Impact of rs1805127 and rs55742440 Variants on Atrial Remodeling in Hypertrophic Cardiomyopathy Patients with Atrial Fibrillation: A Romanian Cohort Study.

Atrial fibrillation (AFib) is characterized by a complex genetic component. We aimed to investigate the association between variations in genes related to cardiac ion handling and AFib in a cohort of Romanian patients with hypertrophic cardiomyopathy (HCM). Forty-five unrelated probands with HCM were genotyped by targeted next-generation sequencing (NGS) for 24 genes associated with cardiac ion homeostasis. Subsequently, the study cohort was divided into two groups based on the presence (AFib+) or absence (AFiB-) of AFib detected during ECG monitoring. We identified two polymorphisms (rs1805127 located in KCNE1 and rs55742440 located in SCN1B) linked to AFib susceptibility. In AFib+, rs1805127 was associated with increased indexed left atrial (LA) maximal volume (LAVmax) (58.42 ± 21 mL/m2 vs. 32.54 ± 6.47 mL/m2, p < 0.001) and impaired LA strain reservoir (LASr) (13.3 ± 7.5% vs. 24.4 ± 6.8%, p < 0.05) compared to those without respective variants. The rs55742440 allele was less frequent in patients with AFib+ (12 out of 25, 48%) compared to those without arrhythmia (15 out of 20, 75%, p = 0.05). Also, AFib+ rs55742440 carriers had significantly lower LAVmax compared to those who were genotype negative. Among patients with HCM and AFib+, the rs1805127 variant was accompanied by pronounced LA remodeling, whereas rs55742440's presence was related to a milder LA enlargement.

Complex Synaptic and Intrinsic Interactions Disrupt Input/Output Functions in the Hippocampus of Scn1b Knock-Out Mice.

Pathogenic variants in SCN1B have been linked to severe developmental epileptic encephalopathies including Dravet syndrome. Scn1b knock-out (KO) mice model SCN1B loss-of-function (LOF) disorders, demonstrating seizures, developmental delays, and early death. SCN1B encodes the protein ß1, an ion channel auxiliary subunit that also has roles in cell adhesion, neurite outgrowth, and gene expression. The goal of this project is to better understand of how loss of Scn1b alters information processing in the brain, resulting in seizures and associated cognitive dysfunction. Using slice electrophysiology in the CA1 region of the hippocampus from male and female Scn1b KO mice and wild-type (WT) littermates, we found that processing of physiologically relevant patterned Schaffer collateral (SC) stimulation produces larger, prolonged depolarizations and increased spiking in KO neurons compared with WTs. KO neurons exhibit enhanced intrinsic excitability, firing more action potentials with current injection. Interestingly, SC stimulation produces smaller, more facilitating excitatory and IPSCs in KO pyramidal neurons, but larger postsynaptic potentials (PSPs) with the same stimulation. We also found reduced intrinsic firing of parvalbumin (PV)-expressing interneurons and disrupted recruitment of both parvalbumin-expressing and somatostatin (SST)-expressing interneurons in response to patterned synaptic stimulation. Neuronal information processing relies on the interplay between synaptic properties, intrinsic properties that amplify or suppress incoming synaptic signals, and firing properties that produce cellular output. We found changes at each of these levels in Scn1b KO pyramidal neurons, resulting in fundamentally altered cellular information processing in the hippocampus that likely contributes to the complex phenotypes of SCN1B-linked epileptic encephalopathies.SIGNIFICANCE STATEMENT Genetic developmental epileptic encephalopathies have limited treatment options, in part because of our lack of understanding of how genetic changes result in dysfunction at the cellular and circuit levels. SCN1B is a gene linked to Dravet syndrome and other developmental epileptic encephalopathies, and Scn1b knock-out (KO) mice phenocopy the human disease, allowing us to study underlying neurophysiological changes. Here, we found changes at all levels of neuronal information processing in brains lacking Scn1b, including intrinsic excitability, synaptic properties, and synaptic integration, resulting in greatly enhanced input/output functions of the hippocampus. Our study shows that loss of Scn1b results in a complex array of cellular and network changes that fundamentally alters information processing in the hippocampus.

Heterogeneity of voltage gated sodium current density between neurons decorrelates spiking and suppresses network synchronization in Scn1b null mouse models.

