ABSTRACT
INTRODUCTION: Infantile nystagmus and foveal hypoplasia associated with AHR gene defects is a newly recognized and rare disorder. Our aim was to present a patient with a novel biallelic AHR pathogenic variant with electrophysiological evidence of chiasmal misrouting. MATERIALS AND METHODS: Complete ocular examination, fundus imaging, visual evoked potentials (VEP) and full-field electroretinography were performed at initial presentation. Genetic testing was performed by whole exome sequencing. RESULTS: Female patient of 6 years old presented a reduced best corrected visual acuity, an infantile nystagmus and a grade III typical foveal hypoplasia without ocular hypopigmentation. A crossed asymmetry was discovered on pattern onset/offset VEP. Genetic testing put in evidence a novel homozygous variant in AHR: c.2242del, p. (Gln748Lysfs*5). During 11-years follow-up period, BCVA gradually improved. There was no evidence of retinal degeneration. CONCLUSION: AHR gene defects could be associated with infantile nystagmus, foveal hypoplasia and chiasmal misrouting.
Subject(s)
Electroretinography , Evoked Potentials, Visual , Fovea Centralis , Nystagmus, Congenital , Humans , Female , Fovea Centralis/abnormalities , Nystagmus, Congenital/genetics , Nystagmus, Congenital/physiopathology , Nystagmus, Congenital/diagnosis , Child , Receptors, Aryl Hydrocarbon/genetics , Basic Helix-Loop-Helix Transcription Factors/genetics , Visual Acuity/physiology , Repressor Proteins/genetics , Tomography, Optical CoherenceABSTRACT
PURPOSE: To evaluate the effect of topical carbonic anhydrase inhibitor (brinzolamide) versus placebo on visual function and waveforms in infantile nystagmus syndrome (INS). DESIGN: Prospective, placebo-controlled, double-blind, cross-over study. METHODS: Setting- A tertiary eye care center. Patients- Cases of idiopathic INS with and without abnormal head posture aged ≥10 years who had not received previous treatment for nystagmus. Intervention- Patients were randomized into two groups. Group 1 was given placebo for 3 months, and after a washout period of 7 days started on topical brinzolamide for the next 3 months. In group 2, the order was reversed. The drops were administered topically three times (every 8 hours) in both eyes. Outcome measure- Binocular best corrected visual acuity (BCVA) using the ETDRS chart, eXpanded nystagmus acuity function (NAFX) score and INS waveforms obtained from eye movement recordings, intraocular pressure (IOP) by Goldmann applanation tonometer, near stereopsis by TNO stereo test, and change in abnormal head posture before and after intervention in the null position. RESULTS: A total of 29 cases completed the study (23 with abnormal head posture; 6 without abnormal head posture).A significant improvement was noted in INS waveform characteristics, mean NAFX score (P < 0.001), and mean binocular visual acuity (P < 0.001) with topical brinzolamide in comparison to baseline as well as placebo. No significant change in head position and stereopsis was noted. No side effects were reported with 3 months of brinzolamide therapy. CONCLUSIONS: While brinzolamide shows improvement in visual acuity and NAFX score in idiopathic INS, its clinical significance needs further evidence.
