Reliability, validity, and responsiveness of the Arabic version of HIT-6 questionnaire in patients with migraine indicated for preventive therapy: A multi-center study.

BACKGROUND: The Headache Impact Test (HIT-6) is an important patient-reported outcome measure (PROM) in migraine prevention trials. OBJECTIVES: This study aimed to (i) assess the reliability and validity of the Arabic version of HIT-6 in Arabic-speaking patients experiencing migraine, and (ii) evaluate the responsiveness of HIT-6 following migraine preventive therapy. METHODS: In this prospective study, patients with migraine (n = 145) were requested to fill out a headache diary, the Arabic version of HIT-6, and Migraine Disability Assessment Scale (MIDAS) at two time points (baseline and 3 months after initiation of prophylactic treatment). Some respondents (n = 73) were requested to fill out HIT-6 again 1 week from the baseline for test-retest reliability. The intensity of migraine headache attacks was evaluated using the Visual Analogue Scale (VAS). An anchor-based method was used to establish the minimal important change (MIC) value and responsiveness of HIT-6. RESULTS: The total scores of HIT-6 were significantly correlated to a fair degree with MIDAS (r = 0.41), as well as VAS (r = 0.53), and monthly migraine days (r = 0.38) at the baseline while at the follow-up (after 3 months), the correlations were of moderate degree with MIDAS scores (r = 0.62) and monthly migraine days (r = 0.60; convergent validity). Reliability estimates of the Arabic HIT-6 were excellent (Cronbach's α = 0.91 at baseline and 0.89 at follow-up). The average measure interclass correlation coefficient (ICC) value for the test-retest reliability was 0.96 (95% confidence interval = 0.94-0.98, p < 0.001). The HIT-6 total score is sensitive to change, being significantly reduced after prophylactic treatment compared to before (effect size = 1.5, standardized response mean = 1.3). A reduction from baseline of 4.5 on HIT-6 showed the highest responsiveness to predict improvement with an area under the curve equal to 0.66, sensitivity of 80%, specificity of 45%, and significance at 0.021. Changes in the HIT-6 total score were positively correlated with changes in monthly migraine days (r = 0.40) and VAS scores (r = 0.69) but not with changes in the score of MIDAS (r = 0.07). CONCLUSION: The Arabic version of HIT-6 is valid, reliable, and sensitive to detect clinical changes following migraine prophylactic treatment with a MIC of 4.5 points.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

Improving public stigma, sociocultural beliefs, and social identity for people with epilepsy in the Aseer region of Saudi Arabia.

Differences in the sociocultural practice and biases against people with epilepsy (PWE) largely contribute to the development of stigmatization. In this study, we evaluated factors that impact stigma for PWE involved in evolution and maintenance to report changes in the public awareness and cultural practices. We performed a cross-sectional study in which data were collected from a self-administered electronic survey composed of 33 items targeting the population in the Aseer region. Feedback response was obtained from 937 respondents. Of these, 921 participants (98.3%) had heard or read about the disorder previously. Approximately 84.8% believed that epilepsy was one of the brain disorders. 95.8% disagreed that epilepsy was due to a contagious disease. However, 40.1% of the responders were convinced that it was the result of a spiritual reason. Still, more than 9% believed treating PWE should be approached spiritually. About 75% felt that epilepsy could be the results of a test delievered by God. In addition to the clinical impact from seizures in PWE, it carries a social label and public stigma that influences one's social prognosis. Raising awareness through campaigns would improve the knowledge and practices of the population and hence provide a healthier environment for PWE, alleviating feelings of stigma, and improving their quality of life.

Micro-RNA-96 and interleukin-10 are independent biomarkers for multiple sclerosis activity.

BACKGROUND: Micro-RNAs (miRNAs) are evolving as biological markers for multiple sclerosis (MS) both in activity and remission. miR-96 is associated with remission, however, the exact mechanism through which it contributes to the anti-inflammatory pathway is not clear. OBJECTIVE: To study the expression of miR-96 and IL-10 (anti-inflammatory mediator) in relapsing remitting (RR) MS. SUBJECTS AND METHODS: A case control study including 32 RRMS patients from Kasr Al-Ainy MS clinic, Cairo University, Egypt, and 26 healthy controls (HC). Assessment of serum IL-10 by ELISA, and miR-96 via real time PCR was done during relapse and remission in patients, and in HC. RESULTS: IL-10 was higher in RRMS patients during remission and in HC compared with relapse (P ˂ 0.001). miR-96 expression was higher in RRMS patients during remission compared with relapse and HC, and was higher in HC than in relapse (P ˂ 0.001). IL-10 level in remission correlated positively with disease duration (r = 0.41; P = 0.02). Otherwise, no correlation was found between IL-10 and relapse number or EDSS (P>0.05). miR-96 in relapse negatively correlated with EDSS in relapse (r=-0.47; P=0.007), but no correlation was found with disease duration or relapse number, whereas, miR-96 in remission did not correlate with any clinical parameters (P>0.05). No correlation was found between IL-10 and miR-96 either in relapse or remission (P>0.05). CONCLUSION: IL-10 and miR-96 are associated with MS quiescence, however, the lack of a significant correlation between them implicates that the influence of miR-96 may be exhibited through some pathway other than IL-10.