Voltage gated sodium channels (VGSCs) are required for action potential initiation and propagation in mammalian neurons. As with other ion channel families, VGSC density varies between neurons. Importantly, sodium current (INa) density variability is reduced in pyramidal neurons of Scn1b null mice. Scn1b encodes the VGSC ß1/ ß1B subunits, which regulate channel expression, trafficking, and voltage dependent properties. Here, we investigate how variable INa density in cortical layer 6 and subicular pyramidal neurons affects spike patterning and network synchronization. Constitutive or inducible Scn1b deletion enhances spike timing correlations between pyramidal neurons in response to fluctuating stimuli and impairs spike-triggered average current pattern diversity while preserving spike reliability. Inhibiting INa with a low concentration of tetrodotoxin similarly alters patterning without impairing reliability, with modest effects on firing rate. Computational modeling shows that broad INa density ranges confer a similarly broad spectrum of spike patterning in response to fluctuating synaptic conductances. Network coupling of neurons with high INa density variability displaces the coupling requirements for synchronization and broadens the dynamic range of activity when varying synaptic strength and network topology. Our results show that INa heterogeneity between neurons potently regulates spike pattern diversity and network synchronization, expanding VGSC roles in the nervous system.

Tetrodotoxin Decreases the Contractility of Mesenteric Arteries, Revealing the Contribution of Voltage-Gated Na+ Channels in Vascular Tone Regulation.

Tetrodotoxin (TTX) poisoning through the consumption of contaminated fish leads to lethal symptoms, including severe hypotension. This TTX-induced hypotension is likely due to the downfall of peripheral arterial resistance through direct or indirect effects on adrenergic signaling. TTX is a high-affinity blocker of voltage-gated Na+ (NaV) channels. In arteries, NaV channels are expressed in sympathetic nerve endings, both in the intima and media. In this present work, we aimed to decipher the role of NaV channels in vascular tone using TTX. We first characterized the expression of NaV channels in the aorta, a model of conduction arteries, and in mesenteric arteries (MA), a model of resistance arteries, in C57Bl/6J mice, by Western blot, immunochemistry, and absolute RT-qPCR. Our data showed that these channels are expressed in both endothelium and media of aorta and MA, in which scn2a and scn1b were the most abundant transcripts, suggesting that murine vascular NaV channels consist of NaV1.2 channel subtype with NaVß1 auxiliary subunit. Using myography, we showed that TTX (1 µM) induced complete vasorelaxation in MA in the presence of veratridine and cocktails of antagonists (prazosin and atropine with or without suramin) that suppressed the effects of neurotransmitter release. In addition, TTX (1 µM) strongly potentiated the flow-mediated dilation response of isolated MA. Altogether, our data showed that TTX blocks NaV channels in resistance arteries and consecutively decreases vascular tone. This could explain the drop in total peripheral resistance observed during mammal tetrodotoxications.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

Subcellular dynamics and functional activity of the cleaved intracellular domain of the Na+ channel ß1 subunit.

The voltage-gated Na+ channel ß1 subunit, encoded by SCN1B, regulates cell surface expression and gating of α subunits and participates in cell adhesion. ß1 is cleaved by α/ß and γ-secretases, releasing an extracellular domain and intracellular domain (ICD), respectively. Abnormal SCN1B expression/function is linked to pathologies including epilepsy, cardiac arrhythmia, and cancer. In this study, we sought to determine the effect of secretase cleavage on ß1 function in breast cancer cells. Using a series of GFP-tagged ß1 constructs, we show that ß1-GFP is mainly retained intracellularly, particularly in the endoplasmic reticulum and endolysosomal pathway, and accumulates in the nucleus. Reduction in endosomal ß1-GFP levels occurred following γ-secretase inhibition, implicating endosomes and/or the preceding plasma membrane as important sites for secretase processing. Using live-cell imaging, we also report ß1ICD-GFP accumulation in the nucleus. Furthermore, ß1-GFP and ß1ICD-GFP both increased Na+ current, whereas ß1STOP-GFP, which lacks the ICD, did not, thus highlighting that the ß1-ICD is necessary and sufficient to increase Na+ current measured at the plasma membrane. Importantly, although the endogenous Na+ current expressed in MDA-MB-231 cells is tetrodotoxin (TTX)-resistant (carried by Nav1.5), the Na+ current increased by ß1-GFP or ß1ICD-GFP was TTX-sensitive. Finally, we found ß1-GFP increased mRNA levels of the TTX-sensitive α subunits SCN1A/Nav1.1 and SCN9A/Nav1.7. Taken together, this work suggests that the ß1-ICD is a critical regulator of α subunit function in cancer cells. Our data further highlight that γ-secretase may play a key role in regulating ß1 function in breast cancer.

