Uncovering the history of recombination and population structure in western Canadian stripe rust populations through mating type alleles.

BACKGROUND: The population structure of crop pathogens such as Puccinia striiformis f. sp. tritici (Pst), the cause of wheat stripe rust, is of interest to researchers looking to understand these pathogens on a molecular level as well as those with an applied focus such as disease epidemiology. Cereal rusts can reproduce sexually or asexually, and the emergence of novel lineages has the potential to cause serious epidemics such as the one caused by the 'Warrior' lineage in Europe. In a global context, Pst lineages in Canada were not well-characterized and the origin of foreign incursions was not known. Additionally, while some Pst mating type genes have been identified in published genomes, there has been no rigorous assessment of mating type diversity and distribution across the species. RESULTS: We used a whole-genome/transcriptome sequencing approach for the Canadian Pst population to identify lineages in their global context and evidence tracing foreign incursions. More importantly: for the first time ever, we identified nine alleles of the homeodomain mating type locus in the worldwide Pst population and show that previously identified lineages exhibit a single pair of these alleles. Consistently with the literature, we find only two pheromone receptor mating type alleles. We show that the recent population shift from the 'PstS1' lineage to the 'PstS1-related' lineage is also associated with the introduction of a novel mating type allele (Pst-b3-HD) to the Canadian population. We also show evidence for high levels of mating type diversity in samples associated with the Himalayan center of diversity for Pst, including a single Canadian race previously identified as 'PstPr' (probable recombinant) which we identify as a foreign incursion, most closely related to isolates sampled from China circa 2015. CONCLUSIONS: These data describe a recent shift in the population of Canadian Pst field isolates and characterize homeodomain-locus mating type alleles in the global Pst population which can now be utilized in testing several research questions and hypotheses around sexuality and hybridization in rust fungi.

First Report of Bacterial Leaf Streak of Barley (Hordeum vulgare) Caused by Xanthomonas translucens pv. translucens in British Columbia, Canada.

Bacterial leaf streak (BLS) of barley is caused by the Gram-negative bacterial pathogen Xanthomonas translucens (Sapkota et al. 2020). In 2021, we observed multiple hill plots with BLS symptomatic plants in a barley stripe rust nursery in Vancouver, BC, Canada. We collected 29 leaf samples showing typical BLS symptoms (e.g. necrotic lesions; Fig. S1) and stored at 4 oC until bacterial isolation. Samples were surface-sterilized in 10% NaOCl for 20 sec and rinsed twice. About 1 cm2 of leaf tissue containing BLS characteristic lesions was macerated in 200 µL sterile H2O on a petri dish, incubated for 15 min, and 10 µl of the homogenates was streaked onto Wilbrink's - Boric Acid - Cephalexin (WBC) agar medium. Plates were incubated at 28-30 oC for 48 hrs. Four single colonies were obtained: BC10-1-2a (USask BC10-2a), BC10-1-2b (USask BC10-2b), UBC026 and UBC028. Colonies were grown in WBC broth and gDNA was extracted using E.Z.N.A. Bacterial DNA Kit (Omega Bio-Tek) or DNeasy Plant Pro Kit® (Qiagen) following manufacturer protocols. Genus-level identification was achieved using 16S rRNA sequencing with 27F/1492R primers (Lane 1991) of UBC026 (1,399 bp; NCBI # OP327375) and UBC028 (1,415 bp; NCBI #OP327376). Complete 16S rRNA sequences (1,533bp) of BC10-2a and BC10-2b (1,533 bp) were extracted from the draft whole-genome sequences (WGS) generated in this study. The 16S rRNA sequence homology values of 99.0-100% were recorded between the 4 strains. BLAST analyses of the 16S rRNA sequences to GenBank entries exhibited 99.5-100% similarity values (100% coverage) with the pathotype strains of Xtt DSM 18974T (LT604072) and X. translucens pv. undulosa (Xtu) CFBP 2055 (CP074361). Whole genomes of BC10-2a (JANUQY01) and BC10-2b (JANUQZ01) were sequenced (150-bp; reads 33.1 million; mean coverage 2125x) using NovaSeq Illumina, assembled (Unicycler v0.4.8; Wick et al. 2017) and analyzed to identify the strains to the species-level (Tambong et al. 2021). WGS of strains USask BC10-2a and USask BC10-2b exhibited genome-based DNA-DNA hybridization (dDDH; Meier-Kolthoff et al. 2013) and BLAST-based average nucleotide identity (ANIb; Richter et al. 2015) of 100%. The two strains also showed dDDH and ANIb of 90.4% (species-leel cut-off of 70%) and 98.780% and 98.80% (cut-off of 96%), respectively, with Xtt DSM 18974T (LT604072). In contrast, the WGS of BC10-2a and BC10-2b exhibited only 78.2% dDDH homology values with Xtu CFBP 2055T, suggesting that the strains are genetically more similar to Xtt. The assignment of these strains to Xtt is corroborated by phylogenomic analysis (Fig. S2; Meier-Kolthoff and Göker 2019) that showed the two strains clustering together (100% bootstrap) with the type strain DSM 18974T. These data suggest that these strains are taxonomically members of Xtt. Identification was also confirmed to the genus-level by LAMP assay using published X. translucens primers (Langlois et al. 2017). Pathovar-level identification was confirmed using a cbsA and S8.pep multiplex PCR diagnostic assay (Roman-Reyna et al. 2022). Koch's postulates were verified by greenhouse inoculation via leaf infiltration of UBC026 and UBC028 on 21-day old barley plants (line HB522) using an inoculum of 108 CFU ml-1 followed by re-isolation of the bacteria on WBC. The inoculated plants showed typical BLS symptoms similar to those observed in the field (Fig. S1). Water-inoculated plants had no symptoms. To our knowledge, this is the first published report of BLS of barley in British Columbia.

