Comprehensive model for X-ray-induced damage in protein crystallography.

Acquisition of X-ray crystallographic data is always accompanied by structural degradation owing to the absorption of energy. The application of high-fluency X-ray sources to large biomolecules has increased the importance of finding ways to curtail the onset of X-ray-induced damage. A significant effort has been under way with the aim of identifying strategies for protecting protein structure. A comprehensive model is presented that has the potential to explain, both qualitatively and quantitatively, the structural changes induced in crystalline protein at ∼100 K. The first step is to consider the qualitative question: what are the radiation-induced intermediates and expected end products? The aim of this paper is to assist in optimizing these strategies through a fundamental understanding of radiation physics and chemistry, with additional insight provided by theoretical calculations performed on the many schemes presented.

Identification of the C4'-oxidized abasic site as the most abundant 2-deoxyribose lesion in radiation-damaged DNA using a novel HPLC-based approach.

A novel analytical high-performance liquid chromatography (HPLC)-based method of quantification of the yields of C4'-oxidized abasic sites, 1, in oxidatively damaged DNA has been elaborated. This new approach is based on efficient conversion of 1 into N-substituted 5-methylene-Δ(3)-pyrrolin-2-ones, 2, upon treatment of damaged DNA with primary amines in neutral or slightly acidic solutions with subsequent quantification of 2 by HPLC. The absolute and relative radiation-chemical yields of 1 in irradiated DNA solutions were re-evaluated using this method. The yields were compared with those of other 2-deoxyribose degradation products including 5-methylene-2(5H)-furanone, malondialdehyde, and furfural resulting from the C1', C4' and C5'-oxidations, respectively. The yield of free base release (FBR) determined in the same systems was employed as an internal measure of the total oxidative damage to the 2-deoxyribose moiety. Application of this technique identifies 1 as the most abundant sugar lesion in double-stranded (ds) DNA irradiated under air in solution (36% FBR). In single-stranded (ss) DNA this product is second by abundance (33% FBR) after 2-deoxyribonolactones (C1'-oxidation; 43% FBR). The production of nucleoside-5'-aldehydes (C5'-oxidation; 14% and 5% FBR in dsDNA and ssDNA, respectively) is in the third place. Taken together with the parallel reaction channel that converts C4'-radicals into malondialdehyde and 3'-phosphoglycolates, our results identify the C4'-oxidation as a prevalent pathway of oxidative damage to the sugar-phosphate backbone (50% or more of all 2-deoxyribose damages) in indirectly damaged DNA.

Insights into the mechanism of X-ray-induced disulfide-bond cleavage in lysozyme crystals based on EPR, optical absorption and X-ray diffraction studies.

Electron paramagnetic resonance (EPR) and online UV-visible absorption microspectrophotometry with X-ray crystallography have been used in a complementary manner to follow X-ray-induced disulfide-bond cleavage. Online UV-visible spectroscopy showed that upon X-irradiation, disulfide radicalization appeared to saturate at an absorbed dose of approximately 0.5-0.8 MGy, in contrast to the saturating dose of ∼0.2 MGy observed using EPR at much lower dose rates. The observations suggest that a multi-track model involving product formation owing to the interaction of two separate tracks is a valid model for radiation damage in protein crystals. The saturation levels are remarkably consistent given the widely different experimental parameters and the range of total absorbed doses studied. The results indicate that even at the lowest doses used for structural investigations disulfide bonds are already radicalized. Multi-track considerations offer the first step in a comprehensive model of radiation damage that could potentially lead to a combined computational and experimental approach to identifying when damage is likely to be present, to quantitate it and to provide the ability to recover the native unperturbed structure.

DNA damage by the direct effect of ionizing radiation: products produced by two sequential one-electron oxidations.

It has long been assumed that the population of radicals trapped in irradiated DNA (that is, the radicals escaping recombination) would quantitatively account for the lesions observed in DNA. Recent results indicate that this is not the case. The yield of DNA lesions exceed the yield of trappable radicals. To account for a portion of this shortfall, it is thought that some of the initially formed 2'-deoxyribose radicals undergo a second oxidation by nearby base cation radicals to form 2'-carbocations. The carbocations react to give strand breaks and free base release. Schemes are presented to account for the major oxidation products observed including 8-oxoGua, 8-oxoAde, 5-OHMeUra, and free base release. Theoretical calculations were performed to ascertain the likelihood of the second oxidation step in these reaction pathways actually occurring, and to account for base sequence dependence and various levels of hydration.

