RESUMEN
Watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2, both belonging to the genus Coguvirus (family Phenuiviridae), have been identified in watermelon plants in Brazil. To study tissue tropism and the potential for seed transmission of these viruses, we initially planned to produce specific antibodies. However, difficulties in isolating and propagating the virus in host plants hindered the purified virus preparations. To overcome this problem, the nucleocapsid (N) proteins of WCLaV-1 and -2 were produced using the pepper ringspot virus vector. The N protein genes and the vector backbone were prepared by (RT-)PCR and ligated by Gibson assembly. The constructs were agro-infiltrated in Nicotiana benthamiana plants. The expressed N proteins were purified and used for polyclonal antibody production. The specificity of both antibodies was confirmed by antigen-coating ELISA, tissue-blot immunobinding assay and Western blot. By antigen-coating ELISA demonstrated that WCLaV-1 showed 93.1% of seed-transmission, while WCLaV-2 showed only 17.8%. The N protein of WCLaV-1 was detected in the cytoplasm of the seed tissues. It was also found in the nuclei of the radicle, as confirmed by confocal microscopy. We concluded that the antibodies exhibited both a high titer and sufficient specificity for use in ELISA-based diagnostics and for subcellular localization study.
Asunto(s)
Citrullus , Formación de Anticuerpos , Anticuerpos , Proteínas Recombinantes , SemillasRESUMEN
Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.
RESUMEN
The increasing prevalence of overweight and obesity among adults is a risk factor for many chronic diseases and death. In addition, obesity among children and adolescents has reached unprecedented levels and studies show that obese children and adolescents are more likely to become obese adults. Therefore, both the prevention and treatment of obesity in adolescents are critical. This study aimed to develop an artificial intelligence (AI) neural network (NNET) model that identifies the risk of obesity in Portuguese adolescents based on their body mass index (BMI) percentiles and levels of physical fitness. Using datasets from the FITescola® project, 654 adolescents aged between 10-19 years old, male: 334 (51%), female: n = 320 (49%), age 13.8 ± 2 years old, were selected to participate in a cross-sectional observational study. Physical fitness variables, age, and sex were used to identify the risk of obesity. The NNET had good accuracy (75%) and performance validation through the Receiver Operating Characteristic using the Area Under the Curve (ROC AUC = 64%) in identifying the risk of obesity in Portuguese adolescents based on the BMI percentiles. Correlations of moderate effect size were perceived for aerobic fitness (AF), upper limbs strength (ULS), and sprint time (ST), showing that some physical fitness variables contributed to the obesity risk of the adolescents. Our NNET presented a good accuracy (75%) and was validated with the K-Folds Cross-Validation (K-Folds CV) with good accuracy (71%) and ROC AUC (66%). According to the NNET, there was an increased risk of obesity linked to low physical fitness in Portuguese teenagers.
RESUMEN
The aim of this study was to compare the physical activity (PA) and sedentary behavior (SB) levels of young and middle-aged adults living in and around the municipality of Penafiel and to determine whether they meet PA recommendations. The researchers used the "International Physical Activity Questionnaire" (IPAQ) to measure moderate to vigorous PA and time spent on sedentary behavior (high vs. low). A prospective observational cross-sectional sample of 1105 adults aged 18-63 years, living in the municipality of Penafiel and its surroundings (45% women, 55% men), was used. The results indicated that more than half of the population was inactive (53.8%) and sedentary (54.0%). Men were more likely to be sedentary (59.2%) and inactive (55.6%) than women (inactive: 51.7%, high SB: 47.7%). Regarding daily PA and SB levels, women had higher levels of walks (3.8 ± 2.3; p = 0.034) and vigorous PA (2.2 ± 1.8 min; p = 0.005) per days/week, as well as vigorous PA per minutes/week (75.4 ± 82.1 min; p = 0.034). The time spent on vigorous PA per day was also higher in women (26.2 ± 22.8 min; p = 0.030). However, men had higher values in walking minutes per day (26.3 ± 17.1 min; p = 0.030), SB for weekdays (429.2 ± 141.2 min; p = 0.001), SB for weekends (324.7 ± 163.7 min; p = 0.033) and time spent on SB per minutes/week (2795.6 ± 882.0 min; p = 0.001). The results also showed that the older the adults, the lower the frequency and total time of vigorous PA per week. Young adults (18-28 years) had higher levels of vigorous PA (p = 0.005) than the other age groups (29-39; 40-50 and 51-63 years). Finally, the study found no significant correlation between individual level factors, such as number of children, marital status and monthly income, and PA or SB. Conversely, a significant and negative correlation between SB and levels of PA was found, indicating that the higher the level of PA practice, the lower the SB level. The authors suggest that promoting new PA habits and healthy lifestyles is an important future challenge for sustainability and improving the quality of life in public health.