Subject(s)
Administration, Topical , Carbonic Anhydrase Inhibitors , Cross-Over Studies , Ophthalmic Solutions , Sulfonamides , Thiazines , Visual Acuity , Humans , Carbonic Anhydrase Inhibitors/administration & dosage , Carbonic Anhydrase Inhibitors/therapeutic use , Double-Blind Method , Male , Female , Visual Acuity/physiology , Prospective Studies , Thiazines/administration & dosage , Sulfonamides/administration & dosage , Child , Adult , Ophthalmic Solutions/administration & dosage , Adolescent , Nystagmus, Congenital/drug therapy , Nystagmus, Congenital/physiopathology , Nystagmus, Congenital/diagnosis , Treatment Outcome , Young Adult , Follow-Up Studies , Middle Aged , Eye Movements/physiology , Eye Movements/drug effects , Vision, Binocular/physiologyABSTRACT
BACKGROUND: Infantile nystagmus syndrome can be associated with an afferent problem (anterior or posterior segment) or constitute an isolated idiopathic disorder. With a normal ophthalmic examination, current guidelines recommend electroretinography (ERG) rather than magnetic resonance (MRI) for preliminary workup. Given the limited use of optical coherence tomography (OCT) in preverbal children, the purpose of this study was to evaluate the role of handheld OCT (HH-OCT) in the initial diagnostic evaluation of infantile nystagmus. METHODS: In this cross-sectional case series, the medical records of all children with infantile nystagmus and HH-OCT imaging at the Duke Eye Center from August 2016 to July 2021 were retrospectively reviewed. Children with anterior segment disorders or obvious retina/optic nerve structural pathology, bilateral ophthalmoplegia, or Down syndrome were excluded. Two masked pediatric ophthalmologists graded HH-OCT images for optic nerve head and macular abnormalities. A neuro-ophthalmologist reviewed clinical findings of each patient's presenting visit and recommended appropriate testing (MRI vs ERG), initially without, and again with HH-OCT image review. RESULTS: A total of 39 cases were included, with mean presenting age of 1.3 years. Final diagnoses included retinal or foveal abnormalities (7), optic nerve pathology (13), idiopathic (10), or unknown (9). HH-OCT findings included optic nerve hypoplasia (1), optic nerve elevation (3), persistence of the inner layers at the fovea (9), thin ganglion cell layer (8), ellipsoid zone abnormality (3), and thin choroid (1). HH-OCT findings altered initial clinical-only management in 16 cases (41%), including avoiding MRI (5) and ERG (10) testing. CONCLUSIONS: Our results suggest that HH-OCT has the potential to augment and streamline the evaluation of infantile nystagmus.
Subject(s)
Nystagmus, Congenital , Tomography, Optical Coherence , Humans , Tomography, Optical Coherence/methods , Cross-Sectional Studies , Retrospective Studies , Female , Male , Child, Preschool , Nystagmus, Congenital/physiopathology , Nystagmus, Congenital/diagnosis , Infant , Child , Electroretinography , Magnetic Resonance Imaging/methods , Optic Disk/diagnostic imaging , Optic Disk/pathologyABSTRACT
PURPOSE: Mutations of G protein-coupled receptor 143 (GPR143) and FERM domain containing 7 (FRMD7) may result in congenital nystagmus (CN) in the first 6 months of life. We aimed to compare the differences in ocular oscillations between patients with these two gene mutations as well as the functional and structural changes in their retinas and visual pathways. METHODS: Medical records were retrospectively reviewed to identify patients of congenital nystagmus with confirmed mutations in either GPR143 or FMRD7 genes from January 2018 to May 2023. The parameters of the ocular oscillations were recorded using Eyelink 1000 Plus. The retinal structure and function were evaluated using optical coherence tomography and multi-focal electroretinography (mERG). The visual pathway and optical nerve projection were evaluated using visual evoked potentials. The next-generation sequencing technique was used to identify the pathogenic variations in the disease-causing genes for CN. RESULTS: Twenty nystagmus patients of GPR143 and 21 patients of FMRD7 who had been confirmed by molecular testing between January 2018 and May 2023 were included. Foveal hypoplasia was detected only in patients with the GPR143 pathogenic variant. mERG examination showed a flat response topography in the GPR143 group compared to the FRMD7 group. VEP showed that bilateral amplitude inconsistency was detected only in the patients with GPR143 gene mutation. The amplitude and frequency of the ocular oscillations were not found to differ between patients with two different genetic mutations. CONCLUSIONS: Although the etiology and molecular mechanisms are completely different between CN patients, they may have similar ocular oscillations. A careful clinical examination and electrophysiological test will be helpful in making a differential diagnosis. Our novel identified variants will further expand the spectrum of the GPR143 and FRMD7 variants.