Excess electron trapping in duplex DNA: long range transfer via stacked adenines.

An understanding of charge transfer (CT) in DNA lies at the root of assessing the risks and benefits of exposure to ionizing radiation. Energy deposition by high-energy photons and fast-charged particles creates holes and excess electrons (EEs) in DNA, and the subsequent reactions determine the complexity of DNA damage and ultimately the risk of disease. Further interest in CT comes from the possibility that hole transfer, excess electron transfer (EET), or both in DNA might be used to develop nanoscale circuits. To study EET in DNA, EPR spectroscopy was used to determine the distribution of EE trapping by oligodeoxynucleotides irradiated and observed at 4 K. Our results indicate that stretches of consecutive adenine bases on the same strand serve as an ideal conduit for intrastrand EET in duplex DNA at 4 K. Specifically, we show that A is an efficient trap for EE at 4 K if, and only if, the A strand of the duplex does not contain one of the other three bases. If there is a T, C, or G on the A strand, then trapping occurs at T or C instead of A. This holds true for stretches up to 32 A's. Whereas T competes effectively against A for the EE, it does not compete effectively against C. Long stretches of T pass the majority of EE to C. Our results show that AT stretches channel EE to cytosine, an end point with significance to both radiation damage and the photochemical repair of pyrimidine dimers.

Yields of damage to C4' deoxyribose and to pyrimidines in pUC18 by the direct effect of ionizing radiation.

Our mechanistic understanding of damage formation in DNA by the direct effect relies heavily on what is known of free radical intermediates studied by EPR spectroscopy. Bridging this information to stable product formation requires methods with comparable sensitivities, a criterion met by the (32)P-post-labeling assay developed by Weinfeld and Soderlind, [Weinfeld,M. and Soderlind,K.-J.M. (1991) (32)P-Postlabeling detection of radiation-induced DNA damage: identification and estimation of thymine glycols and phosphoglycolate termini. Biochemistry, 30, 1091-1097] which when applied to the indirect effect, detected phosphoglycolate (pg) and thymine glycol (Tg). Here we applied this assay to the direct effect, measuring product yields in pUC18 films with hydration levels (Γ) of 2.5, 16 or 23 waters per nucleotide and X-irradiated at either 4 K or room temperature (RT). The yields of pg [G(pg)] for Γ ≈ 2.5 were 2.8 ± 0.2 nmol/J (RT) and 0.2 ± 0.3 nmol/J (4 K), which is evidence that the C4' radical contributes little to the total deoxyribose damage via the direct effect. The yield of detectable base damage [G(B*)] at Γ ≈ 2.5 was found to be 30.2 ± 1.0 nmol/J (RT) and 12.9 ± 0.7 nmol/J (4 K). While the base damage called B*, could be due to either oxidation or reduction, we argue that two reduction products, 5,6-dihydrouracil and 5,6-dihydrothymine, are the most likely candidates.

EPR detection of an electron scavenging contaminant in irradiated deoxyoligonucleotides: one-electron reduced benzoyl.

Our lab investigated damage of DNA due to ionizing radiation using electron paramagnetic resonance (EPR). Through studies focused on one-electron-reduction of synthetic oligodeoxynucleotides containing only thymine and adenine, we discovered the significant presence of a contaminant in all samples. The contaminant was observed to have a reduction potential greater than that of thymine. In addition, the contaminant yielded a sharp EPR singlet when it was one-electron reduced that interfered with the distinctive doublet of one-electron reduced thymine. We determined that the contaminant contained a benzoyl group, a chemical used in to protect the amine group of adenine during oligodeoxynucleotide synthesis. Derivatives of benzoyl and 16 different oligomer sequences were prepared in a LiCl glass and studied using EPR after X-irradiating at 4K. This treatment selectively creates one-electron reduced radicals. Synthetic derivatives were used to develop an EPR benchmark of the benzoyl radical. Using this, along with the known spectra of one-electron reduced nucleobases, we performed component analysis of the EPR signal from each sample. This analysis revealed that 2-9% of adenines, in the commercially synthesized oligomers delivered to us, were left contaminated with benzoyl. We concluded that the presence of benzoyl is a potential source of error in a variety of experiments utilizing synthesized oligodeoxynucleotides.

