[Study of the secondary structure of a single-stranded DNA fragment using self-modification reaction]. / Izuchenie vtorichnoi struktury odnotsepochechnogo fragmenta DNK s ispol'zovaniem reaktsii samomodifikatsii.

Electrophoretic analysis of the products of chemical destruction at modified base residues was used to determine the site-directedness of self-alkylation of the 26-mer DNA fragment pTTGCCTTGAATGGGAAGAGGGTCATT (T26). This fragment possesses a 4-[N-methyl-N-(2-chloroethyl)amino]benzylamido group (CIR-), covalently attached to the 5'-terminal phosphate group both in the presence and in the absence of the oligonucleotide effector (Phn-L)pTGACCCTCp(L-Phn), where Phn is an N-(2-hydroxyethyl)phenazinium residue and L is an ethylenediamine linker. Molecular modeling with the method of molecular mechanics/dynamics (MM/D) was used to investigate the secondary structure of the CIR-T26 conjugate and to interpret the change of the alkylation site upon treatment with CIR-T26 in the presence of an effector.

[Cooperative interactions of oligodeoxyribonucleotides upon binding with DNA by chemical modification]. / Izuchenie kooperativnykh vzaimodeistvii proizvodnykh dezoksiribooligonukleotidov pri sviazyvanii s DNK metodom khimicheskoi modifikatsii.

Quantitative characteristics of the modification of deoxyribooligonucleotide TTGCCTTGAATGG-GAAGAGGGTCATT (P) with 4-(N-2-chloroethyl-N-methylamino)benzyl phosphamide derivative of oligonucleotide pTTCCCA (X) were studied. The modification was performed in the presence of derivatives of the oligonucleotides (Phn-L)pTTCAAGGCp(L-Phn) (E1) and (Phn-L)pTGACCCTCp(L-Phn) (E2), where Phn is the residue of N-(2-hydroxyethyl)phenazinium, and L is ethylene diamine spacer. In PXE1, PXE2, and PXE1E2 complexes, E1, E2, and reagent X are bound with target P in tandem, with E1 near the 3'-end and E2 near the 5'-end of the reagent X. From the dependences of the maximum in time modification degree of target P and the shorter targets containing the complementary binding site for the reagent X on its concentration, the association constants of the complexes PX, PE1, and PE2 were determined as Kx = (4.2 +/- 0.6) x 10(4) M-1, Ke1 = (1.25 +/- 0.44) x 10(7) M-1, and Ke2 = (2.56 +/- 1.22) x 10(6) M-1, respectively. The cooperativity coefficients of joint binding the X, E1, and E2 with the target giving rise to the complexes PXE1, PXE2, and PXE1E2 were estimated as alpha 1 = 15.7 +/- 2.1, alpha 2 = 8.7 +/- 1.2, and alpha 12 = 136.5 +/- 2.6, respectively. The data obtained suggest that E2 is not only the effector of modification but it is also an inhibitor due to the formation of the complex PE2* with Ke2* = (1.97 +/- 1.27) x 10(7) M-1 not capable of adding the reagent X.