Generating a human induced pluripotent stem cell line (XACHi018-A) from a Timothy syndrome infant carrying heterozygous CACNA1C c.1216G>A (p.G406R) mutation.

Timothy syndrome, an extremely rare disease, is closely associated with a mutation in CACNA1C gene, which encodes the cardiac L-type voltage-gated calcium channel (Cav1.2). In this study, we generated a human induced pluripotent stem cell (iPSC) line from a Timothy syndrome infant carrying heterozygous CACNA1C mutation (transcript variant NM_000719.7c.1216G>A: p.G406R). The generated iPSC line showed typical stem cell morphology, positively expressed pluripotency and proliferation markers, normal karyotype, and trilineage differentiation potential. Therefore, this patient-specific iPSC can be of great significance in investigating the mechanisms underlying Timothy syndrome, and hence establishing effective intervention strategies.

Like Father, Like Daughter - Ectodermal Dysplasia-Syndactyly Syndrome: A Case Report.

Ectodermal dysplasia-syndactyly syndrome 1 (EDSS1) is an exceedingly rare condition associated with mutations in the PVL4 gene. It is characterised by sparse, brittle hair, eyebrows and eyelashes, abnormal dentition and nails, along with bilateral cutaneous syndactyly involving the fingers and toes. We report a 2-year-old girl who presented to us with bilateral complete simple syndactyly of the third and fourth web spaces of the hands, along with bilateral syndactyly of both feet involving the second to fourth toes. Upon examination, sparse hair and eyebrows, along with abnormal dentition, were noted. Thorough clinical examination and genetic analysis were conducted on the affected child and her father, who exhibited similar clinical features. Genetic analysis revealed a homozygous nonsense mutation in the PVL4 gene in both individuals. According to the literature, EDSS1 has been reported in only 10 families worldwide, and there are no reported cases from India. Level of Evidence: Level V (Therapeutic).

Identification of a HOXD13 variant in a Mongolian family with incomplete penetrance syndactyly by exon sequencing.

BACKGROUND: Syndactyly (SD) refers to a deformity caused by the fusion and limb differentiation disorder of soft tissues and/or skeletons to varying extents between adjacent fingers (toes). The main features of this disease are phenotypic heterogeneity and genetic heterogeneity. In this study, we examined four generations of a Chinese Mongolian with different phenotypes of syndactylia and analysed and identified the pathogenic genetic variants of SD by exon sequencing. METHODS: The clinical phenotypes of patients were analysed, and the hands and feet were examined by X-ray. The pedigree was drawn, and the family data were analysed. Peripheral blood was collected from the family members, and genomic DNA was extracted. The candidate genes of SD were identified by exon sequencing, and the mutation sites of the captured candidate genes were amplified by PCR and verified by Sanger sequencing. RESULTS: The family has congenital syndactyly, which is an autosomal dominant disease. At present, this condition has been passed down for 4 generations and was identified in 9 patients, including 4 males and 5 females. Five patients, I2, II4, III5, III,7 and III10, had unilateral syndactyly, and four patients, III16, IV3, IV6 and IV7, had bilateral finger syndactyly. All of their toes were unaffected. The proband and the other patients in this family had a c.917G > A (p.R306Q) mutation, which is located at position 917 of the second exon of the HOXD13 gene. This mutation results in a change in the amino acid at position 306, in which arginine is changed to glutamine. This mutation cosegregates in unaffected individuals and affected patients in this family. Moreover, 201 Mongolian genome databases and a thousand human genome databases were referenced to further confirm that the pathogenic genetic variant that causes syndactyly in this family is found in HOXD13. CONCLUSION: This study found that the mutation site of the pathogenic gene in this family was HOXD13, c.917G > A (p.R306Q). The phenotype of the family member III12 was normal, but this member was also a carrier of the pathogenic genetic variant. This indicates that the disease of this family has incomplete penetrance characteristics. Our results further enrich the expression profile of the HOXD13 gene.

Genetic determinants of syndactyly: perspectives on pathogenesis and diagnosis.