Mechanisms of direct radiation damage to DNA: the effect of base sequence on base end products.

It has been generally assumed that product formation in DNA damaged by ionizing radiation is relatively independent of base sequence, i.e., that the yield of a given product depends primarily on the chemical properties of each DNA constituent and not on its base sequence context. We examined this assumption by comparing direct-type end products produced in films of d(CTCTCGAGAG)(2) with those produced in films of d(GCACGCGTGC)(2). Here we report the product yields in d(CTCTCGAGAG)(2) hydrated to Γ = 2.5 and 15, where Γ is the hydration level given in moles of H(2)O/mole of nucleotide. Of the 17 products monitored by GC/MS, seven exhibited statistically significant yields: 8-oxoGua, 8-oxoAde, 5-OHMeUra, 5,6-diHUra, 5,6-diHThy, 5-OHCyt, and 5-OHUra. These yields at Γ = 2.5 are compared with the yields from our previously reported study of d(GCACGCGTGC)(2) (after projecting the yields to a CG/AT ratio of 1). The ratio of projected yields, d(CTCTCGAGAG)(2) divided by d(GCACGCGTGC)(2), are 1.3 ± 0.9, 1.8 ± 0.3, 1.6 ± 0.6, 11.4 ± 4.7, 0.2 ± 0.1, >28, and 0.8 ± 1.1, respectively. Considering just d(CTCTCGAGAG)(2), the ratios of yields at Γ = 2.5 divided by yields at Γ = 15 are 0.7 ± 0.2, 0.5 ± 0.1, 2.3 ± 4.0, 3.4 ± 1.2, 3.5 ± 3.3, 1.2 ± 0.2, and 0.4 ± 0.2, respectively. The effects of sequence and hydration on base product yields are explained by a working model emphasizing the difference between two distinctly different types of reaction: (i) radical reactions that progress to nonradical intermediates and product prior to dissolution and (ii) reactions that stem from radicals trapped in the solid state at room temperature that go on to yield nonradical product after sample dissolution. Based on these findings, insights into rates of hole and excess electron-transfer relative to rates of proton transfer are discussed.

Factors affecting the yields of C1' and C5' oxidation products in radiation-damaged DNA: the indirect effect.

This study reports the effects of denaturation and deoxygenation on radiation-induced formation of 2-deoxyribonolactone (2-dL) and 5'-aldehyde (5'-Ald) lesions in highly polymerized DNA. The radiation-chemical yields of 2-dL were determined through quantification of its dephosphorylation product 5-methylenefuranone (5MF). The formation of 5'-Ald was monitored qualitatively through the release of furfural (Fur) under the same conditions. The yields of 2-dL were found to be 7.3 ± 0.3 nmol J(-1), or about 18% of the yield of free base release measured in the same samples. Denaturation increased the efficiency of 2-dL formation approximately twofold while deoxygenation resulted in a fourfold decrease. The release of Fur is about twofold lower than that of 5MF in aerated native DNA samples and is further reduced by denaturation of the DNA. Unlike 5MF, the formation of Fur requires the presence of molecular oxygen, which is consistent with peroxyl radical-mediated oxidation of C5' radicals into 5'-Ald. In contrast, the existence of an oxygen-independent pathway of 2-dL formation suggests that C1' sugar radicals can also be oxidized by radiation-produced oxidizing intermediates such as electron-loss centers on guanines.

What fraction of DNA double-strand breaks produced by the direct effect is accounted for by radical pairs?