Subject(s)
Cytoskeletal Proteins , Membrane Proteins , Nystagmus, Congenital , Female , Humans , Male , Cytoskeletal Proteins/genetics , DNA/genetics , DNA Mutational Analysis , Electroretinography , Evoked Potentials, Visual/physiology , Eye Movements/physiology , Eye Proteins/genetics , Membrane Glycoproteins/genetics , Membrane Proteins/genetics , Mutation , Nystagmus, Congenital/genetics , Nystagmus, Congenital/physiopathology , Nystagmus, Congenital/diagnosis , Retina/physiopathology , Retrospective Studies , Tomography, Optical Coherence/methodsABSTRACT
PURPOSE: To identify the ophthalmic causes of congenital nystagmus with normal eye examination by electroretinography (ERG). STUDY DESIGN: Retrospective observational study. METHODS: We reviewed the medical records of patients younger than 6 months of age who presented between June 2008 and November 2011 with nystagmus and no other neurological signs following an otherwise normal eye examination. A complete ophthalmic examination and ERG (Nicolet Bravo system; Nicolet Biomedial & RETIscan; Roland Instruments), fundus photography, and Ishihara color test were performed to identify any ophthalmic causes of congenital nystagmus. RESULTS: Thirty-three patients met the criteria. Rod dysfunction was diagnosed in 4 patients (12.1%), cone dysfunction in 2 patients (6.1%), and cone-rod dysfunction in 1 patient (3.0%). The results of ERG were negative in 2 patients (6.1%). Idiopathic infantile nystagmus was diagnosed in the remaining 24 patients (72.7%) based on their normal ERG examination. CONCLUSIONS: In Korean congenital nystagmus patients with a normal fundus examination, achromatopsia and Leber's congenital amaurosis are uncommon causes. ERG is needed to make a definite diagnosis and provide prognostic information in congenital idiopathic nystagmus patients with a normal fundus examination.
Subject(s)
Electroretinography , Fundus Oculi , Nystagmus, Congenital , Humans , Electroretinography/methods , Retrospective Studies , Female , Male , Nystagmus, Congenital/physiopathology , Nystagmus, Congenital/diagnosis , Infant , Retina/physiopathology , Retina/diagnostic imaging , Visual Acuity/physiologyABSTRACT
The visual function of patients with infantile nystagmus (IN) can be significantly decreased owing to constant eye movement. While, reaching a definitive diagnosis becomes a challenge due to genetic heterozygous of this disease. To address it, we investigated whether best-corrected visual acuity (BCVA) results can facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations. 200 patients with IN from 55 families and 133 sporadic cases were enrolled. Mutations were comprehensively screened by direct sequencing using gene-specific primers for FRMD7. We also retrieved related literature to verify the results based on our data. We found that the BCVA of patients with IN harboring FRMD7 mutations was between 0.5 and 0.7, which was confirmed by data retrieved from the literature. Our results showed that BCVA results facilitate the molecular diagnosis of patients with IN harboring FRMD7 mutations. In addition, we identified 31 FRMD7 mutations from the patients, including six novel mutations, namely, frameshift mutation c.1492_1493insT (p.Y498LfsTer14), splice-site mutation c.353C > G, three missense mutations [c.208C > G (p.P70A), c.234G > A (p.M78I), and c.1109G > A (p.H370R)], and nonsense mutation c.1195G > T (p.E399Ter). This study demonstrates that BCVA results may facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations.
