RESUMEN
BACKGROUND: Elucidating the intricate structural organization and spatial gradients of biomolecular composition within the rhizosphere is critical to understanding important biogeochemical processes, which include the mechanisms of root-microbe interactions for maintaining sustainable plant ecosystem services. While various analytical methods have been developed to assess the spatial heterogeneity within the rhizosphere, a comprehensive view of the fine distribution of metabolites within the root-soil interface has remained a significant challenge. This is primarily due to the difficulty of maintaining the original spatial organization during sample preparation without compromising its molecular content. RESULTS: In this study, we present a novel approach, RhizoMAP, in which the rhizosphere molecules are imprinted on selected polymer membranes and then spatially profiled using matrix-assisted laser desorption/ionization (MALDI) mass spectrometry imaging (MSI). We enhanced the performance of RhizoMAP by combining the use of two thin (< 20 µm) membranes (polyester and polycarbonate) with distinct MALDI sample preparations. This optimization allowed us to gain insight into the distribution of over 500 different molecules within the rhizosphere of poplar (Populus trichocarpa) grown in rhizoboxes filled with mycorrhizae soil. These two membranes, coupled with three different sample preparation conditions, enabled us to capture the distribution of a wide variety of molecules that included phytohormones, amino acids, sugars, sugar glycosides, polycarboxylic acids components of the Krebs cycle, fatty acids, short aldehydes and ketones, terpenes, volatile organic compounds, fertilizers from the soil, and others. Their spatial distribution varies greatly, with some following root traces, others showing diffusion from roots, some associated with soil particles, and many having distinct hot spots along the plant root or surrounding soil. Moreover, we showed how RhizoMAP can be used to localize the origin of the molecules and molecular transformation during root growth. Finally, we demonstrated the power of RhizoMAP to capture molecular distributions of key metabolites throughout a 20 cm deep rhizosphere. CONCLUSIONS: RhizoMAP is a method that provides nondestructive, untargeted, broad, and sensitive metabolite imaging of root-associated molecules, exudates, and soil organic matter throughout the rhizosphere, as demonstrated in a lab-controlled native soil environment.
RESUMEN
The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue 'omics'-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.
RESUMEN
Biological nitrogen fixation by microbial diazotrophs can contribute significantly to nitrogen availability in non-nodulating plant species. In this study of molecular mechanisms and gene expression relating to biological nitrogen fixation, the aerobic nitrogen-fixing endophyte Burkholderia vietnamiensis, strain WPB, isolated from Populus trichocarpa served as a model for endophyte-poplar interactions. Nitrogen-fixing activity was observed to be dynamic on nitrogen-free medium with a subset of colonies growing to form robust, raised globular like structures. Secondary ion mass spectrometry (NanoSIMS) confirmed that N-fixation was uneven within the population. A fluorescent transcriptional reporter (GFP) revealed that the nitrogenase subunit nifH is not uniformly expressed across genetically identical colonies of WPB and that only ~11% of the population was actively expressing the nifH gene. Higher nifH gene expression was observed in clustered cells through monitoring individual bacterial cells using single-molecule fluorescence in situ hybridization. Through 15N2 enrichment, we identified key nitrogenous metabolites and proteins synthesized by WPB and employed targeted metabolomics in active and inactive populations. We cocultivated WPB Pnif-GFP with poplar within a RhizoChip, a synthetic soil habitat, which enabled direct imaging of microbial nifH expression within root epidermal cells. We observed that nifH expression is localized to the root elongation zone where the strain forms a unique physical interaction with the root cells. This work employed comprehensive experimentation to identify novel mechanisms regulating both biological nitrogen fixation and beneficial plant-endophyte interactions.
Asunto(s)
Fijación del Nitrógeno , Populus , Fijación del Nitrógeno/fisiología , Populus/genética , Populus/metabolismo , Endófitos/genética , Oxidorreductasas/genética , Hibridación Fluorescente in Situ , Nitrogenasa/genética , Nitrogenasa/metabolismo , NitrógenoRESUMEN
Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.
