Characterization of a New, Country Bean (Lablab purpureus) Lineage of Bean Common Mosaic Necrosis Virus.

Country bean (Lablab purpureus, family Fabaceae) is grown in subsistence agriculture in Bangladesh as a multipurpose crop for food, animal feed, and green manure. This study was undertaken to investigate the genetic diversity of bean common mosaic necrosis virus (BCMNV, genus Potyvirus, family Potyviridae) in country beans. Leaf samples from country beans showing yellowing, vein banding, and mosaic symptoms were collected during field surveys between 2015 and 2019 cropping seasons from farmers' fields in different geographic regions. These samples were tested by serological and molecular diagnostic assays for the presence of BCMNV. Virus-positive samples were subjected to high-throughput Illumina sequencing to generate near-complete genomes of BCMNV isolates. In pairwise comparisons, the polyprotein sequences of BCMNV isolates from Bangladesh showed greater than 98% identities among themselves and shared less than 84% sequence identity at the nucleotide level with virus isolates reported from other countries. In the phylogenetic analysis, BCMNV isolates from Bangladeshi country beans formed a separate clade from virus isolates reported from common beans in other countries in the Americas, Africa, Europe, and from East Timor. Grow-out studies showed seed-to-seedling transmission of BCMNV, implying a possible seedborne nature of the virus in country beans.

First report of grapevine rupestris vein feathering virus in grapevines from Washington State.

Since the first report of grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) in a Greek grapevine causing chlorotic discoloration of leaf veins (El Beaino et al., 2001), GRVFV was reported in some European countries, and in Australia, China, Korea, New Zealand, Uruguay, and Canada (Blouin et al., 2017; Cho et al., 2018; Reynard et al., 2017). In the USA, the virus was reported only from California in vines showing Syrah decline symptoms (Al Rwahnih et al., 2009). During virus surveys conducted between 2015 and 2019, 424 samples (petioles from individual or composite of five vines, with 4 petioles/vine) with and without discernible symptoms were collected randomly from 39 Vitis vinifera cultivars in vineyards and nurseries in eastern Washington State. Total RNA was isolated from these samples separately using SpectrumTM Plant Total RNA Kit (Sigma-Aldrich) and subjected individually to Illumina RNAseq (Huntsman Cancer Institute, Salt Lake City, UT). An average of ~28 million 120-base pair (bp) paired-end reads using HiSeq2500 platform and an average of ~18 million 145-bp paired-end reads using Novaseq 6000 platform were obtained per sample. The contigs from de novo assembly of quality-filtered reads from each sample (CLC Genomics workbench 12) were subjected to BLASTn analysis against the virus database from GenBank. In addition to grapevine viruses and viroids previously reported in Washington State, GRVFV-specific sequences were obtained in samples from 11 of the 39 cultivars; namely, Muscat Ottonel, Pinot gris and Sangiovese from vineyards and Aglianico, Bonarda, Cabernet Sauvignon, Chardonnay, Garnacha Tinta, Riesling, Tempranillo and Valdiguie from nurseries. BLASTn analysis of the 73 GRVFV-specific contigs, ranging in size between 500 nt and 6474 nt, showed sequence identity between 79.4% and 95.5% with GRVFV sequences deposited in GenBank. The data also revealed that GRVFV was always present as coinfection with one or more viruses and viroids (grapevine leafroll-associated virus 3, grapevine red blotch virus, grapevine virus A and B, grapevine rupestris stem pitting-associated virus, hop stunt viroid and grapevine yellow speckle viroid 1) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5'- TACAAGGTGAATTGCTCCACAC -3') and SaR-1027 (5'-TCATTGGCGATGCGTTCG-3') to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT782070) showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084811.1) to 90.9% (738 bp out of 813 bp) with an isolate from New Zealand (MF000326.1). Additional studies are in progress to examine the etiology, genetic diversity and impact of GRVFV in Washington vineyards.

First Report of grapevine red globe virus in grapevines in Washington State.