The purpose of this investigation was to determine what fraction of double strand breaks (dsb's), generated by the direct effect of ionizing radiation on DNA, can be accounted for by radical pairs. A radical pair is defined as two radicals trapped within a separation distance of <3 nm. Q-band EPR was used to measure the yield of radical pairs in calf thymus DNA films X-irradiated at 4 K. The EPR spectrum of DNA showed no evidence of radical pairs. To determine the relative sensitivity for radical pair detection via Q-band EPR, we measured the yield of radical pairs in single crystals of thymine, G(rp-Thy). Under the same conditions employed for DNA, G(rp-Thy) was approximately 8 nmol/J. The value of G(rp-Thy), in conjunction with the measured signal-to-noise, was used to calculate an upper limit for the yield of radical pairs in DNA, G(max)(rp-DNA) < 0.7-1.4 nmol/J. The upper limit, G(max)(rp-DNA), was compared with the yield of dsb's, G(total)(dsb) = 10 nmol/J, previously measured in pUC18 DNA films by Purkayastha, S.; Milligan, J. R.; Bernhard, W. A. Radiat. Res. 2007, 168, 357. We found that G(total)(dsb) > 2 x G(max)(rp-DNA), implying that a significant fraction of dsb's were not derived from a pair of trappable radicals. At least one of the two precursors needed to form a dsb was a diamagnetic (molecular) product. The hypothesis is that EPR silent lesions are formed through a molecular pathway. For example, a two-electron oxidation of deoxyribose would result in a deoxyribose carbocation intermediate that ultimately leads to a strand break.

One-electron oxidation of DNA by ionizing radiation: competition between base-to-base hole-transfer and hole-trapping.

The distance of hole migration through DNA determines the degree to which radiation-induced lesions are clustered. It is the degree of clustering that confers to ionizing radiation its high toxicity. The migration distance is governed by a competition between hole transfer and irreversible trapping reactions. An important type of trapping is reactions that lead to the formation of deoxyribose radicals, which are precursors to free base release (fbr). Using HPLC, fbr was measured in X-irradiated films of d(CGCGCGCGCG)(2) and d(CGCGAATTCGCG)(2) as well as three genomic DNAs: M. luteus, calf thymus, and C. perfringens. The level of DNA hydration was varied from Gamma = 2.5 to 22 mol waters/mol nucleotide. The chemical yields of each base, G(base), were measured and used to calculate the modification factor, M(base). This factor compensates for differences in the GC/AT ratio, providing a measure of the degree to which a given base influences its own release. In the DNA oligomers, M(Gua) > M(Cyt), a result ascribed to the previously observed end effect in short oligomers. In the highly polymerized genomic DNA, we found that M(Cyt) > M(Gua) and that M(Thy) is consistently the smallest of the M factors. For these same DNA films, the yields of total DNA trapped radicals, G(tot)(fr), were measured using EPR spectroscopy. The yield of deoxyribose radicals was calculated using G(dRib)(fr) = approximately 0.11 x G(tot)(fr). Comparing G(dRib)(fr) with total fbr, we found that only about half of the fbr is accounted for by deoxyribose radical intermediates. We conclude that for a hole on cytosine, Cyt(*+), base-to-base hole transfer competes with irreversible trapping by the deoxyribose. In the case of a hole on thymine, Thy(*+), base-to-base hole transfer competes with irreversible trapping by methyl deprotonation. Close proximity of Gua protects the deoxyribose of Cyt but sensitizes the deoxyribose of Thy.

Direct damage to the backbone of DNA oligomers is influenced by the OH moiety at strand ends, by the type of base, and by context.

Previous studies on high molecular weight DNA found that backbone damage, as monitored by free base release, is relatively independent of the type of base; i.e., the yields of all four bases were nearly equal. This could be due to a lack of influence of any given base over damage to its own deoxyribose or it could be a consequence of averaging out disparities due to each base sampling a wide range of base contexts. This study is aimed at distinguishing between these two possibilities. Transparent films, prepared from palindromic oligodeoxynucleotides of d(CTCTCGAGAG), d(CTCTCGAGAGp), d(pCTCTCGAGAGp), d(GAGAGCTCTC), d(ACGCGCGCGT), d(AACGCGCGCGTT), d(CTCTCTTAATAATTATAATTATTAAGAGAG), and d(CTCTCTTAATATTAAGAGAG), were used for this investigation. The DNA films, hydrated to approximately 2.5 waters per nucleotide, were irradiated at RT under air using X-rays generated by a tungsten tube, immediately dissolved in nuclease-free water, and stored at 277 K for 24 h, and then unaltered free base release was measured using HPLC. Yields of free base release were based on a target mass consisting of the DNA and one counterion+2.5 H2O/nucleotide. The yields of each base, G(C), G(G), G(T), and G(A) were determined for each of the above sequences. The observed yields lead to the following conclusions: (i) base release at the oligomer ends is favored over release at internal positions (called the end effect), (ii) phosphorylation of the OH moiety at the oligomer ends quenches the end effect, (iii) the magnitude of the end effect is influenced by the base at the end and the bases proximal to it, and (iv) the release of base is influenced by the base and its context.