RESUMEN
Obesity and decreasing fitness levels among the youth are growing concerns in Portugal, similar to other developed countries, with implications for health and psychomotor development. Understanding the influence of health determinants such as sex and age are crucial for developing effective public health strategies. This study aimed to analyze the association between sex and chronological age with obesity status and physical fitness in Portuguese adolescents. A total of 170 adolescents (85 males and 85 females) were evaluated for body mass index, abdominal adiposity, aerobic fitness, abdominal resistance, upper limb resistance, lower limb power, and maximal running speed in a 40 m sprint using the FITescola® physical fitness battery, a Portuguese government initiative. The general model, analyzed using Pillai's trace, showed a significant effect of age and sex on body mass index, abdominal circumference, aerobic fitness, abdominal resistance, upper limb resistance, lower limb power, and maximal running speed (V = 0.99, F (7) = 10,916.4, p < 0.001, partial η2, sex = 0.22; age = 0.43, sex and age interaction = 0.10). Boys had higher physical fitness levels than girls in most tests, but both sex groups had a significantly higher proportion of non-fit adolescents, with boys showing the highest number of participants classified as non-fit.
Asunto(s)
Aptitud Física , Carrera , Humanos , Masculino , Adolescente , Femenino , Lactante , Portugal/epidemiología , Obesidad/epidemiología , Índice de Masa CorporalRESUMEN
A gravidez na adolescência é um problema de saúde pública mundial e apresenta maior risco de morbimortalidade materna e neonatal. Objetivo: analisar os desfechos maternos em adolescentes de risco habitual e alto risco gestacional. Método: Trata-se de um estudo transversal realizado com adolescentes com idade entre 10 a 19 anos. A amostra utilizada no estudo foi de 220 adolescentes. Foram utilizados como testes estatísticos o X² e, quando necessário, o teste exato de Fisher ou Mid-P. Foi considerado o valor de p<0,05. Resultados: Observou-se que as adolescentes de risco habitual apresentaram gestação não desejada (p=0,033) e lacerações perineais durante o parto vaginal (p<0,001) e as de alto risco tiveram alterações da gestação (p<0,001), episiotomia (p= 0,038) no parto e internações em Unidade de Terapia Intensiva (UTI) (p=0,015). Conclusão: As adolescentes de alto risco gestacional necessitam de uma atenção especializada durante o ciclo gravídico-puerperal, para prevenir alterações gestacionais, quadros clínicos graves, internação em UTI e desfechos neonatais adversos, com intuito de melhorar a qualidade de vida perinatal
Teenage pregnancy is a global public health problem and presents a higherrisk of maternal and neonatal morbidity and mortality. This study aims to analyze the maternal outcomes in adolescents of usual riskand high gestational risk. Methods: This is a crosssectional study, carried out with adolescents aged 10to 19 years. The sample used in the study consisted of 220 adolescents. X² were used asstatistical tests, when necessary, Fisher's exact test or Mid-P was used. Ap value <0.05 wasconsidered. Results:it was observed that the usual risk adolescents had unwantedpregnancies (p= 0.033) and perineal lacerations during vaginal delivery (p<0.001) and thehigh risk ones had changesin pregnancy (p<0.001), episiotomy was performed (p= 0.038)and admitted to theIntensive Care Unit (ICU) (p= 0.015). Conclusions: Adolescentsat high gestational risk need specialized care during the pregnancy-puerperal cycle, to prevent gestational changes, severe clinical conditions, ICU admission and adverse neonatal outcomes, withthe aim of improving perinatal quality of life
Asunto(s)
Humanos , Femenino , Embarazo , Niño , Adolescente , Embarazo en Adolescencia , Embarazo de Alto Riesgo , Complicaciones del Embarazo , Brasil , Lactancia Materna , Estudios TransversalesRESUMEN
Objetivo: Caracterizar os fatores clínicos e obstétricos de mulheres que tiveram diagnóstico de óbito fetal em uma maternidade escola de alto risco. Metodologia: estudo de abordagem quantitativa, de corte transversal e caráter descritivo exploratório. Foram incluídos 354 prontuários de mulheres admitidas com diagnóstico e óbito fetal entre janeiro de 2018 a janeiro de 2022. Analisou-se os dados a partir da distribuição de frequências absolutas e relativas (%). Resultados: A idade média das participantes foi de 26 anos. A maioria era primípara sem perdas fetais prévias. Hipóxia Fetal Intraútero foi a causa de óbito mais frequente (17,8%). Conclusão: O óbito fetal intraútero ainda é um diagnóstico que requer mais visibilidade por parte do sistema de saúde. Foi constatada a deficiência dos registros em prontuário de dados importantes, ressaltando a necessidade de promover treinamento e capacitação para os profissionais que realizam assistência
Objective: To characterize the clinical and obstetric factors of women who were diagnosed with fetal death in a high-risk maternity hospital. Methodology: cross-sectional, analytical and retrospective study, carried out in a high-risk maternity hospital in the Central Region of Goiás. A total of 354 medical records of women admitted with a diagnosis and fetal death between January 2018 and January 2022 were included. Data were analyzed based on the distribution of absolute and relative frequencies (%). Results: The average age of the participants was 26 years old. Most were primiparous without previous fetal losses. Intrauterine Fetal Hypoxia was the most frequent cause of death (17.8%). Conclusion: Intrauterine fetal death is still a diagnosis that requires more visibility from the health system. It was verified the deficiency of records in medical records of important data, emphasizing the need to promote training and qualification for professionals who perform assistance