Neonatal Scn1b-null mice have sinoatrial node dysfunction, altered atrial structure, and atrial fibrillation.

Loss-of-function (LOF) variants in SCN1B, encoding the voltage-gated sodium channel ß1/ß1B subunits, are linked to neurological and cardiovascular diseases. Scn1b-null mice have spontaneous seizures and ventricular arrhythmias and die by approximately 21 days after birth. ß1/ß1B Subunits play critical roles in regulating the excitability of ventricular cardiomyocytes and maintaining ventricular rhythmicity. However, whether they also regulate atrial excitability is unknown. We used neonatal Scn1b-null mice to model the effects of SCN1B LOF on atrial physiology in pediatric patients. Scn1b deletion resulted in altered expression of genes associated with atrial dysfunction. Scn1b-null hearts had a significant accumulation of atrial collagen, increased susceptibility to pacing induced atrial fibrillation (AF), sinoatrial node (SAN) dysfunction, and increased numbers of cholinergic neurons in ganglia that innervate the SAN. Atropine reduced the incidence of AF in null animals. Action potential duration was prolonged in null atrial myocytes, with increased late sodium current density and reduced L-type calcium current density. Scn1b LOF results in altered atrial structure and AF, demonstrating the critical role played by Scn1b in atrial physiology during early postnatal mouse development. Our results suggest that SCN1B LOF variants may significantly impact the developing pediatric heart.

Scn1b expression in the adult mouse heart modulates Na+ influx in myocytes and reveals a mechanistic link between Na+ entry and diastolic function.

Voltage-gated sodium channels (VGSCs) are macromolecular assemblies composed of a number of proteins regulating channel conductance and properties. VGSCs generate Na+ current (INa) in myocytes and play fundamental roles in excitability and impulse conduction in the heart. Moreover, VGSCs condition mechanical properties of the myocardium, a process that appears to involve the late component of INa. Variants in the gene SCN1B, encoding the VGSC ß1- and ß1B-subunits, result in inherited neurological disorders and cardiac arrhythmias. But the precise contributions of ß1/ß1B-subunits and VGSC integrity to the overall function of the adult heart remain to be clarified. For this purpose, adult mice with cardiac-restricted, inducible deletion of Scn1b (conditional knockout, cKO) were studied. Myocytes from cKO mice had increased densities of fast (+20%)- and slow (+140%)-inactivating components of INa, with respect to control cells. By echocardiography and invasive hemodynamics, systolic function was preserved in cKO mice, but diastolic properties and ventricular compliance were compromised, with respect to control animals. Importantly, inhibition of late INa with GS967 normalized left ventricular filling pattern and isovolumic relaxation time in cKO mice. At the cellular level, cKO myocytes presented delayed kinetics of Ca2+ transients and cell mechanics, defects that were corrected by inhibition of INa. Collectively, these results document that VGSC ß1/ß1B-subunits modulate electrical and mechanical function of the heart by regulating, at least in part, Na+ influx in cardiomyocytes.NEW & NOTEWORTHY We have investigated the consequences of deletion of Scn1b, the gene encoding voltage-gated sodium channel ß1-subunits, on myocyte and cardiac function. Our findings support the notion that Scn1b expression controls properties of Na+ influx and Ca2+ cycling in cardiomyocytes affecting the modality of cell contraction and relaxation. These effects at the cellular level condition electrical recovery and diastolic function in vivo, substantiating the multifunctional role of ß1-subunits in the physiology of the heart.

Generation of SCN1B knock out induced pluripotent stem cell (iPSC) line (refractory epilepsy syndrome and Brugada syndrome related cell line).

The SCN1B gene, encoding the voltage-gated Na+ channel beta subunit Nav1.1, was founded as the most clinically relevant epilepsy and Brugadasyndrome gene. Variants in SCN1B resulted in genetic epilepsy with febrile seizures plus, severe Dravet Syndrome (DS), Brugadasyndrome, Atrial Arrhythmias, and Long QT-Syndrome. Here, we generated induced pluripotent stem cells (iPSC) from a normal individual by electroporation of peripheral blood mononuclear cells (PBMC), and further generated a SCN1B-knockout human iPSC line via CRISPR/Cas9 gene editing. The resulting iPSCs had normal karyotype, free of genomically integrated epitomal plasmids, expressed pluripotency markers, and maintained trilineage differentiation potential.