Mechanisms of strand break formation in DNA due to the direct effect of ionizing radiation: the dependency of free base release on the length of alternating CG oligodeoxynucleotides.

The question of how NA base sequence influences the yield of DNA strand breaks produced by the direct effect of ionizing radiation was investigated in a series of oligodeoxynucleotides of the form (d(CG)(n))(2) and (d(GC)(n))(2). The yields of free base release from X-irradiated DNA films containing 2.5 waters/nucleotide were measured by HPLC as a function of oligomer length. For (d(CG)(n))(2), the ratio of the Gua yield to Cyt yield, R, was relatively constant at 2.4-2.5 for n = 2-4 and it decreased to 1.2 as n increased from 5 to 10. When Gua was moved to the 5' end, for example going from d(CG)(5) to d(GC)(5), R dropped from 1.9 +/- 0.1 to 1.1 +/- 0.1. These effects are poorly described if the chemistry at the oligomer ends is assumed to be independent of the remainder of the oligomer. A mathematical model incorporating charge transfer through the base stack was derived to explain these effects. In addition, EPR was used to measure the yield of trapped-deoxyribose radicals at 4 K following X-irradiation at 4 K. The yield of free base release was substantially greater, by 50-100 nmol/J, than the yield of trapped-deoxyribose radicals. Therefore, a large fraction of free base release stems from a nonradical intermediate. For this intermediate, a deoxyribose carbocation formed by two one-electron oxidations is proposed. This reaction pathway requires that the hole (electron loss site) transfers through the base stack and, upon encountering a deoxyribose hole, oxidizes that site to form a deoxyribose carbocation. This reaction mechanism provides a consistent way of explaining both the absence of trapped radical intermediates and the unusual dependence of free base release on oligomer length.

Multiplicity of DNA single-strand breaks produced in pUC18 exposed to the direct effects of ionizing radiation.

The transition of plasmid DNA from a supercoiled to an open circle conformation, as detected by gel electrophoresis, affords an extraordinarily sensitive method for detecting single-strand breaks (SSBs), one measure of deoxyribose damage. To determine the yield of SSBs, G(ssb), by this method, it is commonly assumed that Poisson statistics apply such that, on average, one SSB occurs per supercoiled plasmid lost. For the direct effect, at a large enough plasmid size, this assumption may be invalid. In this report, the assumption that one SSB occurs per pUC18 plasmid (2686 bp) is tested by measuring free base release (fbr), which is also a measure of deoxyribose damage in films prepared under controlled relative humidity so as to produce known levels of DNA hydration. The level of DNA hydration, Gamma, is expressed in mol water/mol nucleotide. The yield of free base release, G(fbr), was measured by HPLC after exposure of the films to 70 kV X rays and subsequent dissolution in water. It is well known that damage in deoxyribose leads to SSBs and free base release. Based on known mechanisms, there exists a close correspondence between free base release and SSBs, i.e., G(fbr) congruent with G(ssb). Following this assumption, the SSB multiplicity, m(ssb), was determined, where m(ssb) was defined as the mean number of SSBs per supercoiled plasmid lost. The yield of lost supercoil was determined previously (S. Purkayastha et al., J. Phys. Chem. B 110, 26286-26291, 2006). We found that m(ssb) = 1.4 +/- 0.2 at Gamma = 2.5 and m(ssb) = 2.8 +/- 0.5 to 3.1 +/- 0.5 at Gamma = 22.5, indicating that the assumption of one SSB per lost supercoil is not likely to hold for a 2686-bp plasmid exposed to the direct effect. In addition, an increase in G(fbr), upon stepping from Gamma = 2.5 to Gamma = 22.5, was paralleled by an increase in the yield of trapped deoxyribose radicals, G(dRib)(fr), also measured previously. As a consequence, the shortfall between SSBs and trapped radicals, G(diff) = G(ssb) - G(dRib)(fr), remained relatively constant at 90-110 nmol/J. The lack of change between the two extremes of hydration is in keeping with the suggestion that non-radical species, such as doubly oxidized deoxyribose, are responsible for the shortfall.