Asunto(s)
Humanos , Femenino , Adulto , Muerte Fetal/etiología , Brasil , Registros Médicos/estadística & datos numéricos , Desprendimiento Prematuro de la PlacentaRESUMEN
A amamentação é uma prática recomendada pela Organização Mundial de Saúde devido aos seus inúmeros benefícios para mãe e recém-nascido, porém seu estabelecimento e manutenção vêm sendo um grande desafio nos dias atuais. Objetivo: Identificar comportamentos indicativos de dificuldades maternas e neonatais relacionadas à amamentação considerando a via de parto. Casuística e Métodos: A amostra foi composta por 240 binômios mãe-bebê, por amostragem aleatória simples e os dados obtidos através da aplicação do instrumento de observação e avaliação da mamada, proposto pelo Fundo das Nações Unidas para Infância (Unicef), com realização de entrevista semiestruturada e coleta de dados complementares por análise documental de prontuários. Estes foram analisados pelo programa SPSS versão 3.5 por meio do teste X2, exato de Fisher e aplicada a correção de Yates quando cabível, sendo os resultados estatisticamente significativos quando p<0,05. Resultados: Constatou-se no estudo uma elevada prevalência de participantes com comportamentos indicativos de dificuldades, sendo "posição" e "sucção" os mais prevalentes. Foram encontradas, ainda, significativas associações entre parto normal e comportamentos favoráveis à amamentação relacionados ao aspecto "resposta", assim como entre cesárea e comportamentos favoráveis relacionados à "posição". Conclusão: Foi possível identificar comportamentos sugestivos de dificuldades durante a amamentação, auxiliando a população, oportunizando reflexões e fornecendo subsídios para profissionais da saúde no incentivo e promoção do aleitamento materno
Breastfeeding is a practice recommended by the World Health Organization due to its numerous benefits for mother and newborn, but its establishment and maintenance have been a major challenge nowadays. Objective: To identify behaviors that indicate maternal and neonatal difficulties related to breastfeeding, considering the mode of delivery. Casuistry and Methods: The sample consisted of 240 mother-baby binomials, by simple random sampling and the data obtained through the application of the instrument of observation and evaluation of breastfeeding, proposed by the United Nations Children's Fund (Unicef), with the performance of semi-structured interview and collection of complementary data through document analysis of medical records. These were analyzed using the SPSS version 3.5 program using Fisher's exact X2 test and Yates correction was applied when applicable, with statistically significant results when p<0.05. Results: The study found a high prevalence of participants with behaviors indicative of difficulties, with "position" and "sucking" being the most prevalent. Significant associations were also found between vaginal delivery and favorable breastfeeding behaviors related to the "response" aspect, as well as between cesarean sections and favorable behaviors related to "position". Conclusion: It was possible to identify behaviors that suggest difficulties during breastfeeding, helping the population, providing opportunities for reflection and providing subsidies for health professionals in encouraging and promoting breastfeeding
Asunto(s)
Humanos , Femenino , Recién Nacido , Cesárea/efectos adversosRESUMEN
A iniquidade racial é a desigualdade em oportunidades e condições de vida que acontece em decorrência da etnia de uma pessoa. Indivíduos pretos, pardos e indígenas são modelos de povos que resistem aos desafios subsequentes dos processos históricos de segregação. Objetivo: Verificar a influência dos aspectos raciais na prática de violência obstétrica na atenção ao parto e nascimento. Métodos: Trata-se de um estudo com abordagem quantitativa, de corte transversal, com coleta de dados prospectiva, realizado em uma maternidade pública na cidade de Goiânia, Goiás. Resultados: Pode-se determinar um cuidado menos satisfatórios para as mulheres negras quando comparado com as brancas para a maioria dos indicadores avaliados neste estudo. Mulheres pretas e pardas têm maior chance de sofrerem manobra de Kristeller, amniotomia precoce, privação alimentar no trabalho de parto, clampeamento imediato do cordão umbilical e menor chance de contato pele a pele e de ser ofertado métodos não farmacológicos para o alívio da dor. Conclusão: O fator raça/cor influencia no tratamento em que as mulheres recebem dentro do estabelecimento de saúde.
Racial inequity is inequality in opportunities and living conditions that occurs as a result of a person's ethnicity. Black, brown and indigenous individuals are models of peoples who resist the subsequent challenges of historical processes of segregation. Objective: To verify the influence of racial aspects in the practice of obstetric violence in labor and birth care. Methods: This is a cross-sectional study with a quantitative approach, with prospective data collection, carried out in a public maternity hospital in the city of Goiânia, Goiás. Results: Less satisfactory care can be determined for black women when compared to white women for most of the indicators evaluated in this study. Black and brown women are more likely to undergo the Kristeller maneuver, early amniotomy, food deprivation during labor, immediate clamping of the umbilical cord and less chance of skin-to-skin contact and being offered non-pharmacological methods for pain relief. Conclusion: The race/color factor alone influences the treatment that women receive within the health establishment.
