ABSTRACT
RTK KIT regulates a variety of crucial cellular processes via its cytoplasmic domain (CD), which is composed of the tyrosine kinase domain, crowned by the highly flexible domains-the juxtamembrane region, kinase insertion domain, and C-tail, which are key recruitment regions for downstream signalling proteins. To prepare a structural basis for the characterization of the interactions of KIT with its signalling proteins (KIT INTERACTOME), we generated the 3D model of the full-length CD attached to the transmembrane helix. This generic model of KIT in inactive state was studied by molecular dynamics simulation under conditions mimicking the natural environment of KIT. With the accurate atomistic description of the multidomain KIT dynamics, we explained its intrinsic (intra-domain) and extrinsic (inter-domain) disorder and represented the conformational assemble of KIT through free energy landscapes. Strongly coupled movements within each domain and between distant domains of KIT prove the functional interdependence of these regions, described as allosteric regulation, a phenomenon widely observed in many proteins. We suggested that KIT, in its inactive state, encodes all properties of the active protein and its post-transduction events.
Subject(s)
Proto-Oncogene Proteins c-kit/chemistry , Proto-Oncogene Proteins c-kit/metabolism , Catalytic Domain , Humans , Hydrogen Bonding , Models, Molecular , Molecular Dynamics Simulation , Protein Binding , Protein Conformation , Protein Domains , Protein Folding , Protein Interaction MapsABSTRACT
The SH2B family of adaptor proteins, SH2-B, APS, and LNK are key modulators of cellular signalling pathways. Whilst SH2-B and APS have been partially structurally and biochemically characterised, to date there has been no such characterisation of LNK. Here we present two crystal structures of the LNK substrate recognition domain, the SH2 domain, bound to phosphorylated motifs from JAK2 and EPOR, and biochemically define the basis for target recognition. The LNK SH2 domain adopts a canonical SH2 domain fold with an additional N-terminal helix. Targeted analysis of binding to phosphosites in signalling pathways indicated that specificity is conferred by amino acids one- and three-residues downstream of the phosphotyrosine. Several mutations in LNK showed impaired target binding in vitro and a reduced ability to inhibit signalling, allowing an understanding of the molecular basis of LNK dysfunction in variants identified in patients with myeloproliferative disease.
Subject(s)
Adaptor Proteins, Signal Transducing/chemistry , Adaptor Proteins, Signal Transducing/metabolism , Adaptor Proteins, Signal Transducing/genetics , Amino Acid Motifs , Animals , Binding Sites , Crystallography, X-Ray , Humans , Janus Kinase 2/chemistry , Janus Kinase 2/metabolism , Janus Kinase 3/chemistry , Janus Kinase 3/metabolism , Mice , Mutation , Myeloproliferative Disorders/genetics , Phosphotyrosine , Protein Binding , Proto-Oncogene Proteins c-kit/chemistry , Proto-Oncogene Proteins c-kit/metabolism , Receptors, Erythropoietin/chemistry , Receptors, Erythropoietin/metabolism , Signal Transduction , fms-Like Tyrosine Kinase 3/chemistry , fms-Like Tyrosine Kinase 3/metabolism , src Homology DomainsABSTRACT
Chimeric proteins have been widely used to evaluate intracellular protein-protein interactions (PPIs) in living cells with various readouts. By combining an interleukin-3-dependent murine cells and chimeric proteins containing a receptor tyrosine kinase c-kit, we previously established a c-kit-based PPI screening (KIPPIS) system to evaluate and select protein binders. In the KIPPIS components, proteins of interest are connected with a chemically inducible helper module and the intracellular domain of the growth-signaling receptor c-kit, which detects PPIs based on cell proliferation as a readout. In this system, proteins of interest can be incorporated into chimeric proteins without any scaffold proteins, which would be advantageous for evaluating interaction between small peptides/domains. To prove this superiority, we apply KIPPIS to 6 peptide aptamer-polypeptide pairs, which are derived from endogenous, synthetic, and viral proteins. Consequently, all of the 6 peptide aptamer-polypeptide interactions are successfully detected by cell proliferation. The detection sensitivity can be modulated in a helper ligand-dependent manner. The assay results of KIPPIS correlate with the activation levels of Src, which is located downstream of c-kit-mediated signal transduction. Control experiments reveal that KIPPIS clearly discriminates interacting aptamers from non-interacting ones. Thus, KIPPIS proves to be a versatile platform for evaluating the binding properties of peptide aptamers.