On the chemical yield of base lesions, strand breaks, and clustered damage generated in plasmid DNA by the direct effect of X rays.

The purpose of this study was to determine the yield of DNA base damages, deoxyribose damage, and clustered lesions due to the direct effects of ionizing radiation and to compare these with the yield of DNA trapped radicals measured previously in the same pUC18 plasmid. The plasmids were prepared as films hydrated in the range 2.5 < Gamma < 22.5 mol water/mol nucleotide. Single-strand breaks (SSBs) and double-strand breaks (DSBs) were detected by agarose gel electrophoresis. Specific types of base lesions were converted into SSBs and DSBs using the base-excision repair enzymes endonuclease III (Nth) and formamidopyrimidine-DNA glycosylase (Fpg). The yield of base damage detected by this method displayed a strikingly different dependence on the level of hydration (Gamma) compared with that for the yield of DNA trapped radicals; the former decreased by 3.2 times as Gamma was varied from 2.5 to 22.5 and the later increased by 2.4 times over the same range. To explain this divergence, we propose that SSB yields produced in plasmid DNA by the direct effect cannot be analyzed properly with a Poisson process that assumes an average of one strand break per plasmid and neglects the possibility of a single track producing multiple SSBs within a plasmid. The yields of DSBs, on the other hand, are consistent with changes in free radical trapping as a function of hydration. Consequently, the composition of these clusters could be quantified. Deoxyribose damage on each of the two opposing strands occurs with a yield of 3.5 +/- 0.5 nmol/J for fully hydrated pUC18, comparable to the yield of 4.1 +/- 0.9 nmol/J for DSBs derived from opposed damages in which at least one of the sites is a damaged base.

Mechanisms of direct radiation damage in DNA, based on a study of the yields of base damage, deoxyribose damage, and trapped radicals in d(GCACGCGTGC)(2).

Dose-response curves were measured for the formation of direct-type DNA products in X-irradiated d(GCACGCGTGC)(2)prepared as dry films and as crystalline powders. Damage to deoxyribose (dRib) was assessed by HPLC measurements of strand break products containing 3' or 5' terminal phosphate and free base release. Base damage was measured using GC/ MS after acid hydrolysis and trimethylsilylation. The yield of trappable radicals was measured at 4 K by EPR of films X-irradiated at 4 K. With exception of those used for EPR, all samples were X-irradiated at room temperature. There was no measurable difference between working under oxygen or under nitrogen. The chemical yields (in units of nmol/J) for trapped radicals, free base release, 8-oxoGua, 8-oxoAde, diHUra and diHThy were G(total)(fr) = 618 +/- 60, G(fbr) = 93 +/- 8, G(8-oxoGua) = 111 +/- 62, G(8-oxoAde) = 4 +/- 3, G(diHUra) = 127 +/- 160, and G(diHThy) = 39 +/- 60, respectively. The yields were determined and the dose-response curves explained by a mechanistic model consisting of three reaction pathways: (1) trappable-radical single-track, (2) trappable-radical multiple-track, and (3) molecular. If the base content is projected from the decamer's GC:AT ratio of 4:1 to a ratio of 1:1, the percentage of the total measured damage (349 nmol/J) would partition as follows: 20 +/- 16% 8-oxoGua, 3 +/- 3% 8-oxoAde, 28 +/- 46% diHThy, 23 +/- 32% diHUra, and 27 +/- 17% dRib damage. With a cautionary note regarding large standard deviations, the projected yield of total damage is higher in CG-rich DNA because C combined with G is more prone to damage than A combined with T, the ratio of base damage to deoxyribose damage is approximately 3:1, the yield of diHUra is comparable to the yield of diHThy, and the yield of 8-oxoAde is not negligible. While the quantity and quality of the data fall short of proving the hypothesized model, the model provides an explanation for the dose-response curves of the more prevalent end products and provides a means of measuring their chemical yields, i.e., their rate of formation at zero dose. Therefore, we believe that this comprehensive analytical approach, combined with the mechanistic model, will prove important in predicting risk due to exposure to low doses and low dose rates of ionizing radiation.