The formation of the digits is a tightly regulated process. During embryogenesis, disturbance of genetic pathways in limb development could result in syndactyly; a common congenital malformation consisting of webbing in adjacent digits. Currently, there is a paucity of knowledge regarding the exact developmental mechanism leading to this condition. The best studied canonical interactions of Wingless-type-Bone Morphogenic Protein-Fibroblast Growth Factor (WNT-BMP-FGF8), plays a role in the interdigital cell death (ICD) which is thought to be repressed in human syndactyly. Animal studies have displayed other pathways such as the Notch signaling, metalloprotease and non-canonical WNT-Planar cell polarity (PCP), to also contribute to failure of ICD, although less prominence has been given. The current diagnosis is based on a clinical evaluation followed by radiography when indicated, and surgical release of digits at 6 months of age is recommended. This review discusses the interactions repressing ICD in syndactyly, and characterizes genes associated with non-syndromic and selected syndromes involving syndactyly, according to the best studied canonical WNT-BMP-FGF interactions in humans. Additionally, the controversies regarding the current syndactyly classification and the effect of non-coding elements are evaluated, which to our knowledge has not been previously highlighted. The aim of the review is to better understand the developmental process leading to this condition.

Recent Advances in Syndactyly: Basis, Current Status and Future Perspectives.

A comprehensive summary of recent knowledge in syndactyly (SD) is important for understanding the genetic etiology of SD and disease management. Thus, this review article provides background information on SD, as well as insights into phenotypic and genetic heterogeneity, newly identified gene mutations in various SD types, the role of HOXD13 in limb deformities, and recently introduced modern surgical techniques for SD. This article also proposes a procedure for genetic analysis to obtain a clearer genotype-phenotype correlation for SD in the future. We briefly describe the classification of non-syndromic SD based on variable phenotypes to explain different phenotypic features and mutations in the various genes responsible for the pathogenesis of different types of SD. We describe how different types of mutation in HOXD13 cause various types of SD, and how a mutation in HOXD13 could affect its interaction with other genes, which may be one of the reasons behind the differential phenotypes and incomplete penetrance. Furthermore, we also discuss some recently introduced modern surgical techniques, such as free skin grafting, improved flap techniques, and dermal fat grafting in combination with the Z-method incision, which have been successfully practiced clinically with no post-operative complications.

Ectodermal Dysplasia-Syndactyly Syndrome with Toe-Only Minimal Syndactyly Due to a Novel Mutation in NECTIN4: A Case Report and Literature Review.

Ectodermal dysplasia-syndactyly syndrome 1 (EDSS1) is characterized by cutaneous syndactyly of the toes and fingers and abnormalities of the hair and teeth, variably associated with nail dystrophy and palmoplantar keratoderma (PPK). EDSS1 is caused by biallelic mutations in the NECTIN4 gene, encoding the adherens junction component nectin-4. Nine EDSS1 cases have been described to date. We report a 5.5-year-old female child affected with EDSS1 due to the novel homozygous frameshift mutation c.1150delC (p.Gln384ArgfsTer7) in the NECTIN4 gene. The patient presents brittle scalp hair, sparse eyebrows and eyelashes, widely spaced conical teeth and dental agenesis, as well as toenail dystrophy and mild PPK. She has minimal proximal syndactyly limited to toes 2-3, which makes the phenotype of our patient peculiar as the overt involvement of both fingers and toes is typical of EDSS1. All previously described mutations are located in the nectin-4 extracellular portion, whereas p.Gln384ArgfsTer7 occurs within the cytoplasmic domain of the protein. This mutation is predicted to affect the interaction with afadin, suggesting that impaired afadin activation is sufficient to determine EDSS1. Our case, which represents the first report of a NECTIN4 mutation with toe-only minimal syndactyly, expands the phenotypic and molecular spectrum of EDSS1.

Expanding the phenotype of CACNA1C mutation disorders.

BACKGROUND: Pathogenic variants in the L-type Ca2+ channel gene CACNA1C cause a multi-system disorder that includes severe long QT syndrome (LQTS), congenital heart disease, dysmorphic facial features, syndactyly, abnormal immune function, and neuropsychiatric disorders, collectively known as Timothy syndrome. In 2015, a variant in CACNA1C (p.R518C) was reported to cause cardiac-only Timothy syndrome, a genetic disorder with a mixed phenotype of congenital heart disease, hypertrophic cardiomyopathy (HCM), and LQTS that lacked extra-cardiac features. We have identified a family harboring the p.R518C pathogenic variant with a wider spectrum of clinical manifestations. METHODS: A four-generation family harboring the p.R518C pathogenic variant was reviewed in detail. The proband and his paternal great-uncle underwent comprehensive cardiac gene panel testing, and his remaining family members underwent cascade testing for the p.R518C pathogenic variant. RESULTS: In addition to displaying cardinal features of CACNA1C disorders including LQTS, congenital heart disease, HCM, and sudden cardiac death, family members manifested atrial fibrillation and sick sinus syndrome. CONCLUSION: Our report expands the cardiac phenotype of CACNA1C variants and reflects the variable expressivity of mutations in the L-type Ca2+ channel.