Subject(s)
Aptamers, Peptide/metabolism , Protein Interaction Mapping/methods , Proto-Oncogene Proteins c-kit/metabolism , Aptamers, Peptide/chemistry , Humans , Ligands , Peptides/chemistry , Peptides/metabolism , Protein Binding , Protein Engineering/methods , Proto-Oncogene Proteins c-kit/chemistryABSTRACT
G-quadruplexes (G4s) are tetrahelical DNA structures stabilized by four guanines paired via Hoogsteen hydrogen bonds into quartets. While their presence within eukaryotic DNA is known to play a key role in regulatory processes, their functional mechanisms are still under investigation. In the present work, we analysed the nanomechanical properties of three G4s present within the promoter of the KIT proto-oncogene from a single-molecule point of view through the use of magnetic tweezers (MTs). The study of DNA extension fluctuations under negative supercoiling allowed us to identify a characteristic fingerprint of G4 folding. We further analysed the energetic contribution of G4 to the double-strand denaturation process in the presence of negative supercoiling, and we observed a reduction in the energy required for strands separation.
Subject(s)
DNA/chemistry , G-Quadruplexes , Guanine/chemistry , Proto-Oncogene Proteins c-kit/chemistry , Single Molecule Imaging/methods , DNA, Superhelical/chemistry , Kinetics , Nucleic Acid Denaturation , Oncogenes , Promoter Regions, Genetic , Proto-Oncogene Mas , Single Molecule Imaging/instrumentationABSTRACT
PURPOSE: Imatinib, a small-molecule tyrosine kinase inhibitor, has shown good clinical activity by inhibiting adenosine triphosphate (ATP) binding to the receptor. Unfortunately, majority of patients eventually develop drug resistance, which limits the long-term benefits of the tyrosine kinase inhibitors and poses a significant challenge in the clinical management of GIST. The aim of our study was to explore the feasibility of blocking KIT dimerisation upstream of the phosphorylation in imatinib-resistant GIST. METHOD: KITMAb was prepared using hybridoma technique. The biological function of KITMAb was examined in KIT-dimer-expressing cells constructed by transfecting with liposomes using enzyme linked immunosorbent assay (ELISA), immunohistochemistry, western blot, MTT, Annexin V/FITC, and flow cytometry assay, respectively. RESULTS: KIT-dimer was expressed in 293 cells transfected with c-kit mutated-type pcDNA3.1. Treatment of KIT-dimer-expressing cells with the KITMAb significantly decreased the expression of both KIT-dimer and other phosphorylated proteins of KIT downstream signalling pathway. Furthermore, KITMAb slowed down cell growth and reduced the proportion of cells in the proliferative phase (S + G2-M). Finally, we also found that KITMAb treatment accelerated cell apoptosis. These results indicate that KITMAb strongly inhibits KIT receptor dimerisation-mediated signalling pathway and cell growth responses in vitro. CONCLUSIONS: We demonstrate c-kit mutation-driven KIT auto-dimerisation prior to tyrosine kinase phosphorylation as same as the procedure in ligand-dependent signalling pathway and describe a monoclonal antibody, KITMAb, with strong affinity to the dimerisation domain of KIT that blocks the important step in both the KIT signalling pathways. Further, the results suggest that treatment with KITMAb may be potentially therapeutic in imatinib-resistant GIST.
Subject(s)
Antibodies, Monoclonal/pharmacology , Biomarkers, Tumor/metabolism , Gene Expression Regulation, Neoplastic , Mutation , Neoplasms/pathology , Protein Multimerization , Proto-Oncogene Proteins c-kit/metabolism , Apoptosis , Biomarkers, Tumor/genetics , Cell Cycle , Cell Proliferation , Humans , Neoplasms/genetics , Neoplasms/immunology , Neoplasms/metabolism , Proto-Oncogene Proteins c-kit/chemistry , Proto-Oncogene Proteins c-kit/genetics , Proto-Oncogene Proteins c-kit/immunology , Tumor Cells, CulturedABSTRACT
Gastrointestinal stromal tumors (GISTs) are the most common Mesenchymal Neoplasm of the gastrointestinal tract. The tumorigenesis of GISTs has been associated with the gain-of-function mutation and abnormal activation of the stem cell factor receptor (c-KIT) and platelet-derived growth factor receptor alpha (PDGFRα) kinases. Hence, inhibitors that target c-KIT and PDGFRα could be a therapeutic option for the treatment of GISTs. The available approved c-KIT/PDGFRα inhibitors possessed low efficacy with off-target effects, which necessitated the development of potent inhibitors. We performed computational studies of 48 pyrazolopyridine derivatives that showed inhibitory activity against c-KIT and PDGFRα to study the structural properties important for inhibition of both the kinases. The derivative of phenylurea, which has high activities for both c-KIT (pIC50 = 8.6) and PDGFRα (pIC50 = 8.1), was used as the representative compound for the dataset. Molecular docking and molecular dynamics simulation (100 ns) of compound 14 was performed. Compound 14 showed the formation of hydrogen bonding with Cys673, Glu640, and Asp810 in c-KIT, and Cys677, Glu644, and Asp836 in PDGFRα. The results also suggested that Thr670/T674 substitution in c-KIT/PDGFRα induced conformational changes at the binding site of the receptors. Three-dimensional quantitative structure-activity relationship (3D-QSAR) models were developed based on the inhibitors. Contour map analysis showed that electropositive and bulky substituents at the para-position and the meta-position of the benzyl ring of compound 14 was favorable and may increase the inhibitory activity against both c-KIT and PDGFRα. Analysis of the results suggested that having bulky and hydrophobic substituents that extend into the hydrophobic pocket of the binding site increases the activity for both c-KIT and PDGFRα. Based on the contour map analysis, 50 compounds were designed, and the activities were predicted. An evaluation of binding free energy showed that eight of the designed compounds have potential binding affinity with c-KIT/PDGFRα. Absorption, distribution, metabolism, excretion and toxicity (ADMET) and synthetic feasibility tests showed that the designed compounds have reasonable pharmaceutical properties and synthetic feasibility. Further experimental study of the designed compounds is recommended. The structural information from this study could provide useful insight into the future development of c-KIT and PDGFRα inhibitors.