Asunto(s)
Humanos , Femenino , Adulto , Racismo , Inequidad Étnica , Violencia Obstétrica , Brasil/etnología , Trabajo de Parto , Estudios Transversales , Determinantes Sociales de la Salud , Clampeo del Cordón Umbilical , MaternidadesRESUMEN
Introdução: O termo cirurgia genital feminina engloba várias técnicas com o objetivo de melhorar a área vulvar feminina estética e funcionalmente. Sentimentos de sofrimento emocional são comuns nas mulheres que buscam tais cirurgias, impactando significativamente em sua autoestima, sexualidade, higiene e funcionalidade vulvar. O objetivo é avaliar Avaliar o interesse das mulheres assistidas em um Centro de Atenção à Mulher em cirurgias íntimas. Métodos: Estudo observacional transversal ocorrido no Centro de Atenção à Mulher (CAM) de Rio do Sul-SC. Para coleta dos dados, foi utilizado um questionário semiestruturado elaborado pelos autores. Os dados foram tratados e agrupados no programa Microsoft Excel e realizadas as análises descritivas dos dados utilizando o programa Statistical Package for the Social Sciences (SPSS). Resultados: Os achados indicaram que houve um grande interesse geral na realização de cirurgias de estética íntima. Das 100 mulheres entrevistadas, 32 apresentavam interesse em realizar algum tipo de cirurgia de estética íntima. Conclusão: Devido à importância dada à estética íntima na interferência física, psicossocial, sexual e cotidiana, com importante impacto na qualidade de vida dessas pessoas, é imperativo que recursos adequados sejam alocados para maior fornecimento de tais procedimentos no Sistema Único de Saúde para a população do Brasil.
Introduction: The term female genital surgery encompasses several techniques to improve the female vulvar area, both aesthetically and functionally. Feelings of emotional distress are common in women who seek such surgeries, significantly impacting their self-esteem, sexuality, hygiene and vulvar functionality. The objective is to To evaluate the interest of women assisted in a Women Care Center in intimate surgery. Methods: Observational study carried out at the Women Care Center (CAM) in Rio do Sul-SC. For data collection, a semi-structured questionnaire developed by the authors was used. Data were processed and grouped in Microsoft Excel, and descriptive data analysis was performed using the Statistical Package for Social Sciences (SPSS) program. Results: The findings indicated a great general interest in performing intimate aesthetic surgeries. Of the 100 women interviewed, 32 were interested in performing some intimate aesthetic surgery. Conclusion: Due to the importance given to intimate cosmetics in physical, psychosocial, sexual and everyday interference, with a major impact on the quality of life of these people, adequate resources must be allocated to a greater supply of such procedures in the Unified Health System for the population of Brazil.
RESUMEN
This study evaluated the presence of oral lesions in patients with COVID-19 hospitalized in an intensive care unit (ICU). Data included demographic, clinical, and laboratory information. Clinical assessment of the oral cavity was performed on the 2 nd and 5 th days of orotracheal intubation. Thirty-eight patients were evaluated and 16 (42.1%) presented oral lesions during their ICU stay. The median age and length of stay were 75 years and 15 days, respectively. Among the patients with oral lesions, ulcerative oral lesions were reported in 14 (87.5%) patients, of which 11 (78.6%) were found on the lips. This study highlights the importance of oral examination for patients admitted to the ICU with COVID-19.
Asunto(s)
COVID-19 , Hospitalización , Humanos , Unidades de Cuidados Intensivos , Intubación Intratraqueal , Estudios Retrospectivos , SARS-CoV-2RESUMEN
The aim of this study was to verify how dancers' flexibility work has developed during confinement through four assessment moments: before, during (two times), and after the lockdown period. The sample was formed by 18 dancers from the Porto Dance Conservatory (Portugal) with an average age of 11.4 ± 1.4 years and 1.4 ± 0.7 years of experience. To assess the passive and active flexibility level, we used seven of the International Gymnastics Federation's recommended tests using main joints (i.e., hips and spine). The first evaluation was performed before the pandemic situation began in a training environment, and the second and third evaluation were performed during the lockdown, in home environment, and in virtual trainings. Finally, the last evaluation was carried out in a training environment after returning to face-to-face activities and with several rules such a social distancing and mask use. The results showed that significant improvements were verified in the flexibility level of the dancers from the first to the fourth moment of evaluation. In the current study, no statistical significance was noted for the decreased values of functional asymmetry between the preferred and non-preferred lower limbs. These differences may have substantial relevance for dancers' harmonious body development.