The first adolescent case of Fraser syndrome 3, with a novel nonsense variant in GRIP1.

Fraser syndrome is characterized by cryptophthalmos, syndactyly and other autopod defects, and abnormalities of the respiratory and urogenital tracts. Biallelic variants in GRIP1 can cause Fraser syndrome 3 (FRASRS3), and five unrelated FRASRS3 cases have been reported to date. Four cases are fetuses with homozygous truncating variants. The remaining case is an almost 9-year-old Turkish girl compound heterozygous for a truncation variant and a possibly frame-shift intragenic deletion. We present a 15.5-year old Pakistani boy with homozygous truncating variant c.1774C>T (p.Gln592Ter). Of the hallmarks of the disease, the boy has cryptophthalmia, midface retrusion, very low anterior hairline, hair growth on temples extending to the supraorbital line and also on alae nasi, agenesis of right kidney, and cutaneous syndactyly of fingers and toes but no symptoms in any other organs, including lungs, anorectal system, genitalia, and umbilical system. This case is the oldest known individual with FRASRS3, and our findings show that a homozygous GRIP1 truncating variant can manifest with a non-lethal phenotype than in the reported cases with such variants, expanding the phenotypic and mutational spectrum of GRIP1.

A novel homozygous RIPK4 variant in a family with severe Bartsocas-Papas syndrome.

Bartsocas-Papas syndrome (BPS) is a rare autosomal recessive disorder characterized by popliteal pterygia, syndactyly, ankyloblepharon, filiform bands between the jaws, cleft lip and palate, and genital malformations. Most of the BPS cases reported to date are fatal either in the prenatal or neonatal period. Causative genetic defects of BPS were mapped on the RIPK4 gene encoding receptor-interacting serine/threonine kinase 4, which is critical for epidermal differentiation and development. RIPK4 variants are associated with a wide range of clinical features ranging from milder ectodermal dysplasia to severe BPS. Here, we evaluated a consanguineous Turkish family, who had two pregnancies with severe multiple malformations compatible with BPS phenotype. In order to identify the underlying genetic defect, direct sequencing of the coding region and exon-intron boundaries of RIPK4 was carried out. A homozygous transversion (c.481G>C) that leads to the substitution of a conserved aspartic acid to histidine (p.Asp161His) in the kinase domain of the protein was detected. Pathogenicity predictions, molecular modeling, and cell-based functional assays showed that Asp161 residue is required for the kinase activity of the protein, which indicates that the identified variant is responsible for the severe BPS phenotype in the family.

Nonframeshifting indel variations in polyalanine repeat of HOXD13 gene underlies hereditary limb malformation for two Chinese families.

BACKGROUND: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention. METHODS: The present study aimed to identify the genetic etiologies of a three-generation family with postaxial polydactyly and a four-generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. RESULTS: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly-Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly-Ala position is highly conserved. Hypothetical three-dimensional (3-D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short ß-strand (residues 63-68 or residues 64-68), thereby forming a conformational change. CONCLUSIONS: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management.

Clinical and molecular characterizations of 11 new patients with type 1 Feingold syndrome: Proposal for selecting diagnostic criteria and further genetic testing in patients with severe phenotype.

Feingold Syndrome type 1 (FS1) is an autosomal dominant disorder due to a loss of function mutations in the MYCN gene. FS1 is generally clinically characterized by mild learning disability, microcephaly, short palpebral fissures, short stature, brachymesophalangy, hypoplastic thumbs, as well as syndactyly of toes, variably associated with organ abnormalities, the most common being gastrointestinal atresia. In current literature, more than 120 FS1 patients have been described, but diagnostic criteria are not well agreed upon, likewise the genotype-phenotype correlations are not well understood. Here, we describe 11 FS1 patients, belonging to six distinct families, where we have identified three novel MYCN mutations along with three pathogenetic variants, the latter which have already been reported. Several patients presented a mild phenotype of the condition and they have been diagnosed as being affected only after segregation analyses of the MYCN mutation identified in the propositus. We also describe here the first ever FS1 patient with severe intellectual disability having a maternally inherited MYCN variant together with an additional GNAO1 mutation inherited paternally. Mutations in the GNAO1 gene are associated with a specific form of intellectual disability and epilepsy, thus the finding of two different rare diseases in the same patient could explain his severe phenotype. Therein, a thorough investigation is merited into the possibility that additional variants in patients with a MYCN mutation and severe phenotype do exist. Finally, in order to guarantee a more reliable diagnosis of FS1, we suggest using both major and minor clinical-molecular diagnostic criteria.