Subject(s)
Gastrointestinal Neoplasms/drug therapy , Gastrointestinal Stromal Tumors/drug therapy , Models, Molecular , Protein Kinase Inhibitors/isolation & purification , Proto-Oncogene Proteins c-kit/antagonists & inhibitors , Receptor, Platelet-Derived Growth Factor alpha/antagonists & inhibitors , Amino Acid Substitution , Antineoplastic Agents/chemistry , Antineoplastic Agents/isolation & purification , Antineoplastic Agents/pharmacokinetics , Antineoplastic Agents/therapeutic use , Binding Sites , Drug Screening Assays, Antitumor/methods , Humans , Molecular Docking Simulation , Molecular Dynamics Simulation , Mutant Proteins/chemistry , Mutant Proteins/genetics , Mutant Proteins/metabolism , Protein Kinase Inhibitors/chemistry , Protein Kinase Inhibitors/pharmacokinetics , Protein Kinase Inhibitors/therapeutic use , Proto-Oncogene Proteins c-kit/chemistry , Proto-Oncogene Proteins c-kit/genetics , Proto-Oncogene Proteins c-kit/metabolism , Pyrazoles/chemistry , Pyridines/chemistry , Quantitative Structure-Activity Relationship , Receptor, Platelet-Derived Growth Factor alpha/chemistry , Receptor, Platelet-Derived Growth Factor alpha/genetics , Receptor, Platelet-Derived Growth Factor alpha/metabolismABSTRACT
Tyrosine phosphorylation, a highly regulated post-translational modification, is carried out by the enzyme tyrosine kinase (TK). TKs are important mediators in signaling cascades, facilitating diverse biological processes in response to stimuli. TKs may acquire mutations leading to malignancy and are viable targets for anti-cancer drugs. Mast/stem cell growth factor receptor KIT is a TK involved in cell differentiation, whose dysregulation leads to various types of cancer, including gastrointestinal stromal tumors, leukemia, and melanoma. KIT can be targeted by a range of inhibitors that predominantly bind to the inactive state of the enzyme. A mutation Y823D in the activation loop of KIT is known to be responsible for the loss of sensitivity to some drugs in metastatic tumors. We used all-atom molecular dynamics simulations to study the impact of Y823D on the KIT conformation and dynamics and compared it to the effect of phosphorylation of Y823. We simulated in total 6.4 µs of wild-type, mutant and phosphorylated KIT in the active- and inactive-state conformations. We found that Y823D affects the protein dynamics differently: in the active state, the mutation increases the protein stability, whereas in the inactive state it induces local destabilization, thus shifting the dynamic equilibrium towards the active state, altering the communication between distant regulatory regions. The observed dynamics of the Y823D mutant is similar to the dynamics of KIT phosphorylated at position Y823, thus we hypothesize that this mutation mimics a constitutively active kinase, which is not responsive to inhibitors that bind its inactive conformation.