Asunto(s)
COVID-19 , Baile , COVID-19/epidemiología , Niño , Control de Enfermedades Transmisibles , Humanos , Portugal/epidemiología , Estudios ProspectivosRESUMEN
OBJECTIVE: The purpose of this study was to analyze the quality of reporting and presence of spin in abstracts of randomized clinical trials (RCTs) on the use of electroanalgesia for musculoskeletal pain. METHODS: The Physiotherapy Evidence Database (PEDro) was searched from 2010 to June 2021. Inclusion criteria were RCTs using electroanalgesia in individuals with musculoskeletal pain, written in any language, comparing 2 or more groups, and with pain as 1 of the outcomes. Two blinded, independent, and calibrated evaluators (Gwet's AC1 agreement analysis) performed eligibility and data extraction. General characteristics, report of outcomes, quality of reporting (Consolidated Standards of Reporting Trials for Abstracts [CONSORT-A]), and spin analysis (7-item spin checklist and spin analysis per section) were extracted from abstracts. RESULTS: Of 989 studies selected, 173 abstracts were analyzed after screening and eligibility criteria. Mean risk of bias on the PEDro scale was 6.02 ± 1.6 points. Most abstracts did not report significant differences for primary (51.4%) and secondary (63%) outcomes. Mean quality of reporting was 5.10 ± 2.4 points in the CONSORT-A, and spin was 2.97 ± 1.7. Abstracts had at least 1 type of spin (93%), and the conclusion presented the greatest number of spin types. More than 50% of abstracts recommended an intervention without significant differences between groups. CONCLUSION: This study found that the majority of RCT abstracts on electroanalgesia for musculoskeletal conditions in our sample had a moderate to high risk of bias, incomplete or missing information, and some type of spin. We recommend that health care providers who use electroanalgesia and the scientific community be aware of spin in published studies.
Asunto(s)
Medicina , Dolor Musculoesquelético , Estimulación Eléctrica Transcutánea del Nervio , Humanos , Dolor Musculoesquelético/diagnóstico , Dolor Musculoesquelético/terapia , Modalidades de Fisioterapia , Lista de Verificación , Ensayos Clínicos Controlados Aleatorios como AsuntoRESUMEN
Abstract This study evaluated the presence of oral lesions in patients with COVID-19 hospitalized in an intensive care unit (ICU). Data included demographic, clinical, and laboratory information. Clinical assessment of the oral cavity was performed on the 2 nd and 5 th days of orotracheal intubation. Thirty-eight patients were evaluated and 16 (42.1%) presented oral lesions during their ICU stay. The median age and length of stay were 75 years and 15 days, respectively. Among the patients with oral lesions, ulcerative oral lesions were reported in 14 (87.5%) patients, of which 11 (78.6%) were found on the lips. This study highlights the importance of oral examination for patients admitted to the ICU with COVID-19.
RESUMEN
Para entender o impacto da Profilaxia Pré-Exposição - PrEP na prevenção do HIV, além dos dados de eficácia clínica, precisamos compreender as crenças que subjazem a aceitabilidade da PrEP, uma vez que, para ser segura e eficaz é importante, que esteja em sintonia com as necessidades e preocupações dos usuários. Assim, o objetivo deste estudo é analisar as crenças comportamentais quanto às vantagens e desvantagens do uso de PrEP. A amostra foi composta por 31 participantes de quatro populações-chaves que já utilizam a PrEP, sendo contactados de forma online. Como instrumento de coleta utilizou-se um questionário tendo por base a Teoria da ação racional, composto por quatro perguntas abertas, além dos dados sociodemográficos. Os dados quantitativos foram analisados por estatísticas descritivas, enquanto os qualitativos por meio de análise categorial temática. No tocante as vantagens de usar a PrEP obtiveram-se 84 crenças, sendo as principais: 1) Dupla proteção, 2) Não uso do preservativo, 3) Diminuir a contaminação, 4) Diminuir as ISTs, 5) Autonomia na prevenção. Já em relação às desvantagens, obtiveram-se 95 crenças: 1) Efeitos colaterais, 2) Não eficácia, 3) Não uso do preservativo, 4) Foco no HIV, 5) Tomar diariamente a PrEP. A análise das crenças possibilitou a identificação dos fatores que podem influenciar positivamente ou negativamente a adoção do comportamento preventivo, apontando que embora a PrEP encoraje estratégias de cuidado, ainda há um desconhecimento sobre sua real eficácia.
To understand the impact of Pre-Exposure Prophylaxis - PrEP on HIV prevention, in addition to clinical efficacy data, we need to understand the beliefs that underlie the acceptability of PrEP, since it is important to be in tune to be safe and effective. users' needs and concerns. Thus, the aim of this study is to analyze behavioral beliefs regarding the advantages and disadvantages of using PrEP. The sample consisted of 31 participants from four key populations that already use PrEP, being contacted online. As a collection instrument, a questionnaire was used based on the Theory of Rational Action, composed of four open questions, in addition to sociodemographic data. Quantitative data were analyzed using descriptive statistics, while qualitative data were analyzed using thematic categorical analysis. Regarding the advantages of using PrEP, 84 beliefs were obtained, the main ones being: 1) Double protection, 2) Not using condoms, 3) Decreasing contamination, 4) Decreasing STIs, 5) Autonomy in prevention. Regarding the disadvantages, 95 beliefs were obtained: 1) Side effects, 2) Ineffectiveness, 3) Not using a condom, 4) Focus on HIV, 5) Taking PrEP daily. The analysis of beliefs enabled the identification of factors that can positively or negatively influence the adoption of preventive behavior, pointing out that although PrEP encourages care strategies, there is still a lack of knowledge about its real effectiveness.