Identification of Compound Heterozygous Variants in LRP4 Demonstrates That a Pathogenic Variant outside the Third ß-Propeller Domain Can Cause Sclerosteosis.

Sclerosteosis is a high bone mass disorder, caused by pathogenic variants in the genes encoding sclerostin or LRP4. Both proteins form a complex that strongly inhibits canonical WNT signaling activity, a pathway of major importance in bone formation. So far, all reported disease-causing variants are located in the third ß-propeller domain of LRP4, which is essential for the interaction with sclerostin. Here, we report the identification of two compound heterozygous variants, a known p.Arg1170Gln and a novel p.Arg632His variant, in a patient with a sclerosteosis phenotype. Interestingly, the novel variant is located in the first ß-propeller domain, which is known to be indispensable for the interaction with agrin. However, using luciferase reporter assays, we demonstrated that both the p.Arg1170Gln and the p.Arg632His variant in LRP4 reduced the inhibitory capacity of sclerostin on canonical WNT signaling activity. In conclusion, this study is the first to demonstrate that a pathogenic variant in the first ß-propeller domain of LRP4 can contribute to the development of sclerosteosis, which broadens the mutational spectrum of the disorder.

Novel GLI3 pathogenic variants in complex pre- and postaxial polysyndactyly and Greig cephalopolysyndactyly syndrome.

Polydactyly is a limb malformation and can occur as nonsyndromic polydactyly, syndromic polydactyly, or along with other limb defects. A few genes have been identified that cause various forms of syndromic and nonsyndromic polydactyly, of which GLI3 has been extensively explored. In the present study, GLI3 gene was screened by direct resequencing in 15 polydactyly cases with or without other anomalies. GLI3 screening revealed two novel pathogenic variants, NM_000168.6:c.3414delC [p.(H1138Qfs*68)] and NM_000168.6:c.1862C>T [p.(P621L)], found in two unrelated cases of familial complex pre- and postaxial polysyndactyly and sporadic Greig cephalopolysyndactyly syndrome (GCPS), respectively. The first pathogenic GLI3 variant, NM_000168.6:c.3414delC, causes premature protein truncation at the C-terminal domain of GLI3. Alternatively, the second pathogenic variant, NM_000168.6:c.1862C>T, lies in the DNA binding domain of GLI3 protein and may affect its hydrophobic interaction with DNA. Both pathogenic GLI3 variants had reduced transcriptional activity in HEK293 cells that likely had led to haploinsufficiency and, consequently, the clinical phenotypes. Overall, the present study reports a novel familial case of complex pre- and postaxial polysyndactyly and the underlying novel pathogenic GLI3 variant expanding the clinical criteria for GLI3 mutational spectrum to complex pre- and postaxial polysyndactyly. Furthermore, this study also reports a novel GLI3 pathogenic variant linked to GCPS, highlighting the known genotype-phenotype correlation.

Lethal Cenani Lenz syndrome in two consecutive pregnancies: Further extension of phenotype from Maldives.

Cenani Lenz syndrome is a rare autosomal recessive disorder associated with variable degree of limb malformations, dysmorphism, and renal agenesis. It is caused due to pathogenic variants in the LRP4 gene, which plays an important role in limb and renal development. Mutations in the APC gene have also been occasionally associated with CLS. The phenotypic spectrum ranges from mild to very severe perinatal lethal type depending on the type of variant. We report a pathogenic variant, c.2710 del T (p.Trp904GlyfsTer5) in theLRP4 gene, in a fetus with lethal Cenani Lenz syndrome with antenatal presentation of tetraphocomelia and symmetrical involvement of hands and feet.

Calmodulin Directly Interacts with the Cx43 Carboxyl-Terminus and Cytoplasmic Loop Containing Three ODDD-Linked Mutants (M147T, R148Q, and T154A) that Retain α-Helical Structure, but Exhibit Loss-of-Function and Cellular Trafficking Defects.