Subject(s)
Antineoplastic Agents/chemistry , Aspartic Acid/chemistry , Protein Kinase Inhibitors/chemistry , Protein Processing, Post-Translational , Proto-Oncogene Proteins c-kit/chemistry , Tyrosine/chemistry , Antineoplastic Agents/metabolism , Aspartic Acid/metabolism , Binding Sites , Databases, Protein , Drug Resistance, Neoplasm/genetics , Humans , Hydrogen Bonding , Ligands , Molecular Dynamics Simulation , Mutation , Phosphorylation , Protein Binding , Protein Conformation, alpha-Helical , Protein Conformation, beta-Strand , Protein Interaction Domains and Motifs , Protein Kinase Inhibitors/metabolism , Protein Stability , Proto-Oncogene Proteins c-kit/antagonists & inhibitors , Proto-Oncogene Proteins c-kit/genetics , Proto-Oncogene Proteins c-kit/metabolism , Substrate Specificity , Thermodynamics , Tyrosine/metabolismABSTRACT
The 2,7-naphthyridone scaffold has been proposed as a novel lead structure of MET inhibitors by our group. To broaden the application of this new scaffold, a series of 8-amino-substituted 2-phenyl-2,7-naphthyridin-1(2H)-one derivatives were designed and synthesized. Preliminary biological screening resulted in the discovery of a new lead of c-Kit and VEGFR-2 kinase inhibitors. Compound 9k exhibited excellent c-Kit inhibitory activity, with an IC50 value of 8.5 nM, i.e., it is 38.8-fold more potent than compound 3 (IC50 of 329.6 nM). Moreover, the compounds 10l and 10r exhibited good VEGFR-2 inhibitory activity, with IC50 values of 56.5 and 31.7 nM, respectively, i.e., they are 5.0-8.8-fold more potent than compound 3 (IC50 of 279.9 nM). Molecular docking experiments provided further insight into the binding interactions of the new lead compounds with c-Kit and VEGFR-2 kinase. In this study, an 8-amino-substituted 2-phenyl-2,7-naphthyridin-1(2H)-one scaffold was identified as the new lead structure of c-Kit and VEGFR-2 kinase inhibitors.
Subject(s)
Drug Discovery , Molecular Docking Simulation , Protein Kinase Inhibitors , Proto-Oncogene Proteins c-kit , Vascular Endothelial Growth Factor Receptor-2 , Humans , Protein Kinase Inhibitors/chemical synthesis , Protein Kinase Inhibitors/chemistry , Proto-Oncogene Proteins c-kit/antagonists & inhibitors , Proto-Oncogene Proteins c-kit/chemistry , Vascular Endothelial Growth Factor Receptor-2/antagonists & inhibitors , Vascular Endothelial Growth Factor Receptor-2/chemistryABSTRACT
Stabilization of G-quadruplex structures in the c-KIT promoter with the aid of ligands has become an area of great interest in potential cancer therapeutics. Understanding the binding process between ligands and G-quadruplex is essential for a discovery of selective ligands with high binding affinity to G-quadruplex. In the present work, binding mechanisms of 4-quinazolinones to c-KIT G-quadruplex were investigated theoretically by means of molecular dynamics (MD) simulations. To explore the binding affinity of ligands, binding free energy calculations were performed using the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) method. We demonstrate that the key interactions in G-quadruplex-ligand complexes are π-π stacking and hydrogen bond interactions. However, neither of these two interactions alone determines the stability of the G-quadruplex-ligand complexes; rather, it is the result of an intricate interplay between the two. To further examine the nature of the binding, a free energy decomposition analysis at residue level was carried out. The results clearly demonstrate the crucial roles of two hot spot residues (DG4 and DG8) for the binding of ligands to c-KIT G-quadruplex, and highlight the importance of the planar aromatic moiety of ligands in G-quadruplex stabilization via π-π stacking interactions. Our study can assist in the design of new derivatives of 4-quinazolinone with high binding affinity for c-KIT G-quadruplex.
Subject(s)
Proto-Oncogene Proteins c-kit/chemistry , Quinazolinones/chemistry , Thermodynamics , Binding Sites , G-Quadruplexes , Hydrogen Bonding , Ligands , Molecular Docking Simulation , Molecular Dynamics Simulation , Molecular StructureABSTRACT
KIT is a type-3 receptor tyrosine kinase that is frequently mutated at exon 11 or 17 in a variety of cancers. First-generation KIT tyrosine kinase inhibitors (TKI) are ineffective against KIT exon 17 mutations, which favor an active conformation that prevents these TKIs from binding. The ATP-competitive inhibitors, midostaurin and avapritinib, which target the active kinase conformation, were developed to inhibit exon 17-mutant KIT. Because secondary kinase domain mutations are a common mechanism of TKI resistance and guide ensuing TKI design, we sought to define problematic KIT kinase domain mutations for these emerging therapeutics. Midostaurin and avapritinib displayed different vulnerabilities to secondary kinase domain substitutions, with the T670I gatekeeper mutation being selectively problematic for avapritinib. Although gatekeeper mutations often directly disrupt inhibitor binding, we provide evidence that T670I confers avapritinib resistance indirectly by inducing distant conformational changes in the phosphate-binding loop. These findings suggest combining midostaurin and avapritinib may forestall acquired resistance mediated by secondary kinase domain mutations. SIGNIFICANCE: This study identifies potential problematic kinase domain mutations for next-generation KIT inhibitors midostaurin and avapritinib.