RESUMEN
Hyperimmune plasma is the raw material for the production of heterologous serum, which corresponds to the main specific treatment against toxins from microorganisms and venomous animals. This work aims to perform a comparative analysis of the plasma collected in the three production bleeds, subjectively analyzing the production of immunoglobulins through the amount of total protein and measuring the levels of pH, glucose, leukocytes, density and fibrinogen. Samples were collected from 67 horses, divided into three groups according to the antigen to which they were immunized, being: Group 1 (G1) - immunized against tetanus toxoid, Group 2 (G2) - immunized against crotalic antigen and Group 3 ( G3) - immunized against scorpionic antigen. Samples were obtained during production bleeding procedures, by collecting whole blood in vacuum tubes with EDTA. The analyzes were performed using a refractometer to quantify total protein, density and fibrinogen and reagent strips for measuring pH, leukocytes and glucose. The results demonstrate significant variations between the three services studied, mainly in relation to total protein, where in G1 its peak production occurred in the second bleed, in G2 it remained stable in the first two bleeds with a slight drop in the third, and in G3 with peak in the first production bleed. Through the rapid tests proposed in this study it is possible to have an overview of the divergence of parameters between the three production bleeds, quickly and at a low cost, but to obtain more reliable results, especially with regard to immunoglobulins, indicated the adoption of more specific analysis techniques.
O plasma hiperimune é a matéria prima para produção de soro heterólogo, que corresponde ao principal tratamento específico contra toxinas oriundas de micro-organismos e animais peçonhentos. Este trabalho tem por objetivo realizar uma análise comparativa do plasma coletado nas três sangrias de produção, analisando subjetivamente a produção de imunoglobulinas através da quantidade de proteína total e dosar os níveis de pH, glicose, leucócitos, densidade e fibrinogênio. Foram coletadas amostras de 67 equinos, divididos em três grupos de acordo com o antígeno ao qual foram imunizados, sendo: Grupo 1 (G1) – imunizados contra o toxóide tetânico, Grupo 2 (G2) – imunizados contra o antígeno crotálico e Grupo 3 (G3) – imunizados contra o antígeno escorpiônico. As amostras foram obtidas durante os procedimentos de sangrias de produção, através da coleta de sangue total em tubos à vácuo com EDTA. As análises foram realizadas através do uso de refratômetro para quantificação de proteína total, densidade e fibrinogênio e de tiras reagentes para dosagem de pH, leucócitos e glicose. Os resultados demonstram significativas variações entre os três serviços estudados, principalmente em relação a proteína total, onde em G1 seu pico de produção ocorreu na segunda sangria, em G2 permaneceu estável nas duas primeiras sangrias com ligeira queda na terceira, e em G3 com pico na primeira sangria de produção. Através dos testes rápidos propostos nesse estudo é possível ter uma visão geral das divergências de parâmetros entre as três sangrias de produção, de forma rápida e com baixo custo, porém para se obter resultados mais fidedignos, principalmente no que se refere as imunoglobulinas, indica-se a adoção de técnicas mais específicas de análises.
RESUMEN
The morphological characteristics and biological maturation are among the more important factors in the performance in the Rhythmic Gymnastics. Thus, the aims of the present study were: (1) identify the training, morphological and biological maturation characteristics in elite Brazilian and Portuguese gymnasts; (2) compare these characteristics across groups. The Brazilian Portuguese National Team (13 gymnasts) were studied. Anthropometric and body composition measurements were performed. For analysis of biological maturation, the sexual (pubertal stages and age at menarche) and somatic (offset maturational) maturation were evaluated. The training data were collected by interviewing. For the statistical analysis, Mann-Whitney test was applied. The somatotype and calculation of its components were performed according to the Health-Carter method thought of the MER Goulding Software Development. Brazil and Portugal National Teams presented similar training volume and training onset, however Brazilian gymnasts had higher age and years of practice in Rhythmic Gymnastics than Portuguese gymnasts. Brazilian had higher body mass; height; lower limb length; triceps, subscapular and abdominal skinfolds; relaxed arm and thigh girths; and endomorphy somatotype component than Portuguese. The groups showed different somatotypes: Brazilian (endomorphic ectomorph) and Portuguese (balanced ectomorph), although without statistical significance. The groups demonstrated a delay in maturational development. Similar breast (stages 3 and 4) and pubic hair (stages 2 and 3) development were verified. In total, 84.6 % of gymnasts had reached menarche (15.9±2.6 years) and all gymnasts had reached the age at peak height velocity (14.9±1.2 years). The distance and age at peak height velocity were higher in Brazilian than in Portuguese.