Grapevine red globe virus (GRGV; genus Maculavirus, family Tymoviridae) has been reported in grapevines (Vitis spp.) from Italy, Greece, France, China, Spain and Germany and in California, U.S.A. (Sabanadzovic et al. 2000; Cretazzo et al. 2017; Fan et al. 2016; Ruiz-Garcia et al., 2018). During surveys of grapevine nurseries, a total of 241 composite samples, each consisting of four petioles from mature leaves/vine from five asymptomatic grapevines, from 33 grapevine (Vitis vinifera) cultivars were collected. Total RNA isolated from these samples using Spectrum Total RNA isolation kit (Sigma-Aldrich, St. Louis, MO) was subjected to high-throughput sequencing (HTS) on an Illumina HiSeq2500 or Novaseq 6000 platforms in paired-end mode (Genomics Core Facility, Huntsman Cancer Institute, Utah University, Salt Lake City, UT). After trimming raw reads based on quality and ambiguity, the paired-end quality reads of approximately 120 (HiSeq) or 145 (Novaseq) base pair (bp) length were assembled de novo into a pool of contigs (CLC Genomics workbench 12). These contigs were subjected to BLASTn analysis against the nonredundant virus database from GenBank (http://www.ncbi.nlm.nih.gov/blast). A total of 49 contig sequences, ranging from 200 to 1645 bp in length with an average coverage ranging up to 418.7, aligning with GRGV genome were detected in cvs. Aglianico, Cabernet franc, Pinot gris and Riesling. BLASTn analysis of contigs greater than 500 bp length showed sequence identity between 88.5% and 95% with corresponding GRGV sequences reported from other countries. These results indicated the presence of genetically distinct isolates of GRGV. HTS data also revealed coinfection of GRGV in all samples with one or more of the following virus and/or viroids: grapevine rupestris stem pitting associated virus, grapevine rupestris vein feathering virus, hop stunt viroid or grapevine yellow speckle viroid-1. To further confirm infection by GRGV, total RNA was extracted from two asymptomatic Pinot gris vines previously tested positive in HTS using Spectrum Total RNA isolation kit and subjected to reverse transcription-PCR using primers specific to the replicase polyprotein gene of the virus (RG4847F: 5'-TGGTCTGTTGTTCGCATCTT-3' and RG6076R: 5' CGGAAGGGGAAGCATTGATCT-3', Cretazzo et al., 2017). Sequence analysis of the approximately1,250 bp amplicons (accession number MT749359) showed 91.2 % nt sequence identity with corresponding sequence of GRGV isolate from Brazil (KX828704.1). To our knowledge, this is the first report of GRGV in Washington State. Together with the report of the occurrence of GRGV in California (Sabanadzovic et al. 2000), these/span> results indicate wide geographical distribution of the virus. Although GRGV can cause asymptomatic infections in grapevines (Martelli et al. 2002), the economic importance of GRGV as single or coinfections with other viruses needs to be examined to assess the potential significance of the virus to grape production and grapevine certification programs.

Mapping and identification of cassava mosaic geminivirus DNA-A and DNA-B genome sequences for efficient siRNA expression and RNAi based virus resistance by transient agro-infiltration studies.

Geminiviruses are among the most serious pathogens of many economically important crop plants and RNA interference (RNAi) is an important strategy for their control. Although any fragment of a viral genome can be used to generate a double stranded (ds) RNA trigger, the precursor for generation of siRNAs, the exact sequence and size requirements for efficient gene silencing and virus resistance have so far not been investigated. Previous efforts to control geminiviruses by gene silencing mostly targeted AC1, the gene encoding replication-associated protein. In this study we made RNAi constructs for all the genes of both the genomic components (DNA-A and DNA-B) of African cassava mosaic virus (ACMV-CM), one of the most devastating geminiviruses causing cassava mosaic disease (CMD) in Africa. Using transient agro-infiltration studies, RNAi constructs were evaluated for their ability to trigger gene silencing against the invading virus and protection against it. The results show that the selection of the DNA target sequence is an important determinant for the amount of siRNA produced and the extent of resistance. The ACMV genes AC1, AC2, AC4 from DNA-A and BC1 from DNA-B were effective targets for RNAi-mediated resistance and their siRNA expression was higher compared to other RNAi constructs. The RNAi construct targeting AC2, the suppressor of gene silencing of ACMV-CM gave highest level of resistance in the transient studies. This is the first report of targeting DNA-B to confer resistance to a bipartite geminivirus infection.