Subject(s)
Antineoplastic Agents/pharmacology , Drug Resistance, Neoplasm/genetics , Protein Kinase Inhibitors/pharmacology , Proto-Oncogene Proteins c-kit/genetics , Pyrazoles/pharmacology , Pyrroles/pharmacology , Staurosporine/analogs & derivatives , Triazines/pharmacology , Cell Line , Drug Resistance, Neoplasm/drug effects , Exons , Humans , Molecular Docking Simulation , Molecular Dynamics Simulation , Mutation , Proto-Oncogene Proteins c-kit/chemistry , Proto-Oncogene Proteins c-kit/metabolism , Staurosporine/chemistry , Staurosporine/pharmacologyABSTRACT
The alpaca classic grey phenotype is of particular interest to the industry. Until now, there were only indirect data suggesting that the KIT gene was involved in the classic grey phenotype. All exons of KIT in three black and three classic silvergrey alpacas were sequenced. Five non-synonymous SNPs were observed. There was only one SNP found that was present only in the silvergrey alpacas, and this was also the only SNP predicted to be damaging. This variant results in a change of a glycine (Gly) to an arginine (Arg) at amino acid position 126 (c.376G>A), occurring in the second Ig-like domain of the extracellular domain of KIT. Basic protein modelling predicted that this variant is likely destabilising. Therefore, an additional 488 alpacas were genotyped for this SNP using the tetra-primer amplification refractory mutation system PCR (Tetra-primer ARMS-PCR). All classic grey alpacas were observed to be heterozygous, and 99.3% of non-grey dark base colour alpacas were found to be homozygous for the wildtype allele in this position. These results confirm that the classic grey phenotype in alpacas is the result of a c.376G>A (p.Gly126Arg) SNP in exon 3 of KIT. These data also support the hypothesis that the grey phenotype is autosomal dominant and that the mutation is most likely homozygous lethal.
Subject(s)
Camelids, New World/genetics , Camelids, New World/physiology , Pigmentation , Proto-Oncogene Proteins c-kit/genetics , Amino Acid Substitution , Animals , Exons , Polymorphism, Single Nucleotide , Proto-Oncogene Proteins c-kit/chemistryABSTRACT
Receptors tyrosine kinase (RTK) enable normal and tumor cells to perceive and adapt to stimuli present in the microenvironment. These stimuli, also known as growth factors, are important molecular cues actively supporting cancer stem cell (CSC) self-renewal and viability. Since in epithelial ovarian cancer (EOC) the expression of c-Kit (CD117) has been identified as a CSC hallmark, we investigated the existence of a tumor growth-promoting loop between c-Kit and its ligand Stem Cell Factor (SCF). SCF exists as a soluble or transmembrane protein and through c-Kit interaction regulates cell viability, proliferation, and differentiation both in physiological and pathological conditions. High amounts of SCF were found in the ascitic effusions collected from EOC patients. While tumor cells and CSC only expressed the membrane-associated SCF isoform, both secreted and membrane-bound isoforms were expressed by tumor-associated macrophages (TAM, here shown to be M2-like) and fibroblasts (TAF). Circulating monocytes from EOC-bearing patients and healthy donors did not express both SCF isoforms. However, monocytes isolated from healthy donors produced SCF upon in vitro differentiation into macrophages, irrespectively of M1 or M2 polarization. In vitro, both SCF isoforms were able to activate the Akt pathway in c-Kit+ cells, and this effect was counteracted by the tyrosine kinase inhibitor imatinib. In addition, our results indicated that SCF could help c-Kit+ CSC survival in selective culture conditions and promote their canonical stemness properties, thus indicating the possible existence of a juxtacrine/paracrine circuit in EOC.