Asunto(s)
Regulación de la Expresión Génica de las Plantas , Plantas Modificadas Genéticamente , Populus , Regiones Promotoras Genéticas , Populus/genética , Populus/metabolismo , Regiones Promotoras Genéticas/genética , Plantas Modificadas Genéticamente/genética , Deshidratación/genética , Estrés Fisiológico/genética , Especificidad de Órganos/genética , Hojas de la Planta/genética , Hojas de la Planta/metabolismoRESUMEN
Probing the entirety of any species metabolome is an analytical grand challenge, especially on a cellular scale. Matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI) is a common spatial metabolomics assay, but this technique has limited molecular coverage for several reasons. To expand the application space of spatial metabolomics, we developed an on-tissue chemical derivatization (OTCD) workflow using 4-APEBA for the confident identification of several dozen elusive phytocompounds. Overall, this new OTCD method enabled the annotation of roughly 280 metabolites, with only a 10% overlap in metabolic coverage when compared to analog negative ion mode MALDI-MSI on serial sections. We demonstrate that 4-APEBA outperforms other derivatization agents by providing: (1) broad specificity toward carbonyls, (2) low background, and (3) introduction of bromine isotopes. Notably, the latter two attributes also facilitate more confidence in our bioinformatics for data processing. The workflow detailed here trailblazes a path toward spatial hormonomics within plant samples, enhancing the detection of carboxylates, aldehydes, and plausibly other carbonyls. As such, several phytohormones, which have various roles within stress responses and cellular communication, can now be spatially profiled, as demonstrated in poplar root and soybean root nodule.
Asunto(s)
Aldehídos , Bioensayo , Espectrometría de Masa por Láser de Matriz Asistida de Ionización Desorción , Ácidos Carboxílicos , Comunicación CelularRESUMEN
The root system of plants consists of primary, lateral, and adventitious roots (ARs) (aka shoot-born roots). ARs arise from stem- or leaf-derived cells during post-embryonic development. Adventitious root development (ARD) through stem cuttings is the first requirement for successful establishment and growth of planted trees; however, the details of the molecular mechanisms underlying ARD are poorly understood. This knowledge is important to both basic plant biology and because of its necessary role in the successful propagation of superior cultivars of commercial woody bioenergy crops, like poplar. In this review article, the molecular mechanisms that control both endogenous (auxin) and environmentally (nutrients and microbes) regulated ARD and how these systems interact to control the rooting efficiency of poplar trees are described. Then, potential future studies in employing integrated systems biology approaches at cellular resolutions are proposed to more precisely identify the molecular mechanisms that cause AR. Using genetic transformation and genome editing approaches, this information can be used for improving ARD in economically important plants for which clonal propagation is a requirement.
Asunto(s)
Proteínas de Plantas , Populus , Proteínas de Plantas/genética , Populus/genética , Biología de Sistemas , Ácidos Indolacéticos , Raíces de Plantas/genéticaRESUMEN
Source-to-sink carbon (C) allocation driven by the sink strength, i.e., the ability of a sink organ to import C, plays a central role in tissue growth and biomass productivity. However, molecular drivers of sink strength have not been thoroughly characterized in trees. Auxin, as a major plant phytohormone, regulates the mobilization of photoassimilates in source tissues and elevates the translocation of carbohydrates toward sink organs, including roots. In this study, we used an 'auxin-stimulated carbon sink' approach to understand the molecular processes involved in the long-distance source-sink C allocation in poplar. Poplar cuttings were foliar sprayed with polar auxin transport modulators, including auxin enhancers (AE) (i.e., IBA and IAA) and auxin inhibitor (AI) (i.e., NPA), followed by a comprehensive analysis of leaf, stem, and root tissues using biomass evaluation, phenotyping, C isotope labeling, metabolomics, and transcriptomics approaches. Auxin modulators altered root dry weight and branching pattern, and AE increased photosynthetically fixed C allocation from leaf to root tissues. The transcriptome analysis identified highly expressed genes in root tissue under AE condition including transcripts encoding polygalacturonase and ß-amylase that could increase the sink size and activity. Metabolic analyses showed a shift in overall metabolism including an altered relative abundance levels of galactinol, and an opposite trend in citrate levels in root tissue under AE and AI conditions. In conclusion, we postulate a model suggesting that the source-sink C relationships in poplar could be fueled by mobile sugar alcohols, starch metabolism-derived sugars, and TCA-cycle intermediates as key molecular drivers of sink strength.