The autosomal-dominant pleiotropic disorder called oculodentodigital dysplasia (ODDD) is caused by mutations in the gap junction protein Cx43. Of the 73 mutations identified to date, over one-third are localized in the cytoplasmic loop (Cx43CL) domain. Here, we determined the mechanism by which three ODDD mutations (M147T, R148Q, and T154A), all of which localize within the predicted 1-5-10 calmodulin-binding motif of the Cx43CL, manifest the disease. Nuclear magnetic resonance (NMR) and circular dichroism revealed that the three ODDD mutations had little-to-no effect on the ability of the Cx43CL to form α-helical structure as well as bind calmodulin. Combination of microscopy and a dye-transfer assay uncovered these mutations increased the intracellular level of Cx43 and those that trafficked to the plasma membrane did not form functional channels. NMR also identify that CaM can directly interact with the Cx43CT domain. The Cx43CT residues involved in the CaM interaction overlap with tyrosines phosphorylated by Pyk2 and Src. In vitro and in cyto data provide evidence that the importance of the CaM interaction with the Cx43CT may lie in restricting Pyk2 and Src phosphorylation, and their subsequent downstream effects.

Effects of Reduced Connexin43 Function on Mandibular Morphology and Osteogenesis in Mutant Mouse Models of Oculodentodigital Dysplasia.

Mutations in the gene encoding the gap-junctional protein connexin43 (Cx43) are the cause of the human disease oculodentodigital dysplasia (ODDD). The mandible is often affected in this disease, with clinical reports describing both mandibular overgrowth and conversely, retrognathia. These seemingly opposing observations underscore our relative lack of understanding of how ODDD affects mandibular morphology. Using two mutant mouse models that mimic the ODDD phenotype (I130T/+ and G60S/+), we sought to uncover how altered Cx43 function may affect mandibular development. Specifically, mandibles of newborn mice were imaged using micro-CT, to enable statistical comparisons of shape. Tissue-level comparisons of key regions of the mandible were conducted using histomorphology, and we quantified the mRNA expression of several cartilage and bone cell differentiation markers. Both G60S/+ and I130T/+ mutant mice had altered mandibular morphology compared to their wildtype counterparts, and the morphological effects were similarly localized for both mutants. Specifically, the biggest phenotypic differences in mutant mice were focused in regions exposed to mechanical forces, such as alveolar bone, muscular attachment sites, and articular surfaces. Histological analyses revealed differences in ossification of the intramembranous bone of the mandibles of both mutant mice compared to their wildtype littermates. However, chondrocyte organization within the secondary cartilages of the mandible was unaffected in the mutant mice. Overall, our results suggest that the morphological differences seen in G60S/+ and I130T/+ mouse mandibles are due to delayed ossification and suggest that mechanical forces may exacerbate the effects of ODDD on the skeleton.

Brachydactyly type A3 is caused by a novel 13 bp HOXD13 frameshift deletion in a Chinese family.

Brachydactyly type A (BDA) is defined as short middle phalanges of the affected digits and is subdivided into four types (BDA1-4). To date, the molecular cause is unknown. However, there is some evidence that pathogenic variants of HOXD13 could be associated with BDA3 and BDA4. Here, we report a Chinese autosomal dominant BDA3 pedigree with a novel HOXD13 mutation. The affected individuals presented with an obviously shorter fifth middle phalanx. The radial side of the middle phalanx was shorter than the ulnar side, and the terminal phalanx of the fifth finger inclined radially and formed classical clinodactyly. Interestingly, the index finger was normal. The initial diagnosis was BDA3. However, the distal third and fourth middle phalanges were also slightly affected, resulting in mild radial clinodactyly. Both feet showed shortening of the middle phalanges, which were fused to the distal phalanges of the second to the fifth toes, as reported in BDA4. Therefore, this pedigree had combined BDA3 and atypical BDA4. By direct sequencing, a 13 bp deletion within exon 1 of HOXD13 (NM_000523.4: c.708_720del13; NP_000514.2: p.Gly237fs) was identified. The 13 bp deletion resulted in a frameshift and premature termination of HOXD13. This study provides further evidences that variants in HOXD13 cause BDA3-BDA4 phenotypes.