Subject(s)
Genetic Diseases, X-Linked , Nystagmus, Congenital , Humans , Nystagmus, Congenital/diagnosis , Nystagmus, Congenital/genetics , Membrane Proteins/genetics , DNA Mutational Analysis , Genetic Diseases, X-Linked/genetics , Mutation , Visual Acuity , Pedigree , Cytoskeletal Proteins/geneticsABSTRACT
Nystagmus describes an involuntary, periodic movement of one or both eyes. About 1/600 children and adolescents have nystagmus, most of them idiopathic infantile nystagmus (IIN), also called "congenital nystagmus", which can be caused by mutations in the FRMD7 gene. Other frequent forms of nystagmus are latent nystagmus, which is usually associated with infantile strabismus, and nystagmus associated with albinism. Sometimes difficult to distinguish in young infants is a sensory nystagmus, where a defect in the visual system reduces vision and causes nystagmus. Causes include retinal dystrophies, congenital stationary night blindness and structural ocular defects including optic nerve hypoplasia or dense bilateral congenital cataracts. Unilateral nystagmus can be the sign of an anterior visual pathway lesion. Seesaw nystagmus may be associated with suprasellar and mesodiencephalic lesions and - rarely - with retinal dystrophies.The ophthalmology plays a key role in identifying the form of nystagmus. Children with new onset nystagmus, with spasmus nutans, with vertical or unilateral nystagmus and those with seesaw nystagmus require neurologic evaluation including imaging of the brain.The treatment of nystagmus depends on the underlying cause. Even minor refractive errors should be corrected, contact lenses offer advantages over glasses.Gabapentin and memantine, possibly also carbonic anhydrase inhibitors, are effective in treating IIN, nystagmus in albinism and sensory nystagmus. Nevertheless, pharmacologic treatment of nystagmus is rarely used in children; the reasons are the limited effects on vision, the need for lifelong therapy, and potential side effects. Eye muscle surgery (Anderson procedure, Kestenbaum procedure) can correct a nystagmus-related anomalous head posture. The concept of "artifical divergence" of Cüppers may help to decrease nystagmus intensity in patients whose nystagmus dampens with convergence. The four-muscle-tenotomy, which involves disinsertion and reinsertion of the horizontal muscles at the original insertion of both eyes, has a proven but limited positive effect on visual acuity.
Subject(s)
Albinism , Nystagmus, Congenital , Nystagmus, Pathologic , Infant , Adolescent , Child , Humans , Nystagmus, Pathologic/diagnosis , Nystagmus, Pathologic/genetics , Nystagmus, Pathologic/therapy , Nystagmus, Congenital/diagnosis , Nystagmus, Congenital/genetics , Eye Movements , Oculomotor Muscles/surgery , Cytoskeletal Proteins/genetics , Membrane Proteins/geneticsABSTRACT
Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.
Subject(s)
Eye Proteins , Genetic Diseases, X-Linked , Membrane Glycoproteins , Nystagmus, Congenital , Humans , Albinism, Ocular/genetics , Albinism, Ocular/diagnosis , Eye Proteins/genetics , Iris , Membrane Glycoproteins/genetics , Mutation/genetics , Nystagmus, Congenital/genetics , Nystagmus, Congenital/diagnosis , PedigreeABSTRACT
In recent years, exome sequencing (ES) has shown great utility in the diagnoses of Mendelian disorders. However, after rigorous filtering, a typical ES analysis still involves the interpretation of hundreds of variants, which greatly hinders the rapid identification of causative genes. Since the interpretations of ES data require comprehensive clinical analyses, taking clinical expertise into consideration can speed the molecular diagnoses of Mendelian disorders. To leverage clinical expertise to prioritize candidate genes, we developed PhenoApt, a phenotype-driven gene prioritization tool that allows users to assign a customized weight to each phenotype, via a machine-learning algorithm. Using the ability to rank causative genes in top-10 lists as an evaluation metric, baseline analysis demonstrated that PhenoApt outperformed previous phenotype-driven gene prioritization tools by a relative increase of 22.7%-140.0% in three independent, real-world, multi-center cohorts (cohort 1, n = 185; cohort 2, n = 784; and cohort 3, n = 208). Additional trials showed that, by adding weights to clinical indications, which should be explained by the causative gene, PhenoApt performance was improved by a relative increase of 37.3% in cohort 2 (n = 471) and 21.4% in cohort 3 (n = 208). Moreover, PhenoApt could assign an intrinsic weight to each phenotype based on the likelihood of its being a Mendelian trait using term frequency-inverse document frequency techniques. When clinical indications were assigned with intrinsic weights, PhenoApt performance was improved by a relative increase of 23.7% in cohort 2 and 15.5% in cohort 3. For the integration of PhenoApt into clinical practice, we developed a user-friendly website and a command-line tool.