RESUMEN
Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.
RESUMEN
Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six synthetic drought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis-regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.
RESUMEN
Plant-based biosynthesis of fuels, chemicals, and materials promotes environmental sustainability, which includes decreases in greenhouse gas emissions, water pollution, and loss of biodiversity. Advances in plant synthetic biology (synbio) should improve precision and efficacy of genetic engineering for sustainability. Applicable synbio innovations include genome editing, gene circuit design, synthetic promoter development, gene stacking technologies, and the design of environmental sensors. Moreover, recent advancements in developing spatially resolved and single-cell omics contribute to the discovery and characterization of cell-type-specific mechanisms and spatiotemporal gene regulations in distinct plant tissues for the expression of cell- and tissue-specific genes, resulting in improved bioproduction. This review highlights recent plant synbio progress and new single-cell molecular profiling towards sustainable biofuel and biomaterial production.
Asunto(s)
Biocombustibles , Biología Sintética , Plantas/genética , Ingeniería Genética , BiomasaRESUMEN
With growing populations and pressing environmental problems, future economies will be increasingly plant-based. Now is the time to reimagine plant science as a critical component of fundamental science, agriculture, environmental stewardship, energy, technology and healthcare. This effort requires a conceptual and technological framework to identify and map all cell types, and to comprehensively annotate the localization and organization of molecules at cellular and tissue levels. This framework, called the Plant Cell Atlas (PCA), will be critical for understanding and engineering plant development, physiology and environmental responses. A workshop was convened to discuss the purpose and utility of such an initiative, resulting in a roadmap that acknowledges the current knowledge gaps and technical challenges, and underscores how the PCA initiative can help to overcome them.
Asunto(s)
Células Vegetales , Agricultura , Chlamydomonas reinhardtii , Cloroplastos , Biología Computacional , Procesamiento de Imagen Asistido por Computador , Células Vegetales/fisiología , Desarrollo de la Planta , Plantas/clasificación , Plantas/genética , Zea maysRESUMEN
Plant organs and tissues contain multiple cell types, which are well organized in 3-dimensional structure to efficiently perform physiological functions such as homeostasis and response to environmental perturbation and pathogen infection. It is critically important to perform molecular measurements at the cell-type-specific level to discover mechanisms and unique features of cell populations that govern differentiation and respond to external perturbations. Although mass spectrometry-based proteomics has been demonstrated as an enabling discovery tool for studying plant physiology, conventional approaches require millions of cells to generate robust biological conclusions. Such requirements mask the cell-to-cell heterogeneities and limit the comprehensive profiling of plant proteins at spatially resolved and cell-type-specific resolutions. This article describes a recently developed proteomics workflow for studying a small number of plant cells by integrating laser capture microdissection, microfluidic nanodroplet-based sample preparation, and ultrasensitive liquid chromatography-mass spectrometry. Using poplar as a model tree species, we provide detailed protocols, including plant leaf and root tissue harvest, sample preparation, cryosectioning, laser microdissection, protein digestion, mass spectrometry measurement, and data analysis. We show that the workflow enables the precise identification and quantification of thousands of proteins from hundreds of isolated plant root and leaf cells. © 2021 Wiley Periodicals LLC. Basic Protocol 1: Plant tissue fixation and embedding Support Protocol 1: Preparation of 2.5% CMC solution Support Protocol 2: Slow freezing of CMC blocks to avoid crack development in the block Basic Protocol 2: Preparation of cryosections Alternate Protocol: Using a vacuum manifold to dehydrate the cryosection slides (primarily for root tissues) Basic Protocol 3: Laser capture microdissection of specific types of plant cells Basic Protocol 4: Nanodroplet-based sample preparation for ultrasensitive proteomic analysis Support Protocol 3: Fabrication of nanowell chips Basic Protocol 5: Liquid chromatography and mass spectrometry.