Modeling NaV1.1/SCN1A sodium channel mutations in a microcircuit with realistic ion concentration dynamics suggests differential GABAergic mechanisms leading to hyperexcitability in epilepsy and hemiplegic migraine.

Loss of function mutations of SCN1A, the gene coding for the voltage-gated sodium channel NaV1.1, cause different types of epilepsy, whereas gain of function mutations cause sporadic and familial hemiplegic migraine type 3 (FHM-3). However, it is not clear yet how these opposite effects can induce paroxysmal pathological activities involving neuronal networks' hyperexcitability that are specific of epilepsy (seizures) or migraine (cortical spreading depolarization, CSD). To better understand differential mechanisms leading to the initiation of these pathological activities, we used a two-neuron conductance-based model of interconnected GABAergic and pyramidal glutamatergic neurons, in which we incorporated ionic concentration dynamics in both neurons. We modeled FHM-3 mutations by increasing the persistent sodium current in the interneuron and epileptogenic mutations by decreasing the sodium conductance in the interneuron. Therefore, we studied both FHM-3 and epileptogenic mutations within the same framework, modifying only two parameters. In our model, the key effect of gain of function FHM-3 mutations is ion fluxes modification at each action potential (in particular the larger activation of voltage-gated potassium channels induced by the NaV1.1 gain of function), and the resulting CSD-triggering extracellular potassium accumulation, which is not caused only by modifications of firing frequency. Loss of function epileptogenic mutations, on the other hand, increase GABAergic neurons' susceptibility to depolarization block, without major modifications of firing frequency before it. Our modeling results connect qualitatively to experimental data: potassium accumulation in the case of FHM-3 mutations and facilitated depolarization block of the GABAergic neuron in the case of epileptogenic mutations. Both these effects can lead to pyramidal neuron hyperexcitability, inducing in the migraine condition depolarization block of both the GABAergic and the pyramidal neuron. Overall, our findings suggest different mechanisms of network hyperexcitability for migraine and epileptogenic NaV1.1 mutations, implying that the modifications of firing frequency may not be the only relevant pathological mechanism.

Modulation of the effects of class Ib antiarrhythmics on cardiac NaV1.5-encoded channels by accessory NaVß subunits.

Native myocardial voltage-gated sodium (NaV) channels function in macromolecular complexes comprising a pore-forming (α) subunit and multiple accessory proteins. Here, we investigated the impact of accessory NaVß1 and NaVß3 subunits on the functional effects of 2 well-known class Ib antiarrhythmics, lidocaine and ranolazine, on the predominant NaV channel α subunit, NaV1.5, expressed in the mammalian heart. We showed that both drugs stabilized the activated conformation of the voltage sensor of domain-III (DIII-VSD) in NaV1.5. In the presence of NaVß1, the effect of lidocaine on the DIII-VSD was enhanced, whereas the effect of ranolazine was abolished. Mutating the main class Ib drug-binding site, F1760, affected but did not abolish the modulation of drug block by NaVß1/ß3. Recordings from adult mouse ventricular myocytes demonstrated that loss of Scn1b (NaVß1) differentially affected the potencies of lidocaine and ranolazine. In vivo experiments revealed distinct ECG responses to i.p. injection of ranolazine or lidocaine in WT and Scn1b-null animals, suggesting that NaVß1 modulated drug responses at the whole-heart level. In the human heart, we found that SCN1B transcript expression was 3 times higher in the atria than ventricles, differences that could, in combination with inherited or acquired cardiovascular disease, dramatically affect patient response to class Ib antiarrhythmic therapies.

Frequency of Irritable Bowel Syndrome in Patients with Brugada Syndrome and Drug-Induced Type 1 Brugada Pattern.