Subject(s)
Carcinoma, Ovarian Epithelial/metabolism , Neoplastic Stem Cells/metabolism , Ovarian Neoplasms/metabolism , Proto-Oncogene Proteins c-kit/metabolism , Stem Cell Factor/metabolism , Antineoplastic Agents/pharmacology , Carcinoma, Ovarian Epithelial/genetics , Cell Differentiation/drug effects , Cell Differentiation/genetics , Cell Proliferation/drug effects , Cell Proliferation/genetics , Cell Survival/genetics , Female , Fibroblasts/metabolism , HEK293 Cells , Humans , Imatinib Mesylate/pharmacology , Macrophages/drug effects , Macrophages/immunology , Macrophages/metabolism , Neoplastic Stem Cells/drug effects , Ovarian Neoplasms/genetics , Paracrine Communication/genetics , Phosphatidylinositol 3-Kinase/metabolism , Phosphorylation , Protein Isoforms/chemistry , Protein Kinase Inhibitors/pharmacology , Proto-Oncogene Proteins c-akt/antagonists & inhibitors , Proto-Oncogene Proteins c-akt/chemistry , Proto-Oncogene Proteins c-akt/metabolism , Proto-Oncogene Proteins c-kit/chemistry , Signal Transduction/genetics , Stem Cell Factor/genetics , Tumor Microenvironment/drug effects , Tumor Microenvironment/genetics , Tumor Microenvironment/immunologyABSTRACT
We combined computational and experimental methods to interrogate the binding determinants of angiopoietin-2 (Ang2) to its receptor tyrosine kinase (RTK) Tie2-a central signaling system in angiogenesis, inflammation, and tumorigenesis. We used physics-based electrostatic and surface-area calculations to identify the subset of interfacial Ang2 and Tie2 residues that can affect binding directly. Using random and site-directed mutagenesis and yeast surface display (YSD), we validated these predictions and identified additional Ang2 positions that affected receptor binding. We then used burial-based calculations to classify the larger set of Ang2 residues that are buried in the Ang2 core, whose mutations can perturb the Ang2 structure and thereby affect interactions with Tie2 indirectly. Our analysis showed that the Ang2-Tie2 interface is dominated by nonpolar contributions, with only three Ang2 and two Tie2 residues that contribute electrostatically to intermolecular interactions. Individual interfacial residues contributed only moderately to binding, suggesting that engineering of this interface will require multiple mutations to reach major effects. Conversely, substitutions in substantially buried Ang2 residues were more prevalent in our experimental screen, reduced binding substantially, and are therefore more likely to have a deleterious effect that might contribute to oncogenesis. Computational analysis of additional RTK-ligand complexes, c-Kit-SCF and M-CSF-c-FMS, and comparison to previous YSD results, further show the utility of our combined methodology.
Subject(s)
Multiprotein Complexes/chemistry , Protein Interaction Maps/genetics , Receptor, TIE-2/chemistry , Vesicular Transport Proteins/chemistry , Carcinogenesis/genetics , Computer Simulation , Humans , Inflammation/genetics , Ligands , Multiprotein Complexes/genetics , Mutagenesis, Site-Directed , Mutation/genetics , Neovascularization, Pathologic/genetics , Protein Binding/genetics , Proto-Oncogene Proteins c-kit/chemistry , Receptor, TIE-2/genetics , Signal Transduction/genetics , Stem Cell Factor/chemistry , Vesicular Transport Proteins/geneticsABSTRACT
G-quadruplexes (GQs) are guanine-rich, noncanonical nucleic acid structures that play fundamental roles in genomic stability and the regulation of gene expression. GQs are enriched in promoter sequences of growth regulatory genes and proto-oncogenes such as c-kit, which is linked to gastrointestinal stromal tumors, mast cell disease, and leukemia. While GQs have become a popular subject for experimental and computational research, the forces governing GQ dynamics are not fully understood. To gain insights into cation interactions and base-dipole moments of these highly ordered nucleic acid structures, we performed molecular dynamics simulations on the c-kit1 GQ using the CHARMM36 additive and Drude-2017 polarizable force fields. These simulations are the first of their kind to investigate the role of electronic polarization on interactions dictating GQ conformational sampling and cation interactions. Use of a polarizable model revealed differences in base dipole moments between GQs and B-form duplex DNA, force field-dependent ion binding pathways, and allowed for quantification of multibody contributions of water to ion-GQ interactions. These results emphasize the importance of electronic polarization as a contribution to the forces underlying nucleic acid dynamics.
Subject(s)
Electrons , G-Quadruplexes , Molecular Dynamics Simulation , Proto-Oncogene Proteins c-kit/chemistry , Protein StabilityABSTRACT
In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10â¢C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.
Subject(s)
G-Quadruplexes , Models, Molecular , Nucleic Acid Conformation , Proto-Oncogene Proteins c-kit/chemistry , Adenine/chemistry , Ammonium Compounds/chemistry , Biophysical Phenomena , Humans , Ions/chemistry , Kinetics , Promoter Regions, Genetic , Proto-Oncogene Mas , Sodium/chemistry , Thermodynamics , Thymine/chemistryABSTRACT
KIT is a receptor tyrosine kinase that after binding to its ligand stem cell factor activates signaling cascades linked to biological processes such as proliferation, differentiation, migration and cell survival. Based on studies performed on SCF and/or KIT mutant animals that presented anemia, sterility, and/or pigmentation disorders, KIT signaling was mainly considered to be involved in the regulation of hematopoiesis, gametogenesis, and melanogenesis. More recently, novel animal models and ameliorated cellular and molecular techniques have led to the discovery of a widen repertoire of tissue compartments and functions that are being modulated by KIT. This is the case for the lung, heart, nervous system, gastrointestinal tract, pancreas, kidney, liver, and bone. For this reason, the tyrosine kinase inhibitors that were originally developed for the treatment of hemato-oncological diseases are being currently investigated for the treatment of non-oncological disorders such as asthma, rheumatoid arthritis, and alzheimer's disease, among others. The beneficial effects of some of these tyrosine kinase inhibitors have been proven to depend on KIT inhibition. This review will focus on KIT expression and regulation in healthy and pathologic conditions other than cancer. Moreover, advances in the development of anti-KIT therapies, including tyrosine kinase inhibitors, and their application will be discussed.