Asunto(s)
Células Vegetales , Proteómica , Cromatografía Liquida , Captura por Microdisección con Láser , Fijación del TejidoRESUMEN
Histones belong to a family of highly conserved proteins in eukaryotes. They pack DNA into nucleosomes as functional units of chromatin. Post-translational modifications (PTMs) of histones, which are highly dynamic and can be added or removed by enzymes, play critical roles in regulating gene expression. In plants, epigenetic factors, including histone PTMs, are related to their adaptive responses to the environment. Understanding the molecular mechanisms of epigenetic control can bring unprecedented opportunities for innovative bioengineering solutions. Herein, we describe a protocol to isolate the nuclei and purify histones from sorghum leaf tissue. The extracted histones can be analyzed in their intact forms by top-down mass spectrometry (MS) coupled with online reversed-phase (RP) liquid chromatography (LC). Combinations and stoichiometry of multiple PTMs on the same histone proteoform can be readily identified. In addition, histone tail clipping can be detected using the top-down LC-MS workflow, thus, yielding the global PTM profile of core histones (H4, H2A, H2B, H3). We have applied this protocol previously to profile histone PTMs from sorghum leaf tissue collected from a large-scale field study, aimed at identifying epigenetic markers of drought resistance. The protocol could potentially be adapted and optimized for chromatin immunoprecipitation-sequencing (ChIP-seq), or for studying histone PTMs in similar plants.
Asunto(s)
Biomarcadores/metabolismo , Epigénesis Genética , Histonas/aislamiento & purificación , Espectrometría de Masas , Hojas de la Planta/metabolismo , Proteínas de Plantas/aislamiento & purificación , Sorghum/genética , Sorghum/metabolismo , Secuencia de Aminoácidos , Tampones (Química) , Núcleo Celular/metabolismo , Cromatografía Liquida , Histonas/química , Histonas/metabolismo , Proteínas de Plantas/química , Proteínas de Plantas/metabolismo , Procesamiento Proteico-PostraduccionalRESUMEN
Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic-related and salt stress-inducible synthetic promoters for use in hybrid poplar. De novo motif-detecting algorithms yielded 30 water-deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water-deficit stress motifs (SD18, SD13 and SD9) found in 16 co-expressed gene promoters, and we discovered a well-conserved motif for salt response (SS16). We characterized several native poplar stress-inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five-to-eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18-1, SD9-2, SS16-1, SS16-2 and SS16-3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18-1 and SD9-2 were induced by water-deficit stress, whereas SS16-1, SS16-2 and SS16-3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.
Asunto(s)
Regulación de la Expresión Génica de las Plantas , Proteínas de Plantas , Regulación de la Expresión Génica de las Plantas/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Plantas Modificadas Genéticamente/genética , Plantas Modificadas Genéticamente/metabolismo , Regiones Promotoras Genéticas/genética , Estrés Fisiológico/genéticaRESUMEN
Phosphorus is one of the essential nutrients for plant growth, but it may be relatively unavailable to plants because of its chemistry. In soil, the majority of phosphorus is present in the form of a phosphate, usually as metal complexes making it bound to minerals or organic matter. Therefore, inorganic phosphate solubilization is an important process of plant growth promotion by plant associated bacteria and fungi. Non-nodulating plant species have been shown to thrive in low-nutrient environments, in some instances by relying on plant associated microorganisms called endophytes. These microorganisms live within the plant and help supply nutrients for the plant. Despite their potential enormous environmental importance, there are a limited number of studies looking at the direct molecular impact of phosphate solubilizing endophytic bacteria on the host plant. In this work, we studied the impact of two endophyte strains of wild poplar (Populus trichocarpa) that solubilize phosphate. Using a combination of x-ray imaging, spectroscopy methods, and proteomics, we report direct evidence of endophyte-promoted phosphorus uptake in poplar. We found that the solubilized phosphate may react and become insoluble once inside plant tissue, suggesting that endophytes may aid in the re-release of phosphate. Using synchrotron x-ray fluorescence spectromicroscopy, we visualized the nutrient phosphorus inside poplar roots inoculated by the selected endophytes and found the phosphorus in both forms of organic and inorganic phosphates inside the root. Tomography-based root imaging revealed a markedly different root biomass and root architecture for poplar samples inoculated with the phosphate solubilizing bacteria strains. Proteomics characterization on poplar roots coupled with protein network analysis revealed novel proteins and metabolic pathways with possible involvement in endophyte enriched phosphorus uptake. These findings suggest an important role of endophytes for phosphorus acquisition and provide a deeper understanding of the critical symbiotic associations between poplar and the endophytic bacteria.