First Report of Cucumber mosaic virus from Eggplant (Solanum melongena) in Bangladesh.

In Bangladesh, eggplant (Solanum melongena L.) is largely cultivated by subsistence farmers for domestic consumption and generating family income. During a survey of family-owned farms in April of 2014 in Barisal region of Bangladesh, we observed a farmer's field (0.25 acres) of 3-month-old eggplants with nearly 90% of plants showing mild mosaic and mottling of leaves. Symptomatic plants showed reduced growth, with nearly 50% fewer fruits than from healthy plants. Symptomatic leaves tested positive for Cucumber mosaic virus (CMV; genus Cucumovirus, family: Bromoviridae) by immunostrip diagnostic kit (Agdia, Elkhart, IN). For confirmation of the virus identity, leaf samples were pressed on FTA Plant Cards (Whatman International, Maidstone, UK) and air-dried at room temperature. For eluting total nucleic acids, four to eight disks were punched from the spotted circles of each FTA card using a Harris micropunch (2-mm diameter, Sigma-Aldrich, USA) and soaked for 1 h in 300 µl of extraction buffer (15 mM Na2CO3, 35 mM NaHCO3, 2% [w/v] PVP40, 0.2% [w/v] BSA, 0.05% [v/v] Tween 20, pH 9.6). After vortexing followed by a brief centrifugation, 10 µl of the supernatant was mixed with denaturing buffer (0.1M glycine-NaOH, pH 9.0, 50 mM NaCl, 1 mM EDTA, pH 8.0, 0.5% [v/v] Triton X-100) containing 1% ß-mercaptoethanol, incubated at 95°C for 10 min, and kept in ice until use. Denatured sample (2 µl) was subsequently used in reverse-transcription (RT)-PCR using primers CMV-RNA3F (5'-GTAGACATCTGTGACGCGA-3') and CMV-RNA3R (5'-GCGCGAAACAAGCTTCTTATC-3') previously reported (2) to amplify a 529-nucleotide (nt) fragment representing the 210-nt intergenic region and the 319-nt partial coat protein (CP) gene of the RNA 3 segment. The amplicons were cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA), and DNA isolated from four independent clones per amplicon was sequenced in both orientations. The derived sequences (GenBank Accession Nos. KM516898 to KM516901) showed close to 100% identity among themselves and 97% identity with the corresponding sequence of CMV isolate BK16 from cucumber in Thailand (FN552546). These results supported immunostrip diagnostic assays in confirming the presence of CMV in symptomatic samples of eggplants from Barisal. For additional confirmation, a second primer pair (CMV-CP-F: 5'-ATGGACAAATCTGAATCAACCAG-3' and CMV-CP-R: 5'-TCAAACTGGGAGCACCCCAGAC-3') was designed using CMV sequences from JN054635 and GU906293 to amplify the full-length CP gene from the same nucleic acid preparations used above. The approximately 657-nt amplicons, representing the full-length CP gene, were cloned, and plasmid DNA from four independent colonies per amplicon wa s sequenced as described above. The derived CP sequences (KM516902 to KM516905) shared 96 and 95% nucleotide and 98.6 and 99.5% amino acid sequence identities with corresponding sequences of CMV isolates from banana (EF178298) and eggplant (GU906293), respectively, from India. Phylogenetic analysis of CP sequences derived from this study with corresponding sequences available in GenBank indicated that CMV from eggplant in Bangladesh aligned closely with CMV subgroup 1B. CMV was previously reported in chili pepper, and tomato from Bangladesh (1) and in eggplant from Israel (4) and India (3). To our knowledge this is the first confirmed report of the occurrence of CMV subgroup 1B in eggplant in Bangladesh. Since no aphids were observed on eggplants, it is likely that CMV was introduced into the farmer's field through seedlings raised from seed carrying the virus. References: (1) A. M. Akanda et al. J. Fac. Agric., Kyushu Univ. 35:151, 1991. (2) C. De Blas et al. J. Phytopathol. 141:323, 1994. (3) S. Kumar et al. Virus Dis. 25:129, 2014. (4) E. Tanne and S. Zimmerman-Gries. Plant Dis. 64:371, 1980.