Subject(s)
Protein Kinase Inhibitors/therapeutic use , Proto-Oncogene Proteins c-kit/antagonists & inhibitors , Animals , Humans , Proto-Oncogene Proteins c-kit/chemistry , Proto-Oncogene Proteins c-kit/genetics , Proto-Oncogene Proteins c-kit/metabolism , Signal Transduction , Stem Cell Factor/genetics , Stem Cell Factor/metabolismABSTRACT
The D816X (Xâ¯=â¯V, H, Y or F) missense mutation constitutively activates c-Kit kinase in gastrointestinal stromal tumor (GIST) and has been observed to cause acquired resistance against first-line and second-line kinase inhibitors. In the present study, the allosteric mechanism of D816X-induced c-Kit conformational change is investigated at molecular level. The Asp816 residue is located at the activation loop (A-loop) of c-Kit and the mutation can eliminate a negative formal charge from the loop region by substituting the acidic asparagic acid residue with neutral valine, histidine, tyrosine or phenylalanine. Here, we classify the c-Kit kinase into four states in terms of its mutation (wild type or mutant) and conformation (DFG-in or DFG-out). The wild-type kinase is electrostatically stabilized in inactive DFG-out conformation, whereas the D816X mutation can promote the conformational conversion to active DFG-in and then activate the kinase. Structural analysis reveals that the Asp816 residue in DFG-out is surrounded by a number of polar and positively charged residues within its first and second shells of protein context, and kinase conformational change to DFG-in brings this residue into a negative electrostatic potential environment. Dynamics simulation characterizes that the c-Kit conformational conversion from DFG-out to DFG-in can cause local unfavorable effect to type-II inhibitor, while the mutation-induced global structural rearrangement would participate in the favorable interaction of c-Kit with type-I inhibitor.
Subject(s)
Drug Resistance, Neoplasm/genetics , Gastrointestinal Stromal Tumors/genetics , Gastrointestinal Stromal Tumors/metabolism , Mutation , Protein Kinase Inhibitors/pharmacology , Proto-Oncogene Proteins c-kit/genetics , Proto-Oncogene Proteins c-kit/metabolism , Alleles , Amino Acid Substitution , Binding Sites , Cell Line, Tumor , Gastrointestinal Stromal Tumors/drug therapy , Gastrointestinal Stromal Tumors/pathology , Humans , Molecular Docking Simulation , Molecular Dynamics Simulation , Molecular Structure , Protein Binding , Protein Kinase Inhibitors/chemistry , Protein Kinase Inhibitors/therapeutic use , Proto-Oncogene Proteins c-kit/chemistry , Static Electricity , ThermodynamicsABSTRACT
The Kit proto-oncogene was found as a consequence of the discovery of the feline v-kit sarcoma oncogene. Stem cell factor (SCF) is the Kit ligand and it mediates Kit dimerization and activation. The Kit receptor contains an extracellular segment that is made up of five immunoglobulin-like domains (D1/2/3/4/5), a transmembrane segment, a juxtamembrane segment, a protein-tyrosine kinase domain that contains an insert of 77 amino acid residues, and a carboxyterminal tail. Activating somatic mutations in Kit have been documented in various neoplasms including gastrointestinal stromal tumors (GIST), mast cell overexpression (systemic mastocytosis), core-binding factor acute myeloid leukemias (AML), melanomas, and seminomas. In the case of gastrointestinal stromal tumors, most activating mutations occur in the juxtamembrane segment and these mutants are initially sensitive to imatinib. As with many targeted anticancer drugs, resistance to Kit antagonists occurs in about two years and is the result of secondary KIT mutations. An activation segment exon 17 D816V mutation is one of the more common resistance mutations in Kit and this mutant is resistant to imatinib and sorafenib. Type I protein kinase inhibitors interact with the active enzyme form with DFG-D of the proximal activation segment directed inward toward the active site (DFG-Din). In contrast, type II inhibitors bind to their target with the DFG-D pointing away from the active site (DFG-Dout). Based upon the X-ray crystallographic structures, imatinib, sunitinib, and ponatinib are Type II Kit inhibitors. We used the Schrödinger induced fit docking protocol to model the interaction of midostaurin with Kit and the result indicates that it binds to the DFG-Din conformation of the receptor and is thus classified as type I inhibitor. This medication inhibits the notoriously resistant Kit D816V mutant and is approved for the treatment of systemic mastocytosis and is effective against tumors bearing the D816V activation/resistance mutation.