Subject(s)
Genetic Diseases, Inborn/genetics , Hearing Loss, Sensorineural/genetics , Intellectual Disability/genetics , Machine Learning , Microcephaly/genetics , Nystagmus, Congenital/genetics , Scoliosis/genetics , Cohort Studies , Computational Biology , Databases, Genetic , Exome , Genetic Diseases, Inborn/diagnosis , Genetic Diseases, Inborn/pathology , Genetic Testing , Genotype , Hearing Loss, Sensorineural/diagnosis , Hearing Loss, Sensorineural/pathology , Humans , Intellectual Disability/diagnosis , Intellectual Disability/pathology , Microcephaly/diagnosis , Microcephaly/pathology , Nystagmus, Congenital/diagnosis , Nystagmus, Congenital/pathology , Phenotype , Scoliosis/diagnosis , Scoliosis/pathology , Software , Exome SequencingABSTRACT
PURPOSE: Ocular albinism type I (OA1) is caused by mutations in the GPR143 gene. The purpose of this study was to describe the clinical and genetic findings in 13 patients from 12 unrelated Chinese pedigrees with a pathogenic variant of the GPR143 gene. METHODS: Most patients underwent clinical examination, including best-corrected visual acuity (BCVA), slit-lamp biomicroscopy, fundus examination, spectral domain optical coherence tomography, and full-field electroretinograms (ERG). A combination of molecular screening procedures, consisting of Sanger-DNA sequencing of GPR143 and targeted next-generation sequencing, was performed to identify each mutation. In silico programs were utilized to evaluate the pathogenicity of all the variants. RESULTS: The 13 patients (mean age 21.75 ± 16.63 years, range 1-54 years) all presented with congenital nystagmus, different extents of visual impairment, and severe foveal hypoplasia. Their BCVA was between 0.05 and 0.3 (decimal notation). The patients and obligate carriers exhibited different extents of mild depigmentation of the iris and fundus. We detected 11 distinct mutations in this patient cohort, including 7 novel mutations. Most (82%) were null mutations and included frameshift indel, nonsense, splicing effect, and large genomic DNA deletions, while missense mutations only accounted for 18%. CONCLUSIONS: Patients with GPR143 mutations all have congenital nystagmus, visual impairment, and foveal hypoplasia, whereas hypopigmentation in their iris and fundus is mild. They exhibit no evident genotype-phenotype correlations. GPR143 mutation screening is very important for establishing a precise diagnosis and for providing genetic counseling for patients and their families.
Subject(s)
Albinism, Ocular/genetics , Asian People/genetics , Eye Proteins/genetics , Membrane Glycoproteins/genetics , Mutation/genetics , Adolescent , Adult , Albinism, Ocular/diagnosis , Albinism, Ocular/physiopathology , Albinism, Oculocutaneous , Child , Child, Preschool , China/epidemiology , Cross-Sectional Studies , Electroretinography , Female , Genetic Association Studies , High-Throughput Nucleotide Sequencing , Humans , Infant , Male , Middle Aged , Nystagmus, Congenital/diagnosis , Nystagmus, Congenital/genetics , Nystagmus, Congenital/physiopathology , Pedigree , Retina/physiology , Retrospective Studies , Slit Lamp Microscopy , Tomography, Optical Coherence , Visual Acuity/physiologyABSTRACT
Aniridia is most commonly caused by haploinsufficiency of the PAX6 gene, characterized by variable iris and foveal hypoplasia, nystagmus, cataracts, glaucoma, and aniridia-related keratopathy (ARK). Genotype-phenotype correlations have previously been described; however, detailed longitudinal studies of aniridia are less commonly reported. We identified 86 patients from 62 unrelated families with molecularly confirmed heterozygous PAX6 variants from a UK-based single-center ocular genetics service. They were categorized into mutation groups, and a retrospective review of clinical characteristics (ocular and systemic) from baseline to most recent was recorded. One hundred and seventy-two eyes were evaluated, with a mean follow-up period of 16.3 ± 12.7 years. Nystagmus was recorded in 87.2% of the eyes, and foveal hypoplasia was found in 75%. Cataracts were diagnosed in 70.3%, glaucoma in 20.6%, and ARK in 68.6% of eyes. Prevalence, age of diagnosis and surgical intervention, and need for surgical intervention varied among mutation groups. Overall, the missense mutation subgroup had the mildest phenotype, and surgically naive eyes maintained better visual acuity. Systemic evaluation identified type 2 diabetes in 12.8% of the study group, which is twice the UK prevalence. This is the largest longitudinal study of aniridia in the UK, and as such, it can provide insights into prognostic indicators for patients and guiding clinical management of both ocular and systemic features.
