Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis / 中华医学杂志(英文版)

BACKGROUND@#Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.@*METHODS@#The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.@*RESULTS@#The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed.@*CONCLUSIONS@#The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Hepatitis B virus surface gene pre-S2 mutant as a high-risk serum marker for hepatoma recurrence after curative hepatic resection.

Chronic hepatitis B virus (HBV) infection is the major cause of hepatocellular carcinoma (HCC). The pre-S2 mutant large HBV surface antigen (LHBS) is highly associated with HCC. This study analyzed the expression of the large form of surface protein in tumors and evaluated the LHBS with mutations within the pre-S2 region as a high-risk recurrence marker in HCC patients after curative hepatic resection. By analyses using immunohistochemical staining (n = 12) and western blotting (n = 22), the HBV surface protein, which is mainly comprised of the major form of HBV surface antigen, was greatly diminished in the tumors. However, LHBS was not significantly decreased in tumorous regions, suggesting that LHBS maintains its expression in cancer development. A cohort of 175 patients with HBV-related HCC who underwent curative hepatic resection was analyzed for pre-S gene mutations using Pre-S Gene Chip. Results of the multivariate regression analysis showed that the serum pre-S2 mutant level and the American Joint Committee on Cancer stage were the two main independent high-risk factors for recurrence. A Cox proportional hazards analysis also revealed a prediction model, which indicated the recurrence-free survival rate along with the time after surgery; this was developed and further validated in an independent HCC cohort. Receiver operating characteristic curve analysis revealed that the model showed close sensitivities in the main and validation cohorts (area under the curve values, 0.741 and 0.704, respectively). Conclusion: Unlike the major HBV surface antigen, LHBS is mostly expressed in the tumorous regions of HBV-induced HCC, indicating that it plays a unique role in tumor progression; the relative level of pre-S2 mutant in serum is, independently of tumor stage, an important high-risk marker for HCC recurrence after primary hepatic resection. (Hepatology 2018).

Zinc-dependent interaction between JAB1 and pre-S2 mutant large surface antigen of hepatitis B virus and its implications for viral hepatocarcinogenesis.

Chronic hepatitis B virus (HBV) infection is a major cause of hepatocellular carcinoma (HCC) worldwide. The pre-S2 mutant large HBV surface protein (Δ2 LHBS), which contains an in-frame deletion of approximately 17 amino acids in LHBS, is highly associated with risks and prognoses of HBV-induced HCC. It was previously reported that Δ2 LHBS interacts with the Jun activation domain-binding protein 1 (JAB1), a zinc metalloprotease. This promotes the degradation of the cell cycle regulator p27(Kip1) and is believed to be the major mechanism for Δ2 LHBS-induced HCC. In this study, it was found that the interaction between JAB1 and Δ2 LHBS is facilitated by divalent metal Zn(2+) ions. The binding of JAB1 to Δ2 LHBS requires the JAB1/CSN5 MPN metalloenzyme (JAMM) motif and residue H138 that binds to Zn(2+) ions in JAB1. Isothermal titration calorimetry showed that Δ2 LHBS binds directly to Zn(2+) ions in a two-site binding mode. Residues H71 and H116 in Δ2 LHBS, which also contact Zn(2+) ions, are also indispensable for Δ2 LHBS-mediated p27(Kip1) degradation in human HuH7 cells. These results suggest that developing drugs that interrupt interactions between Δ2 LHBS and JAB1 can be used to mitigate Δ2 LHBS-associated risks for HCC.

Histone deacetylase inhibitor suberoylanilide hydroxamic acid suppresses the pro-oncogenic effects induced by hepatitis B virus pre-S2 mutant oncoprotein and represents a potential chemopreventive agent in high-risk chronic HBV patients.

Chronic hepatitis B virus (HBV) infection is the major cause of hepatocellular carcinoma (HCC). The pre-S(2) mutant large HBV surface antigen (LHBS) in type II ground glass hepatocytes (GGHs) has been recognized as an emerging viral oncoprotein; it directly interacts with the c-Jun activation domain-binding protein 1 (JAB1) and subsequently causes hyperphosphorylation of the tumor-suppressor retinoblastoma and, consequently, leads to disturbed cell cycle progression. The interaction of the pre-S(2) mutant LHBS with JAB1 could provide a potential target for chemoprevention. In this study, we found that the preneoplastic type II GGHs showed a significant decrease of the cyclin-dependent kinase inhibitor p27(Kip1), which serves as a marker for pre-S(2) mutant-JAB1 complex formation. The histone deacetylase (HDAC) inhibitor suberoylanilide hydroxamic acid (SAHA) elevated expression of the tumor-suppressor thioredoxin-binding protein 2 (TBP2), which subsequently enhanced the JAB1-TBP2 interaction and abolished the pre-S(2) mutant LHBS-induced degradation of p27(Kip1), which, in turn, recovered the normal cell cycle checkpoint. The pre-S(2) mutant LHBS-induced pro-oncogenic effects: increased cell proliferation, nuclear/cytoplasmic ratio and proliferating cell nuclear antigen expression, were all greatly ameliorated after SAHA treatments, which suggested SAHA as a promising chemopreventive agent for the pre-S(2) mutant oncoprotein-induced HCC. In conclusion, this study provides the mechanism of histone deacetylase (HDAC) inhibitor in preventing the pre-S(2) mutant-induced oncogenic phenotype. The HDAC inhibitor SAHA is therefore a potential chemopreventive agent for high-risk chronic HBV patients who may develop HCC.

Deficient mRNA expression of specific protein 3 gene in peripheral blood mononuclear cells from patients with multiple sclerosis / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To characterize the deficiency of the mRNA expression of specific protein (SP3) gene in peripheral blood mononuclear cells (PBMCs) from Chinese patients with multiple sclerosis (MS) and study its correlation with the disease phenotypes.</p><p><b>METHODS</b>Fifty-six patients with definite MS were collected and total RNA was extracted from their PBMCs. Specific primers corresponding to SP3 gene were designed and the mRNA expression of SP3 gene was detected by reverse transcriptase-PCR (RT-PCR) method. The deficiency of SP3 expression was compared among MS patients, irrelevant disease group and normal controls.</p><p><b>RESULTS</b>Of the 56 MS cases, 23 (41.1%) were SP3-deficient. In contrast, the frequency of SP3-deficiency in normal subjects and irrelevant disease controls was 8.6% (5/35) and 14.3% (4/27), respectively. The frequency of the SP3-expression deficiency in MS patients was significantly higher than that in both control groups (P< 0.01). Within the MS cases, the scores of expanded disability status scale (EDSS) in the SP3-expressing subjects were significantly different from that in the SP3-deficient ones in the stable, but not in the active, phase of MS (P< 0.05).</p><p><b>CONCLUSION</b>Author's observation suggested that deficient expression of SP3 gene occurs in Chinese MS patients, and that the SP3 expression may correlate with the clinical manifestations of MS and play roles in its immunological pathogenesis.</p>