A Review of the Phenotype of Synpolydactyly Type 1 in Homozygous Patients: Defining the Relatively Long and Medially Deviated Big Toe with/without Cupping of the Forefoot as a Pathognomonic Feature in the Phenotype.

Synpolydactyly type 1 (SPD1, OMIM 186000) is inherited as autosomal dominant and is caused by HOXD13 mutations. The condition is rare and is known for its phenotypic heterogeneity. In the homozygous state, the phenotype is generally more severe and is characterized by three main features: a more severe degree of syndactyly, a more severe degree of brachydactyly, and the frequent loss of the normal tubular shape of the metacarpals/metatarsals. Due to the phenotypic heterogeneity and the phenotypic overlap with other types of syndactyly, no pathognomonic feature has been described for the homozygous phenotype of SPD1. In the current communication, the author reviews the literature on the phenotypes of SPD1 in homozygous patients. The review documents that not all homozygous patients show a severe hand phenotype. The review also defines the "relatively long and medially deviated big toe with/without cupping of the forefoot" as a pathognomonic feature in the phenotype. Illustration of this feature is done through a demonstrative clinical report in a multigeneration family with SPD1 and HOXD13 polyalanine repeat expansion. Finally, the pathogenesis of the clinical features is reviewed.

Classification of aplasia cutis congenita: a 25-year review of cases presenting to a tertiary paediatric dermatology department.

BACKGROUND: Aplasia cutis congenita (ACC) is a rare, congenital disorder characterized by localized or widespread absence of skin at birth with heterogeneous clinical presentation. The classification proposed by Frieden in 1986 is widely used. AIM: To establish whether, 34 years on, the Frieden classification still meets the needs of dermatologists. METHODS: We conducted a retrospective chart review of all patients with a diagnosis of ACC presenting over a 25-year period to a tertiary paediatric dermatology department. We compiled demographic data, clinical characteristics (e.g. number, location and morphology of the lesions), imaging and genetic results where available, and other associated abnormalities, and grouped them according to the Frieden classification. For Type 6 ACC (Bart syndrome) we reviewed neonatal photographs of all babies born with epidermolysis bullosa (EB) over 5 years. RESULTS: Excluding Type 6, there were 56 children with ACC. The scalp was involved in 82.1%, and Type 1 was the commonest type. Over 5 years, 13 of 108 neonates (12%) with EB were born with the appearance of Type 6 ACC. Two children did not fit Frieden's original classification and one had a previously undescribed association of ACC with cleft lip/palate-ectodermal dysplasia 1 syndrome. CONCLUSION: We conclude that the Frieden classification remains valid with some modifications. Type 3 ACC probably represents a mosaic RASopathy syndrome, while Type 7 could cover nongenetic ACC attributable to trauma. Type 8 should be subdivided into two subgroups: teratogenic and infective. Type 9 covers at least four subgroups. The classification will continue to evolve as new genes and pathomechanisms emerge.

Bilateral anophthalmia and intrahepatic biliary atresia, two unusual components of Fraser syndrome: a case report.

BACKGROUND: Fraser syndrome or "cryptophthalmos syndrome" is a rare autosomal recessive disease. It is characterized by a group of congenital malformations such as: crytophthalmos, syndactyly, abnormal genitalia, and malformations of the nose, ears, and larynx. Although cryptophthalmos is considered as a main feature of Fraser syndrome, its absence does not exclude the diagnosis. Clinical diagnosis can be made by Thomas Criteria. Here we present the first documented case of Fraser Syndrome in Aleppo, Syria that is characterized by bilateral anophthalmia and intrahepatic biliary atresia. CASE PRESENTATION: During pregnancy, several ultrasound scans revealed hyperechoic lungs, ascites, and unremarkable right kidney at the 19th-week visit; bilateral syndactyly on both hands and feet at the 32nd-week visit. On the 39th week of gestation, the stillborn was delivered by cesarean section due to cephalopelvic disproportion. Gross examination showed bilateral anophthalmia, bilateral syndactyly on hands and feet, low set ears, and ambiguous genitalia. Microscopic examination of the lung, spleen, liver, ovary, and kidneys revealed abnormalities in these organs. CONCLUSION: The diagnosis of Fraser syndrome can be made prenatally and postnatally; prenatally by ultrasound at 18 weeks of gestation and postnatally by clinical examination using Thomas criteria. Moreover, intrahepatic biliary atresia was not described previously with Fraser syndrome; this recommends a more detailed pathologic study for Fraser syndrome cases.