Subject(s)
Aniridia/genetics , Cataract/genetics , Diabetes Mellitus, Type 2/genetics , Glaucoma/genetics , Nystagmus, Congenital/genetics , PAX6 Transcription Factor/genetics , Adolescent , Adult , Aniridia/complications , Cataract/diagnosis , Child , DNA Mutational Analysis , Diabetes Mellitus, Type 2/diagnosis , Female , Follow-Up Studies , Fovea Centralis/abnormalities , Genetic Association Studies , Glaucoma/diagnosis , Haploinsufficiency , Heterozygote , Humans , Longitudinal Studies , Male , Middle Aged , Nystagmus, Congenital/diagnosis , Pedigree , Young AdultABSTRACT
Background: Infantile nystagmus syndrome (INS) is a genetically heterogeneous disorder. Identifying genetic causes of INS would help clinicians to facilitate clinical diagnosis and provide appropriate treatment. The aim of this study was to determine the diagnostic utility of targeted next-generation sequencing (NGS) for INS.Materials and methods: We recruited 37 patients who were referred to the Neuro-ophthalmology clinics for evaluations of INS. NGS was performed using a targeted panel that included 98 candidate genes associated with INS. We identified pathogenic variants according to guidelines of the American College of Medical Genetics and Genomics. We also calculated the sensitivity and specificity of each clinical sign to assess the diagnostic yield of our gene panel.Results: After variant filtering, annotation, and interpretation, the potential pathogenic variants were detected in 13 of the 37 patients, achieving a molecular diagnostic rate of 35%. The identified genes were PAX6 (n = 4), FRMD7 (n = 4), GPR143 (n = 2), CACNA1F (n = 1), CNGA3 (n = 1) and GUCY2D (n = 1). In approximately 30% (n = 4) of the patients, the initial clinical diagnosis was revised after a molecular diagnosis was performed. The presence of a family history had the highest predictive power for a molecular diagnosis (sensitivity = 61.5%, specificity = 91.7%), and the sensitivity increased when the family history was considered together with one of two clinical signs such as pendular nystagmus waveforms or anterior segment dysgenesis.Conclusions: Our study shows that targeted NGS can be useful to determine a molecular diagnosis for patients with INS. Targeted NGS also helps to confirm a clinical diagnosis in atypical phenotypes or unresolved cases.