Irritable bowel syndrome (IBS) is one of the most widely recognized functional bowel disorders (FBDs) with a genetic component. SCN5A gene and SCN1B loci have been identified in population-based IBS cohorts and proposed to have a mechanistic role in the pathophysiology of IBS. These same genes have been associated with Brugada syndrome (BrS). The present study examines the hypothesis that these two inherited syndromes are linked. Prevalence of FBDs over a 12 months period were compared between probands with BrS/drug-induced type 1 Brugada pattern (DI-Type 1 BrP) (n = 148) and a control group (n = 124) matched for age, female sex, presence of arrhythmia and co-morbid conditions. SCN5A/SCN1B genes were screened in 88 patients. Prevalence of IBS was 25% in patients with BrS/DI-Type 1 BrP and 8.1% in the control group (p = 2.34 × 10-4). On stepwise logistic regression analysis, presence of current and/or history of migraine (OR of 2.75; 95% CI: 1.08 to 6.98; p = 0.033) was a predictor of underlying BrS/DI-Type 1 BrP among patients with FBDs. We identified 8 putative SCN5A/SCN1B variants in 7 (12.3%) patients with BrS/DI-Type 1 BrP and 1 (3.2%) patient in control group. Five out of 8 (62.5%) patients with SCN5A/SCN1B variants had FBDs. In conclusion, IBS is a common co-morbidity in patients with BrS/DI-Type 1 BrP. Presence of current and/or history of migraine are a predictor of underlying BrS/DI-Type 1 BrP among patients with FBDs. Frequent co-existence of IBS and BrS/DI-Type 1 BrP necessitates cautious use of certain drugs among the therapeutic options for IBS that are known to exacerbate the Brugada phenotype.

Homozygous SCN1B variants causing early infantile epileptic encephalopathy 52 affect voltage-gated sodium channel function.

We identified nine patients from four unrelated families harboring three biallelic variants in SCN1B (NM_001037.5: c.136C>T; p.[Arg46Cys], c.178C>T; p.[Arg60Cys], and c.472G>A; p.[Val158Met]). All subjects presented with early infantile epileptic encephalopathy 52 (EIEE52), a rare, severe developmental and epileptic encephalopathy featuring infantile onset refractory seizures followed by developmental stagnation or regression. Because SCN1B influences neuronal excitability through modulation of voltage-gated sodium (NaV ) channel function, we examined the effects of human SCN1BR46C (ß1R46C ), SCN1BR60C (ß1R60C ), and SCN1BV158M (ß1V158M ) on the three predominant brain NaV channel subtypes NaV 1.1 (SCN1A), NaV 1.2 (SCN2A), and NaV 1.6 (SCN8A). We observed a shift toward more depolarizing potentials of conductance-voltage relationships (NaV 1.2/ß1R46C , NaV 1.2/ß1R60C , NaV 1.6/ß1R46C , NaV 1.6/ß1R60C , and NaV 1.6/ß1V158M ) and channel availability (NaV 1.1/ß1R46C , NaV 1.1/ß1V158M , NaV 1.2/ß1R46C , NaV 1.2/ß1R60C , and NaV 1.6/ß1V158M ), and detected a slower recovery from fast inactivation for NaV 1.1/ß1V158M . Combined with modeling data indicating perturbation-induced structural changes in ß1, these results suggest that the SCN1B variants reported here can disrupt normal NaV channel function in the brain, which may contribute to EIEE52.

Sodium channel ß1 subunits participate in regulated intramembrane proteolysis-excitation coupling.

Loss-of-function (LOF) variants in SCN1B, encoding voltage-gated sodium channel ß1 subunits, are linked to human diseases with high risk of sudden death, including developmental and epileptic encephalopathy and cardiac arrhythmia. ß1 Subunits modulate the cell-surface localization, gating, and kinetics of sodium channel pore-forming α subunits. They also participate in cell-cell and cell-matrix adhesion, resulting in intracellular signal transduction, promotion of cell migration, calcium handling, and regulation of cell morphology. Here, we investigated regulated intramembrane proteolysis (RIP) of ß1 by BACE1 and γ-secretase and show that ß1 subunits are substrates for sequential RIP by BACE1 and γ-secretase, resulting in the generation of a soluble intracellular domain (ICD) that is translocated to the nucleus. Using RNA sequencing, we identified a subset of genes that are downregulated by ß1-ICD overexpression in heterologous cells but upregulated in Scn1b-null cardiac tissue, which lacks ß1-ICD signaling, suggesting that the ß1-ICD may normally function as a molecular brake on gene transcription in vivo. We propose that human disease variants resulting in SCN1B LOF cause transcriptional dysregulation that contributes to altered excitability. Moreover, these results provide important insights into the mechanism of SCN1B-linked channelopathies, adding RIP-excitation coupling to the multifunctionality of sodium channel ß1 subunits.