First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

Detection and Identification of a 'Candidatus Liberibacter solanacearum' Species from Ash Tree Infesting Psyllids.

'Candidatus Liberibacter' species are associated with severe, economically important diseases. Nearly all known species are putatively insect transmitted, specifically by psyllids. Detection of 'Ca. Liberibacter' in plants is complicated by their uneven distribution in host plants and largely fastidius nature. The death of black (Fraxinus nigra) and mancana (Fraxinus mandshurica) ash trees in Saskatchewan, Canada has been associated with infestation by the cottony ash psyllid (Psyllopsis discrepans). A combination of conventional PCR amplification and Sanger sequencing of the 16S recombinant DNA was used to detect and identify 'Ca. Liberibacter' in psyllids collected from ash trees in Saskatchewan. BLAST analysis of two 16S sequences that were 1,058 and 1,085 bp long (NTHA 5, GenBank accession number MK942379 and NTHA 6, GenBank accession number MK937570, respectively) revealed they were 99 to 100% similar to a 'Ca. Liberibacter solanacearum' sequence (GenBank accession number KX197200) isolated from the Nearctic psyllid (Bactericera maculipennis) of U.S. provenance. Sequencing the psyllid genes CO1 and Cyt-b confirmed that the psyllids from which the bacterial DNA was isolated were P. discrepans, based on comparisons with sequences in GenBank and BOLD and a reference sample from the United Kingdom. These results provide the first evidence that 'Ca. Liberibacter solanacearum' species are associated with psyllids collected from ash trees and specifically P. discrepans. The recent episodes of dieback of ash in Saskatchewan associated with psyllid feeding are consistent with disease symptoms caused by 'Ca. Liberibacter' pathogens, and this possibility warrants further study.

High throughput nutritional profiling of pea seeds using Fourier transform mid-infrared spectroscopy.

Seed samples from 117 genetically diverse pea breeding lines were used to determine the robustness of Fourier transform mid-infrared spectroscopy (FT-MIR) for the rapid nutritional profiling of seeds. The FT-MIR results were compared to wet chemistry methods for assessing the concentrations of total protein, starch, fiber, phytic acid, and carotenoids in pea seed samples. Of the five partial least square regression models (PLSR) developed, protein, fiber and phytic acid concentrations predicted by the models exhibited correlation coefficients greater than 0.83 when compared with data obtained using the wet chemistry methods for both the calibration and validation sets. The starch PLSR model had a correlation greater than 0.75, and carotenoids had correlation of 0.71 for the validation sets. The methods implemented in this research show the novelty and usefulness of FT-MIR as a simple, fast, and cost-effective technique to determine multiple seed constituents simultaneously.