Subject(s)
Eye Proteins/genetics , Mutation , Nystagmus, Congenital/diagnosis , Nystagmus, Congenital/genetics , Adolescent , Adult , Aged , Child , Female , Genetic Association Studies , Genetic Testing , High-Throughput Nucleotide Sequencing , Humans , Male , Middle Aged , Pedigree , Sensitivity and Specificity , Sequence Analysis, DNASubject(s)
Humans , Male , Infant , Nystagmus, Congenital/diagnosis , Nystagmus, Congenital/therapy , Magnetic Resonance ImagingABSTRACT
Infantile nystagmus syndrome (INS) denominates early-onset, involuntary oscillatory eye movements with different etiologies. Nystagmus is also one of the symptoms in oculocutaneus albinism (OCA), a heterogeneous disease mainly caused by defects in melanin synthesis or melanosome biogenesis. Dopachrome tautomerase (DCT, also called TYRP2) together with tyrosinase (TYR) and tyrosin-related protein 1 (TYRP1) is one of the key enzymes in melanin synthesis. Although DCT´s role in pigmentation has been proven in different species, until now only mutations in TYR and TYRP1 have been found in patients with OCA. Detailed ophthalmological and orthoptic investigations identified a consanguineous family with two individuals with isolated infantile nystagmus and one family member with subtle signs of albinism. By whole-exome sequencing and segregation analysis, we identified the missense mutation c.176G > T (p.Gly59Val) in DCT in a homozygous state in all three affected family members. We show that this mutation results in incomplete protein maturation and targeting in vitro compatible with a partial or total loss of function. Subsequent screening of a cohort of patients with OCA (n = 85) and INS (n = 25) revealed two heterozygous truncating mutations, namely c.876C > A (p.Tyr292*) and c.1407G > A (p.Trp469*), in an independent patient with OCA. Taken together, our data suggest that mutations in DCT can cause a phenotypic spectrum ranging from isolated infantile nystagmus to oculocutaneous albinism.
Subject(s)
Albinism, Oculocutaneous/genetics , Intramolecular Oxidoreductases/genetics , Melanins/biosynthesis , Mutation, Missense , Nystagmus, Congenital/genetics , Adolescent , Albinism, Oculocutaneous/diagnosis , Albinism, Oculocutaneous/enzymology , Albinism, Oculocutaneous/pathology , Base Sequence , Calnexin/genetics , Calnexin/metabolism , Child , Cohort Studies , Consanguinity , Female , Gene Expression Regulation , HEK293 Cells , Homozygote , Humans , Intramolecular Oxidoreductases/deficiency , Male , Melanins/genetics , Membrane Glycoproteins/genetics , Membrane Glycoproteins/metabolism , Monophenol Monooxygenase/genetics , Monophenol Monooxygenase/metabolism , Nystagmus, Congenital/diagnosis , Nystagmus, Congenital/enzymology , Nystagmus, Congenital/pathology , Oxidoreductases/genetics , Oxidoreductases/metabolism , Pedigree , Exome Sequencing , Young AdultABSTRACT
PURPOSE: To translate infantile nystagmus system (INS) research into easily understood, clinically relevant terminology and suggest modifications to research and clinical testing, data and clinical interpretation, and therapeutic choices and evaluation. METHODS: A clinical method is presented using only three best-corrected visual acuity measurements of patients with INS, whereby (1) a measure of the quality of visual acuity across the visual field is possible; (2) pre-therapy estimates of post-therapy improvements in peak acuity and the high-acuity range of gaze angles are possible; and (3) more realistic visual function outcome measures of therapy are available to the practitioner. RESULTS: The application of the high-acuity field quality spreadsheet to the analyses of patients with INS (before and after therapy) results in a quantitative measure of visual function based on three visual acuity measurements. CONCLUSIONS: The clinician can now duplicate adequate functional visual acuity descriptions in patients with INS along with their pre-therapy estimates and outcome measures. Previously, these have only been available to researchers or the rare clinicians who have access to both eye movement data and the expanded nystagmus acuity function analysis of INS waveforms. [J Pediatr Ophthalmol Strabismus. 2021;58(3):188-195.].
