NewsMeSH: A new classifier designed to annotate health news with MeSH headings.

MOTIVATION: In the age of big data, the amount of scientific information available online dwarfs the ability of current tools to support researchers in locating and securing access to the necessary materials. Well-structured open data and the smart systems that make the appropriate use of it are invaluable and can help health researchers and professionals to find the appropriate information by, e.g., configuring the monitoring of information or refining a specific query on a disease. METHODS: We present an automated text classifier approach based on the MEDLINE/MeSH thesaurus, trained on the manual annotation of more than 26 million expert-annotated scientific abstracts. The classifier was developed tailor-fit to the public health and health research domain experts, in the light of their specific challenges and needs. We have applied the proposed methodology on three specific health domains: the Coronavirus, Mental Health and Diabetes, considering the pertinence of the first, and the known relations with the other two health topics. RESULTS: A classifier is trained on the MEDLINE dataset that can automatically annotate text, such as scientific articles, news articles or medical reports with relevant concepts from the MeSH thesaurus. CONCLUSIONS: The proposed text classifier shows promising results in the evaluation of health-related news. The application of the developed classifier enables the exploration of news and extraction of health-related insights, based on the MeSH thesaurus, through a similar workflow as in the usage of PubMed, with which most health researchers are familiar.

In search of an evidence-based strategy for quality assessment of human tissue samples: report of the tissue Biospecimen Research Working Group of the Spanish Biobank Network.

The purpose of the present work is to underline the importance of obtaining a standardized procedure to ensure and evaluate both clinical and research usability of human tissue samples. The study, which was carried out by the Biospecimen Science Working Group of the Spanish Biobank Network, is based on a general overview of the current situation about quality assurance in human tissue biospecimens. It was conducted an exhaustive review of the analytical techniques used to evaluate the quality of human tissue samples over the past 30 years, as well as their reference values if they were published, and classified them according to the biomolecules evaluated: (i) DNA, (ii) RNA, and (iii) soluble or/and fixed proteins for immunochemistry. More than 130 publications released between 1989 and 2019 were analysed, most of them reporting results focused on the analysis of tumour and biopsy samples. A quality assessment proposal with an algorithm has been developed for both frozen tissue samples and formalin-fixed paraffin-embedded (FFPE) samples, according to the expected quality of sample based on the available pre-analytical information and the experience of the participants in the Working Group. The high heterogeneity of human tissue samples and the wide number of pre-analytic factors associated to quality of samples makes it very difficult to harmonize the quality criteria. However, the proposed method to assess human tissue sample integrity and antigenicity will not only help to evaluate whether stored human tissue samples fit for the purpose of biomarker development, but will also allow to perform further studies, such as assessing the impact of different pre-analytical factors on very well characterized samples or evaluating the readjustment of tissue sample collection, processing and storing procedures. By ensuring the quality of the samples used on research, the reproducibility of scientific results will be guaranteed.

Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine neoplasia type 1 syndrome in Spain.

CONTEXT: Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. OBJECTIVE: The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. RESULTS: A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. CONCLUSIONS: Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.