RNAi-mediated resistance to Cassava brown streak Uganda virus in transgenic cassava.

Cassava brown streak disease (CBSD), caused by Cassava brown streak Uganda virus (CBSUV) and Cassava brown streak virus (CBSV), is of new epidemic importance to cassava (Manihot esculenta Crantz) production in East Africa, and an emerging threat to the crop in Central and West Africa. This study demonstrates that at least one of these two ipomoviruses, CBSUV, can be efficiently controlled using RNA interference (RNAi) technology in cassava. An RNAi construct targeting the near full-length coat protein (FL-CP) of CBSUV was expressed constitutively as a hairpin construct in cassava. Transgenic cassava lines expressing small interfering RNAs (siRNAs) against this sequence showed 100% resistance to CBSUV across replicated graft inoculation experiments. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis showed the presence of CBSUV in leaves and some tuberous roots from challenged controls, but not in the same tissues from transgenic plants. This is the first demonstration of RNAi-mediated resistance to the ipomovirus CBSUV in cassava.

RNAi-mediated resistance to diverse isolates belonging to two virus species involved in Cassava brown streak disease.

Cassava brown streak disease (CBSD) is emerging as one of the most important viral diseases of cassava (Manihot esculenta) and is considered today as the biggest threat to cassava cultivation in East Africa. The disease is caused by isolates of at least two phylogenetically distinct species of single-stranded RNA viruses belonging to the family Potyviridae, genus Ipomovirus. The two species are present predominantly in the coastal lowland [Cassava brown streak virus (CBSV); Tanzania and Mozambique] and highland [Cassava brown streak Uganda virus (CBSUV); Lake Victoria Basin, Uganda, Kenya and Malawi] in East Africa. In this study, we demonstrate that CBSD can be efficiently controlled using RNA interference (RNAi). Three RNAi constructs targeting the highland species were generated, consisting of the full-length (FL; 894 nucleotides), 397-nucleotide N-terminal and 491-nucleotide C-terminal portions of the coat protein (CP) gene of a Ugandan isolate of CBSUV (CBSUV-[UG:Nam:04]), and expressed constitutively in Nicotiana benthamiana. After challenge with CBSUV-[UG:Nam:04], plants homozygous for FL-CP showed the highest resistance, followed by the N-terminal and C-terminal lines with similar resistance. In the case of FL, approximately 85% of the transgenic plant lines produced were completely resistant. Some transgenic lines were also challenged with six distinct isolates representing both species: CBSV and CBSUV. In addition to nearly complete resistance to the homologous virus, two FL plant lines showed 100% resistance and two C-terminal lines expressed 50-100% resistance, whereas the N-terminal lines succumbed to the nonhomologous CBSV isolates. Northern blotting revealed a positive correlation between the level of transgene-specific small interfering RNAs detected in transgenic plants and the level of virus resistance. This is the first demonstration of RNAi-mediated resistance to CBSD and protection across very distant isolates (more than 25% in nucleotide sequence) belonging to two different species: Cassava brown streak virus and Cassava brown streak Uganda virus.

Distinct evolutionary histories of the DNA-A and DNA-B components of bipartite begomoviruses.