Excitatory and inhibitory neuron defects in a mouse model of Scn1b-linked EIEE52.

OBJECTIVE: Human variants in voltage-gated sodium channel (VGSC) α and ß subunit genes are linked to developmental and epileptic encephalopathies (DEEs). Inherited, biallelic, loss-of-function variants in SCN1B, encoding the ß1/ß1B subunits, are linked to early infantile DEE (EIEE52). De novo, monoallelic variants in SCN1A (Nav1.1), SCN2A (Nav1.2), SCN3A (Nav1.3), and SCN8A (Nav1.6) are also linked to DEEs. While these VGSC-linked DEEs have similar presentations, they have diverse mechanisms of altered neuronal excitability. Mouse models have suggested that Scn2a-, Scn3a-, and Scn8a-linked DEE variants are, in general, gain of function, resulting in increased persistent or resurgent sodium current (INa ) and pyramidal neuron hyperexcitability. In contrast, Scn1a-linked DEE variants, in general, are loss-of-function, resulting in decreased INa and hypoexcitability of fast-spiking interneurons. VGSC ß1 subunits associate with Nav1.1, Nav1.2, Nav1.3, and Nav1.6 and are expressed throughout the brain, raising the possibility that insults to both pyramidal and interneuron excitability may drive EIEE52 pathophysiology. METHODS: We investigated excitability defects in pyramidal and parvalbumin-positive (PV +) interneurons in the Scn1b-/- model of EIEE52. We also used Scn1bFL/FL mice to delete Scn1b in specific neuronal populations. RESULTS: Scn1b-/- cortical PV + interneurons were hypoexcitable, with reduced INa density. Scn1b-/- cortical pyramidal neurons had population-specific changes in excitability and impaired INa density. Scn1b deletion in PV + neurons resulted in 100% lethality, whereas deletion in Emx1 + or Camk2a + neurons did not affect survival. INTERPRETATION: This work suggests that SCN1B-linked DEE variants impact both excitatory and inhibitory neurons, leading to the increased severity of EIEE52 relative to other DEEs.

Sodium channel ß1 subunits are post-translationally modified by tyrosine phosphorylation, S-palmitoylation, and regulated intramembrane proteolysis.

Voltage-gated sodium channel (VGSC) ß1 subunits are multifunctional proteins that modulate the biophysical properties and cell-surface localization of VGSC α subunits and participate in cell-cell and cell-matrix adhesion, all with important implications for intracellular signal transduction, cell migration, and differentiation. Human loss-of-function variants in SCN1B, the gene encoding the VGSC ß1 subunits, are linked to severe diseases with high risk for sudden death, including epileptic encephalopathy and cardiac arrhythmia. We showed previously that ß1 subunits are post-translationally modified by tyrosine phosphorylation. We also showed that ß1 subunits undergo regulated intramembrane proteolysis via the activity of ß-secretase 1 and γ-secretase, resulting in the generation of a soluble intracellular domain, ß1-ICD, which modulates transcription. Here, we report that ß1 subunits are phosphorylated by FYN kinase. Moreover, we show that ß1 subunits are S-palmitoylated. Substitution of a single residue in ß1, Cys-162, to alanine prevented palmitoylation, reduced the level of ß1 polypeptides at the plasma membrane, and reduced the extent of ß1-regulated intramembrane proteolysis, suggesting that the plasma membrane is the site of ß1 proteolytic processing. Treatment with the clathrin-mediated endocytosis inhibitor, Dyngo-4a, re-stored the plasma membrane association of ß1-p.C162A to WT levels. Despite these observations, palmitoylation-null ß1-p.C162A modulated sodium current and sorted to detergent-resistant membrane fractions normally. This is the first demonstration of S-palmitoylation of a VGSC ß subunit, establishing precedence for this post-translational modification as a regulatory mechanism in this protein family.

Functional informed genome-wide interaction analysis of body mass index, diabetes and colorectal cancer risk.