Subject(s)
Antineoplastic Agents/therapeutic use , Neoplasms/drug therapy , Protein Kinase Inhibitors/therapeutic use , Proto-Oncogene Proteins c-kit/antagonists & inhibitors , Animals , Humans , Mutation , Proto-Oncogene Mas , Proto-Oncogene Proteins c-kit/chemistry , Proto-Oncogene Proteins c-kit/genetics , Proto-Oncogene Proteins c-kit/metabolism , Stem Cell Factor/metabolismABSTRACT
BACKGROUND: Gain-of-function mutations and overexpression of KIT are characteristic features of gastrointestinal stromal tumor (GIST). Dysregulation in miRNA expression may lead to KIT overexpression and tumorigenesis. METHODS: miRNA microarray analysis and real-time PCR were used to determine the miRNA expression profiles in a cohort of 69 clinical samples including 50 CD117IHC+/KITmutation GISTs and 19 CD117IHC-/wild-type GISTs. GO enrichment and KEGG pathway analyses were performed to reveal the predicted targets of the dysregulated miRNAs. Of the dysregulated miRNAs whose expression was inversely correlated with that of KIT miRNAs were predicted by bioinformatics analysis and confirmed by luciferase reporter assay. Cell counting kit-8 (CCK-8) and flow cytometry were used to measure the cell proliferation, cycle arrest and apoptosis. Wound healing and transwell assays were used to evaluate migration and invasion. A xenograft BALB/c nude mouse model was applied to investigate the tumorigenesis in vivo. Western blot and qRT-PCR were used to investigate the protein and mRNA levels of KIT and its downstream effectors including ERK, AKT and STAT3. RESULTS: Of the six miRNAs whose expression was inversely correlated with that of KIT, we found that miR-148b-3p was significantly downregulated in the CD117IHC+/KITmutation GIST cohort. This miRNA was subsequently found to inhibit proliferation, migration and invasion of GIST882 cells. Mechanistically, miR-148b-3p was shown to regulate KIT expression through directly binding to the 3'-UTR of the KIT mRNA. Restoration of miR-148b-3p expression in GIST882 cells led to reduced expression of KIT and the downstream effectors proteins ERK, AKT and STAT3. However, overexpression of KIT reversed the inhibitory effect of miR-148b-3p on cell proliferation, migration and invasion. Furthermore, we found that reduced miR-148b-3p expression correlated with poor overall survival (OS) and disease-free survival (DFS) in GIST patients. CONCLUSION: miR-148b-3p functions as an important regulator of KIT expression and a potential prognostic biomarker for GISTs.
Subject(s)
Gastrointestinal Neoplasms/pathology , Gastrointestinal Stromal Tumors/pathology , MicroRNAs/metabolism , Proto-Oncogene Proteins c-kit/metabolism , 3' Untranslated Regions , Animals , Antagomirs/metabolism , Apoptosis/drug effects , Cell Cycle Checkpoints/drug effects , Cell Line, Tumor , Cell Proliferation/drug effects , Female , Gastrointestinal Neoplasms/metabolism , Gastrointestinal Neoplasms/mortality , Gastrointestinal Stromal Tumors/metabolism , Gastrointestinal Stromal Tumors/mortality , Humans , Imatinib Mesylate/pharmacology , Male , Mice , Mice, Inbred BALB C , Mice, Nude , MicroRNAs/antagonists & inhibitors , MicroRNAs/genetics , Middle Aged , Proto-Oncogene Proteins c-kit/chemistry , Proto-Oncogene Proteins c-kit/genetics , STAT3 Transcription Factor/metabolism , Survival RateABSTRACT
Several signaling pathways, ligands, and genes that regulate proliferative and self-renewal properties of the Hematopoietic Stem Cells (HSCs) have been studied meticulously. One of the signaling pathways that play a crucial role in the process of hematopoiesis is the Stem Cell Factor (SCF) mediated c-Kit pathway. The c-Kit is a Receptor Tyrosine Kinase (RTK), which is expressed in the cells including HSCs. It undergoes dimerization upon binding with its cognate ligand SCF. As a result, phosphorylation of the Juxtamembrane (JM) domain of c-Kit takes place at Tyr568 and Tyr570 residues. These phosphorylated residues become the docking sites for protein tyrosine phosphatases (PTPs) namely SHP-1 and SHP-2, which in turn cause dephosphorylation and negative regulation of the downstream signaling responsible for the cell proliferation. Interestingly, it has been reported that the mutation of c-Kit at D816V makes it independent of SCF stimulation and SHP-1/SHP-2 inhibition, thereby, causing its constitutive activation. The present study was commenced to elucidate the structural behavior of this mutation in the JM and A-loop region of c-Kit using Molecular Dynamics (MD) simulations of the wild-type and mutant c-Kit in unphosphorylated and phosphorylated states. The energy difference computed between the wild type and mutant (D816V) c-Kit, and protein-protein docking and complex analysis revealed the impact of this single residue mutation on the integrity dynamics of c-Kit that makes it independent of SHP-1/SHP-2 negative regulation.