BACKGROUND: Viruses of the genus Begomovirus (family Geminiviridae) have genomes consisting of either one or two genomic components. The component of bipartite begomoviruses known as DNA-A is homologous to the genomes of all geminiviruses and encodes proteins required for replication, control of gene expression, overcoming host defenses, encapsidation and insect transmission. The second component, referred to as DNA-B, encodes two proteins with functions in intra- and intercellular movement in host plants. The origin of the DNA-B component remains unclear. The study described here was initiated to investigate the relationship between the DNA-A and DNA-B components of bipartite begomoviruses with a view to unraveling their evolutionary histories and providing information on the possible origin of the DNA-B component. RESULTS: Comparative phylogenetic and exhaustive pairwise sequence comparison of all DNA-A and DNA-B components of begomoviruses demonstrates that the two molecules have very distinct molecular evolutionary histories and likely are under very different evolutionary pressures. The analysis highlights that component exchange has played a far greater role in diversification of begomoviruses than previously suspected, although there are distinct differences in the apparent ability of different groups of viruses to utilize this "sexual" mechanism of genetic exchange. Additionally we explore the hypothesis that DNA-B originated as a satellite that was captured by the monopartite progenitor of all extant bipartite begomoviruses and subsequently evolved to become the integral (essential) genome component that we recognize today. The situation with present-day satellites associated with begomoviruses provides some clues to the processes and selection pressures that may have led to the "domestication" of a wild progenitor of the DNA-B component. CONCLUSIONS: The analysis has highlighted the greater genetic variation of DNA-B components, in comparison to the DNA-A components, and that component exchange is more widespread than previously demonstrated and confined to viruses from the Old World. Although the vast majority of New World and some Old World begomoviruses show near perfect co-evolution of the DNA-A and DNA-B components, this is not the case for the majority of Old World viruses. Genetic differences between Old and New World begomoviruses and the cultivation of exotic crops in the Old World are likely factors that have led to this dichotomy.

Interaction between coat protein and replication initiation protein of Mung bean yellow mosaic India virus might lead to control of viral DNA replication.

In addition to their encapsidation function, viral coat proteins (CP) contribute to viral life cycle in many different ways. The CPs of the geminiviruses are responsible for intra- as well as inter-plant virus transmission and might determine the yield of viral DNA inside the infected tissues by either packaging the viral DNA or interfering with the viral replicative machinery. Since the cognate Rep largely controls the rolling circle replication of geminiviral DNA, the interaction between Rep and CP might be worthwhile to examine for elucidation of CP-mediated control of the viral DNA copy number. Here a reasonably strong interaction between Rep and CP of the geminivirus Mung bean yellow mosaic India virus is reported. The domain of interaction has been mapped to a central region of Rep. The replication initiation activity of Rep, i.e., its nicking and closing function, is down regulated by CP. This report highlights how CP could be important in controlling geminiviral DNA replication.

PCNA interacts with Indian mung bean yellow mosaic virus rep and downregulates Rep activity.

Proliferative cell nuclear antigen (PCNA), a conserved plant protein as well as an important replication factor, is induced in response to geminivirus infection in the resting cells of the phloem tissues. The biochemical role of PCNA in rolling circle replication (RCR) of geminivirus DNA has not been explored in detail. The initiation of RCR of the bipartite genome of a geminivirus, Indian mung bean yellow mosaic virus (IMYMV), is mainly controlled by viral protein Rep (or AL1 or AC1). The role of host PCNA in RCR of IMYMV was revealed by studying the physical and functional interactions between recombinant PCNA and recombinant IMYMV Rep. Pea nuclear PCNA as well as recombinant pea PCNA showed binding to recombinant Rep in experiments involving both affinity chromatography and yeast two-hybrid approaches. The contacting amino acid residues of PCNA seemed to be present throughout a wide region of the trimeric protein, while those of Rep appeared to be localized only in the middle part of the protein. The site-specific nicking-closing activity and the ATPase function of IMYMV Rep were impaired by PCNA. These observations lead to interesting speculations about the control of viral RCR and dynamic profiles of protein-protein interactions at the RCR origin of the geminiviruses.