ectopia lentis. The majority of MFS patients had fewer than four of the skeletal findings required to fulfill the major skeletal Ghent criterion for MFS. Only 21% of Korean patients had major skeletal abnormalities and most cases showed only minor skeletal involvement. FBN1 gene mutations were detected in 35 out of 39 patients (89.7%), which is similar to rates presented in the previous reports. These results suggest that some clinical features in Korean patients with MFS differed from those reported in Western MFS patients.

Paucity of skeletal manifestations in Hispanic families with FBN1 mutations.

Marfan syndrome (MFS) is an autosomal dominant condition with pleiotropic manifestations involving the skeletal, ocular, and cardiovascular systems. The diagnosis is based primarily on clinical involvement of these and other systems, referred to as the Ghent criteria. We have identified three Hispanic families from Mexico with cardiovascular and ocular manifestations due to novel FBN1 mutations but with paucity of skeletal features. The largest family, hMFS001, had a frameshift mutation in exon 24 (3075delC) identified as the cause of aortic disease in the family. Assessment of eight affected adults revealed no major skeletal manifestation of MFS. Family hMFS002 had a missense mutation (R1530C) in exon 37. Four members fulfilled the criteria for ocular and cardiovascular phenotype but lacked skeletal manifestations. Family hMFS003 had two consecutive missense FBN1 mutations (C515W and R516G) in exon 12. Eight members fulfilled the ocular criteria for MFS and two members had major cardiovascular manifestations, however none of them met criteria for skeletal system. These data suggest that individuals of Hispanic descent with FBN1 mutations may not manifest skeletal features of the MFS to the same extent as Caucasians. We recommend that echocardiogram, ocular examination and FBN1 molecular testing be considered for any patients with possible MFS even in the absence of skeletal features, including Hispanic patients.

Marfan syndrome in a large family: response of family members to a screening programme.

Reaction to medical, social, and genetic implications of Marfan syndrome was evaluated by means of two questionnaires, the first after various tests before discussion of the diagnosis, the second after full discussion of the patient's diagnosis. Thirty-seven members of a family known to be at risk for Marfan syndrome attended for both questionnaires. All patients claimed to be satisfied with the way they were informed of the results of screening; 41% of patients were more worried about their health and 48% were more worried about the future after diagnosis. Apart from 50% of the smokers reducing or stopping their intake of cigarettes there were only very minor changes in lifestyle over the first month despite the increased level of expressed anxiety. If a definitive screening test was available, 96% of patients claimed they would have chosen it, 45% felt it would have an influence on their future plans, and 78% would choose to use a method of prenatal diagnosis for Marfan syndrome if it were available.