RESUMEN
Root systems are dynamic and adaptable organs that play critical roles in plant development. However, how roots grow and accumulate biomass during plant life cycle and in relation to shoot growth phenology remains understudied. A comprehensive time-dependent root morphological analysis integrated with molecular signatures is then required to advance our understanding of root growth and development. Here we studied Brachypodium distachyon rooting process by monitoring root morphology, biomass production, and C/N ratios during developmental stages. To provide insight into gene regulation that accompanies root growth, we generated comprehensive transcript profiles of Brachypodium whole-root system at four developmental stages. Our data analysis revealed that multiple biological processes including trehalose metabolism and various families of transcription factors (TFs) were differentially expressed in root system during plant development. In particular, the AUX/IAA, ERFs, WRKY, NAC, and MADS TF family members were upregulated as plant entered the booting/heading stage, while ARFs and GRFs were downregulated suggesting these TF families as important factors involved in specific phases of rooting, and possibly in regulation of transition to plant reproductive stages. We identified several Brachypodium candidate root biomass-promoting genes and cis-regulatory elements for further functional validations and root growth improvements in grasses.
Asunto(s)
Brachypodium/metabolismo , Regulación de la Expresión Génica de las Plantas/fisiología , Proteínas de Plantas/biosíntesis , Raíces de Plantas/metabolismo , Secuencias Reguladoras de Ácidos Nucleicos/fisiología , Brachypodium/genética , Proteínas de Plantas/genética , Raíces de Plantas/genéticaRESUMEN
The spatial configuration and morphology of roots are commonly monitored for a better understanding of plant health and development. However, this approach provides minimal details about the biochemistry regulating the observable traits. Therefore, the ability to metabolically map the entire root structure would be of major value. Here, we developed a sample preparation approach that enables imaging of the entire root within a restricted space (width of microscope slide), which was influenced by the Swiss-rolling technique. We were able to image and confidently identify molecules along the entire root structure from rolled-root tissue sections using multiple spatially resolved mass spectrometry approaches.
Asunto(s)
Metaboloma , Metabolómica/métodos , Raíces de Plantas/metabolismo , Espectrometría de Masa por Láser de Matriz Asistida de Ionización Desorción/métodos , Brachypodium/metabolismoRESUMEN
Sorghum [Sorghum bicolor (L.) Moench] is an important cereal crop noted for its ability to survive water-limiting conditions. Herein, we present an analytical workflow to explore the changes in histone modifications through plant developmental stages and two drought stresses in two sorghum genotypes that differ in their response to drought. Top-down mass spectrometry (MS) is an ideal method to profile histone modifications and distinguish closely related histone proteoforms. We analyzed leaves of 48 plants and identified 26 unique histone proteins and 677 unique histone proteoforms (124 full-length and 553 truncated proteoforms). We detected trimethylation on nearly all H2B N-termini where acetylation is commonly expected. In addition, an unexpected modification on H2A histones was assigned to N-pyruvic acid 2-iminylation based on its unique neutral loss of CO2. Interestingly, some of the truncated histones, in particular H4 and H3.2, showed significant changes that correlated with the growth and water conditions. The histone proteoforms could serve as targets in search of chromatin modifiers and ultimately have important ramifications in future attempts of studying plant epigenetic reprogramming under stress.