Subject(s)
Nystagmus, Congenital , Nystagmus, Pathologic , Eye Movements , Humans , Nystagmus, Congenital/diagnosis , Nystagmus, Pathologic/diagnosis , Oculomotor Muscles , Visual Acuity , Visual FieldsABSTRACT
Background: To describe genetic molecular findings in individuals with congenital nystagmus, foveal hypoplasia, and subnormal vision, with normal ocular pigmentation (absence of diffuse transillumination or transparent retinal pigment typical for albinism).Methods: This is a retrospective, multicenter study of ophthalmic, systemic, and genetic features, as collected from medical records of patients diagnosed with infantile nystagmus and foveal hypoplasia. Ophthalmic findings include best-corrected visual acuity (BCVA), biomicroscopic examination, cycloplegic refraction, retinal examination, macular optical coherence tomography, and electroretinography. Genetic information was retrieved from the participating genetic clinics and included ethnicity and molecular diagnosis.Results: Thirty-one individuals met the inclusion criteria and had a secure molecular diagnosis. Mutations in two genes predominated, constituting 77.4% of all the represented genes: SLC38A8 (45.1%) and PAX6 (32.3%). Seventy-eight percent of the subjects who had a measurable BCVA had moderate and severe visual impairment (range 20/80 to 20/270). Most patients with a mutation in SLC38A8 had mild to moderate astigmatism, while most patients with PAX6 mutation had moderate and severe myopia. Patients in the PAX6 group had variable degrees of anterior segment manifestations.Conclusion: In our cohort, the main causative genes for congenital nystagmus and foveal hypoplasia in normally pigmented eyes were SLC38A8 and PAX6. A mild phenotype in PAX6 mutations may be an under-diagnosed cause of nystagmus and foveal hypoplasia. Reaching an accurate genetic diagnosis is essential for both the patients and their family members. This enables predicting disease prognosis, tailoring correct follow-up, and providing genetic counseling and family planning to affected families.
Subject(s)
Amino Acid Transport Systems, Neutral/genetics , Eye Abnormalities/genetics , Fovea Centralis/abnormalities , Nystagmus, Congenital/genetics , PAX6 Transcription Factor/genetics , Vision, Low/genetics , Visual Acuity/physiology , Adolescent , Adult , Aged , Albinism/genetics , Astigmatism/genetics , Child , Child, Preschool , Cytoskeletal Proteins/genetics , Eye Abnormalities/diagnosis , Female , Humans , Infant , Male , Membrane Proteins/genetics , Myopia/genetics , Nystagmus, Congenital/diagnosis , Retrospective Studies , Slit Lamp Microscopy , Vision, Low/diagnosis , Vision, Low/physiopathology , Young AdultSubject(s)
Cytoskeletal Proteins/genetics , Genetic Diseases, X-Linked/genetics , Genetic Testing/methods , Membrane Proteins/genetics , Nystagmus, Congenital/genetics , Genetic Diseases, X-Linked/diagnosis , Genetic Testing/standards , Humans , Mutation , Nystagmus, Congenital/diagnosis , Sensitivity and SpecificityABSTRACT
ABSTRACT: A 6-year-old boy was referred for constant right gaze deviation. Rather than a gaze deviation, he constantly seemed to look on the left side of any displayed target. Examination revealed the association of a highly positive angle Kappa and an esotropia of equal values. He also exhibited signs of ocular albinism with no associated infantile nystagmus syndrome. The X-linked ocular albinism was confirmed genetically, explaining the presence of a positive angle Kappa. A highly positive angle Kappa can be associated with a convergent strabismus; in case both values offset each other, this can result in a constant "sidelooking," which should not be confused with a gaze deviation.
Subject(s)
Albinism, Ocular/complications , Esotropia/etiology , Nystagmus, Congenital/complications , Oculomotor Muscles/physiopathology , Albinism, Ocular/diagnosis , Child , Diagnostic Techniques, Ophthalmological , Esotropia/diagnosis , Esotropia/physiopathology , Humans , Male , Nystagmus, Congenital/diagnosis , Nystagmus, Congenital/physiopathologyABSTRACT
Fovea hipoplazisi, normal foveanin gelismemesi ile karakterizedir. Izole veya baska oküler durumlarda sekonder olarak gelisebilmektedir. Optik koherens tomografi (OKT), floresein anjiyografi, fundus otofloresans ve OKT anjiyografi tanida kullanilabilir. Bu olgu sunumunda multimodal görüntüleme ile tani konulan, foveal hipoplazili bir hastayi sunmaktayiz.