Las características morfológicas y la maduración biológica se encuentran entre los factores más importantes en el rendimiento en la gimnasia rítmica. Por lo tanto, los objetivos del presente estudio fueron: (1) identificar las características de entrenamiento, morfológicas y maduración biológica en las gimnastas brasileñas y portuguesas de élite; (2) comparas estas características entre grupos. Se estudió la Selección Nacional Portuguesa y Brasileña (13 gimnastas). Se realizaron mediciones antropométricas y de composición corporal. Para el análisis de la maduración biológica, se evaluaron las etapas sexuales (etapas de pubertad y edad en la menarquia) y somáticas (edad en el pick de velocidad de altura). Los datos de entrenamiento fueron recolectados mediante entrevistas. Para el análisis estadístico, se aplicó la prueba de Mann-Whitney. El somatotipo y el cálculo de sus componentes se realizaron de acuerdo con el método de Health-Carter, pensado en el desarrollo de software MER Goulding. Los equipos nacionales de Brasil y Portugal presentaron un volumen de entrenamiento y un inicio de entrenamiento similares; sin embargo, las gimnastas brasileñas tenían mayor edad y años de práctica en gimnasia rítmica que las gimnastas portuguesas. Las brasileñas tenían mayor masa corporal; altura; longitud del miembro inferior; pliegues cutáneos del músculo tríceps, músculo subescapular y a nivel abdominal; circunferencia relajada del brazo y del muslo; y el componente somatotípico endomórfico que el portugués. Los grupos eran diferentes somatotipos: brasileñas (ectomórfico endomórfico) y portugués (ectomórfico equilibrada), aunque sin significación estadística. Los grupos demostraron un retraso en el desarrollo madurativo. Se verificó un desarrollo similar del seno (estadios 3 y 4) y del vello púbico (estadios 2 y 3). En total, el 84,6 % de las gimnastas alcanzaron la menarquia (15,9 ± 2,6 años) y el 92,3 % de las gimnastas alcanzaron su altura máxima con 17,4 ± 1,2 años. La distancia y la edad en la velocidad de alcance de la altura máxima fueron más altas en Brasil que en Portugal.
Asunto(s)
Humanos , Femenino , Adolescente , Adulto Joven , Composición Corporal , Antropometría , Crecimiento , Gimnasia , Portugal , Maduración Sexual , BrasilRESUMEN
O Implante Coclear (IC) é um dispositivo eletrônico capaz de substituir parcialmente o órgão sensorial auditivo em indivíduos com perdas auditivas de graus severo a profundo. O Brasil conta atualmente, com 26 centros de referência que dão assistência à população deficiente auditiva em todas as idades, tanto na rede privada como no Serviço Único de Saúde. O objetivo deste estudo é analisar a adesão de crianças à reabilitação auditiva dentro do serviço de Implante Coclear em um Centro de Referência, no Rio Grande do Norte. Trata-se de um estudo transversal observacional exploratório realizado a partir das informações dos prontuários de crianças usuárias de implante coclear atendidas na Clínica Otomed. A população de estudo foi composta por 90 crianças de 0 a 12 anos, de ambos os sexos, usuárias de implante coclear, que realizaram a cirurgia e ativação entre o período de Janeiro de 2008 a Dezembro de 2017, residentes no estado do Rio Grande do Norte. Para a análise das variáveis qualitativas foi utilizada a descrição de frequências absolutas e relativas e as variáveis quantitativas foram extraídas as medidas de tendência central e de dispersão. As variáveis categóricas foram submetidas ao teste do Qui-quadrado, dentro do nível de significância de 5%. Para analisar a relação intragrupo das variáveis qualitativas e quantitativas, utilizou-se o teste de Wilcoxon, e entre os grupos o teste de Mann-Whitney. Houve evolução das categorias auditivas e de linguagem tanto das crianças da região metropolitana quanto as da não metropolitana que permaneceram assíduas à habilitação auditiva por um período mínimo de 3 anos. O diagnóstico e implantação precoce se mostraram favoráveis ao desenvolvimento das crianças em especial àquelas que realizaram a Triagem Auditiva Neonatal (AU).
The Cochlear Implant (IC) is an electronic device that can replace the auditory sensory organ in individuals with hearing degrees of deep depth. Brazil currently has 26 referral centers that assist the hearing impaired population of all ages, both in the private network and in the Unified Health Service. The objective of this study is to analyze the adherence of children to hearing rehabilitation in the health service. Cochlear Implant at the Reference Center in Rio Grande do Norte. This is a cross-sectional observational exploratory study based on information from medical records of cochlear implant users attended at the Otomed Clinic. The study population consisted of 90 children from 0 to 12 years old, of both sexes, users of cochlear implants, who underwent surgery and activated between January 2008 and December 2017, residents of the state of Rio Grande do Sul. North. For an analysis of the qualitative variables, a description of the absolute and definite frequencies was used and the quantitative variables extracted as measures of central tendency and dispersion. As strategic variables, they were submitted to the Chi-square test, within the significance level of 5%. To analyze an intragroup relationship of qualitative and quantitative variables used or the Wilcoxon test, and between groups or the Mann-Whitney test. There was an evolution of the auditory and language categories of both children in the metropolitan and non-metropolitan regions, who remained assiduous to the hearing for a minimum of 3 years. Early diagnosis and implantation may be conducive to the development of children in particular who have undergone Neonatal Hearing Screening (AU).