BACKGROUND: Body mass index (BMI) and diabetes are established risk factors for colorectal cancer (CRC), likely through perturbations in metabolic traits (e.g. insulin resistance and glucose homeostasis). Identification of interactions between variation in genes and these metabolic risk factors may identify novel biologic insights into CRC etiology. METHODS: To improve statistical power and interpretation for gene-environment interaction (G × E) testing, we tested genetic variants that regulate expression of a gene together for interaction with BMI (kg/m2 ) and diabetes on CRC risk among 26 017 cases and 20 692 controls. Each variant was weighted based on PrediXcan analysis of gene expression data from colon tissue generated in the Genotype-Tissue Expression Project for all genes with heritability ≥1%. We used a mixed-effects model to jointly measure the G × E interaction in a gene by partitioning the interactions into the predicted gene expression levels (fixed effects), and residual G × E effects (random effects). G × BMI analyses were stratified by sex as BMI-CRC associations differ by sex. We used false discovery rates to account for multiple comparisons and reported all results with FDR <0.2. RESULTS: Among 4839 genes tested, genetically predicted expressions of FOXA1 (P = 3.15 × 10-5 ), PSMC5 (P = 4.51 × 10-4 ) and CD33 (P = 2.71 × 10-4 ) modified the association of BMI on CRC risk for men; KIAA0753 (P = 2.29 × 10-5 ) and SCN1B (P = 2.76 × 10-4 ) modified the association of BMI on CRC risk for women; and PTPN2 modified the association between diabetes and CRC risk in both sexes (P = 2.31 × 10-5 ). CONCLUSIONS: Aggregating G × E interactions and incorporating functional information, we discovered novel genes that may interact with BMI and diabetes on CRC risk.

Brugada Syndrome Caused by Sodium Channel Dysfunction Associated with a SCN1B Variant A197V.

OBJECTIVE: We aimed to identify and characterize a SCN1B variant, A197V, associated with Brugada Syndrome (BrS). METHODS: Whole-exome sequencing was employed to explore the potential causative genes in 8 unrelated clinically diagnosed BrS patients. A197V variant was only detected in exon 4 of SCN1B in a 46 year old patient, who was admitted due to syncope. Wild type (WT) and mutant (A197V) genes were co-expressed with SCN5A in human embryonic kidney cells (HEK293 cells) and studied using whole-cell patch clamp and immunodetection techniques. RESULTS: Coexpression of 5A/WT + 1B/A197V resulted in a marked decrease in current density compared to 5A/WT + 1B/WT. The activation velocity was decelerated by A197V mutation. No significant changes were observed in recovery from inactivation parameters. Cell surface protein analyses confirmed that Nav1.5 channel membrane distribution was affected by A197V mutation. CONCLUSIONS: The current study is the first to report the functional analysis of SCN1B/ A197V, serving as a substrate responsible for BrS.

Sexually Divergent Mortality and Partial Phenotypic Rescue After Gene Therapy in a Mouse Model of Dravet Syndrome.

Dravet syndrome (DS) is a neurodevelopmental genetic disorder caused by mutations in the SCN1A gene encoding the α subunit of the NaV1.1 voltage-gated sodium channel that controls neuronal action potential firing. The high density of this mutated channel in GABAergic interneurons results in impaired inhibitory neurotransmission and subsequent excessive activation of excitatory neurons. The syndrome is associated with severe childhood epilepsy, autistic behaviors, and sudden unexpected death in epilepsy. Here, we compared the rescue effects of an adeno-associated viral (AAV) vector coding for the multifunctional ß1 sodium channel auxiliary subunit (AAV-NaVß1) with a control vector lacking a transgene. We hypothesized that overexpression of NaVß1 would facilitate the function of residual voltage-gated channels and improve the DS phenotype in the Scn1a+/- mouse model of DS. AAV-NaVß1 was injected into the cerebral spinal fluid of neonatal Scn1a+/- mice. In untreated control Scn1a+/- mice, females showed a higher degree of mortality than males. Compared with Scn1a+/- control mice, AAV-NaVß1-treated Scn1a+/- mice displayed increased survival, an outcome that was more pronounced in females than males. In contrast, behavioral analysis revealed that male, but not female, Scn1a+/- mice displayed motor hyperactivity, and abnormal performance on tests of fear and anxiety and learning and memory. Male Scn1a+/- mice treated with AAV-NaVß1 showed reduced spontaneous seizures and normalization of motor activity and performance on the elevated plus maze test. These findings demonstrate sex differences in mortality in untreated Scn1a+/- mice, an effect that may be related to a lower level of intrinsic inhibitory tone in female mice, and a normalization of aberrant behaviors in males after central nervous system administration of AAV-NaVß1. The therapeutic efficacy of AAV-NaVß1 in a mouse model of DS suggests a potential new long-lasting biological therapeutic avenue for the treatment of this catastrophic epilepsy.