Asunto(s)
Humanos , Masculino , Femenino , Recién Nacido , Lactante , Preescolar , Niño , Sistema Único de Salud , Implantación Coclear/estadística & datos numéricos , Política de Salud , Audición , Pérdida Auditiva , Distribución de Chi-Cuadrado , Sistema de Registros/estadística & datos numéricos , Estudios Transversales/métodos , Estadísticas no Paramétricas , Diagnóstico PrecozRESUMEN
Objetivo levantar a prevalência dos fatores intrínsecos e extrínsecos que podem interferir no processo de aprendizagem em crianças com epilepsia. Métodos este estudo descritivo foi realizado no Ambulatório de Neurologia Infantil do Hospital de Pediatria Professor Heriberto Bezerra (HOSPED) da UFRN. A obtenção dos dados ocorreu durante setembro/2009 a março/2010 por meio da aplicação de um questionário com pais e cuidadores de crianças com epilepsia. A amostra foi constituída por 41 crianças, seguindo os seguintes critérios de inclusão: a) pais ou cuidadores de crianças com diagnóstico inequívoco de epilepsia atendidas no ambulatório do HOSPED; b) crianças com idades entre 3 e 12 anos; e c) pais ou responsáveis assinarem o termo de consentimento livre e esclarecido. Resultados 61% das crianças apresentaram diagnóstico de epilepsia pura. 59% tiveram sua primeira crise antes dos 03 anos de idade. 34% apresentavam crises do tipo generalizada. 51% apresentavam crises no período da pesquisa. 98% estavam em tratamento medicamentoso para controle das crises, sendo 55% monoterapia e 45% politerapia. 76% estavam inseridas na escola, sendo 50% em escolas públicas. 66% nunca repetiram o ano. 49% das crianças tiveram assiduidade escolar prejudicada em virtude das crises. 64% nunca foram excluídas da escola pelos professores devido a epilepsia e 85% dos pais afirmaram superproteger os filhos. Conclusão o estudo concluiu que, além da epilepsia, as crianças com essa patologia são também expostas a outros fatores, decorrentes da doença, que podem influenciar negativamente no processo de aprendizagem dessas crianças. .
Purpose to raise the prevalence of intrinsic and extrinsic factors of the learning process in children with epilepsy. Methods this descriptive study was conducted at the Clinic of Neurology Children’s Hospital of Pediatrics Professor Heriberto Bezerra, HOSPED – UFRN. Data collection occurred during the September/2009 to March/2010 through a questionnaire with parents and carers of children with epilepsy. The sample comprised 41 children, according to the following inclusion criteria: a) parents or caregivers of children with an unequivocal diagnosis of epilepsy seen at the outpatient clinic of HOSPED; b) children aged between 3 and 12 years; and c) parents or guardian sign the consent form free and clear. Results 61% of children were diagnosed with pure epilepsy. 59% had their first crisis before the age of 03. 34% presented generalized crisis type. 51% presented crisis during the survey period. 98% were on medications to control crisis, and from these children, 55% monotherapy and 45% polytherapy. 76% were at school, 50% inserted in public school. 66% never repeated the school year. 49% of children had school attendance affected because of the crisis. 64% have never been excluded from school by teachers because of epilepsy and 85% of parents affirmed to overprotect their children. Conclusion the study concluded that, in addition epilepsy, children with that pathology are also exposed to other factors, resulting from the disease, which may negatively affect these children learning process. .
RESUMEN
INTRODUÇÃO: O Cartão Nacional de Saúde (CNS) possui estreita relação com a avaliação dos alunos realizada no Programa Saúde na Escola (PSE) sendo necessário para validação de suas ações. Há uma alta prevalência de alunos avaliados que não possuem o CNS, o que faz com que várias ações do programa tornem-se inválidas, por não possuírem a informação primordial para alimentar o sistema. OBJETIVO: Ampliar o número de educandos atendidos no PSE pertencentes às escolas cadastradas no Município de Entre Folhas/MG, demonstrando a importância e os benefícios de possuir o CNS no PSE tanto para o município quanto para as crianças contempladas. METODOLOGIA: Trata-se de um projeto de intervenção, baseado no Planejamento Estratégico Situacional. Foi realizada uma revisão de literatura, no período dos últimos 10 anos, nos bancos de dados Scientific Electronic Library Online (Scielo), Literatura Latino-Americana e do Caribe em Ciências da Saúde (LILACS), Banco de Dados de Enfermagem (BDENF), edições do Ministério da Saúde e outros. RESULTADOS: A partir do estudo foi possível identificar os fatores que influenciaram na não efetivação das ações do programa devido à ausência do CNS, sendo propostas ações estratégicas para superação da situação problema encontrada com o intuito de realizar a ampliação do número de educandos cadastrados no Sistema Único de Saúde assim, solicitando aos pais e/ou responsáveis o envio de documentação adequada para cadastro e conferência dos cartões. CONCLUSÃO: Espera-se que com este estudo se possa ampliar o compartilhamento de informações com os funcionários sobre a necessidade do uso do número de identificação dos educandos, pois sua ausência veio a prejudicar a inserção dos dados da vigência anterior. Notou-se que por meio das ações de criação e atualização do CNS, tornou-se possível assegurar a participação efetiva de todos educandos nas ações, além de criar a responsabilização e cidadania a fim de garantir atendimento não somente no PSE, mas em toda e qualquer esfera em âmbito nacional. Dessa forma, fica clara a obrigatoriedade da preparação do setor de saúde, considerando como dever principal a conscientização da necessidade de possuir o CNS e seu uso mediante a evolução dos programas. Por sua vez, ele permitirá o reconhecimento do usuário no sistema associando as informações para a formação de um prontuário eletrônico abrangendo todos os dados do usuário do SUS gerando um novo hábito em relação aos atendimentos da atenção básica e seus programas de saúde.