Unaltered free base release from d(CGCGCG)2 produced by the direct effect of ionizing radiation at 4 K and room temperature.

Unaltered free base release in d(CGCGCG)2 exposed to X rays at 4 K or room temperature was measured by HPLC. Samples were prepared either as films hydrated to a level of Gamma = 2.5 mol water/mol nucleotide or as polycrystalline with Gamma approximately 7.5 mol water/mol nucleotide. X irradiation of films at 4 K, followed by annealing to room temperature, resulted in yields for cytosine and guanine of G(Cyt) = 0.036 +/- 0.001 micromol/J and G(Gua) = 0.090 +/- 0.002 micromol/J. Irradiation of films at room temperature gave similar yields. The yields for polycrystalline d(CGCGCG)2 X-irradiated at room temperature were G(Cyt) = 0.035 +/- 0.005 micromol/J and G(Gua) = 0.077 +/- 0.023 micromol/J. The total free base release yield, G(fbr), was 0.124 +/- 0.008 micromol/J for films and 0.112 +/- 0.028 micromol/J for polycrystalline samples. G(fbr) is believed to be a good estimate of total strand break yield. The yields of total free radicals trapped [G(Sigmafr)] by the d(CGCGCG)2 films at 4 K were measured by EPR. The measured value, G(Sigmafr) = 0.450 +/- 0.005 micromol/J, was used to calculate the yield of trappable sugar radicals, giving G(sugar)(fr) = 0.04-0.07 micromol/J. We found that (1) guanine release exceeded cytosine release by more than twofold, (2) G(sugar)(fr) cannot account for more than half of the free base release, and (3) G(fbr), G(Cyt) and G(Gua) were independent of the sample temperature during irradiation. Finding (1) suggests that base and or sequence influences sugar damage, and finding (2) is consistent with our working hypothesis that an important pathway to strand break formation entails two one-electron oxidations at the same sugar site.

Which DNA damage is likely to be relevant in hormetic responses?

Working under the assumption that hormesis is triggered by specific types of DNA damage, this report focuses on the types of damage which form the signature of ionizing radiation. The key attribute of the signature is the clustering of damage, arising from clusters of energy deposition such that more than one site within a 10 base pair segment of DNA has been chemically altered. A brief overview is given on what is currently believed to be the primary components of clustered damage produced by the direct effect. The overview draws primarily on studies that utilize electron paramagnetic resonance to measure free radical intermediates and gel electrophoresis to measure clustered damage in plasmid DNA. Based on this information, the threshold for a radiation induced biological response is calculated.

An investigation into the mechanisms of DNA strand breakage by direct ionization of variably hydrated plasmid DNA.

The mechanisms by which ionizing radiation directly causes strand breaks in DNA were investigated by comparing the chemical yield of DNA-trapped free radicals to the chemical yield of DNA single strand break (ssb) and double strand break (dsb), as a function of hydration (Gamma). Solid-state films of plasmid pUC18, hydrated to 2.5 < Gamma < 22.5 mol, were X-irradiated at 4 K, warmed to room temperature, and dissolved in water. Free radical yields were determined by EPR at 4 K. With use of the same samples, Gel electrophoresis was used to measure the chemical yield of total strand breaks, which includes prompt plus heat labile ssb; G'total(ssb) decreased from 0.092 +/- 0.016 micromol/J at Gamma= 2.5 to 0.066 +/- 0.008 micromol/J at Gamma= 22.5. Most provocative is that at Gamma= 2.5 the yield of total ssb exceeds the yield of trapped deoxyribose radicals: G'total(ssb) - G'sugar(fr) = 0.06 +/- 0.02 micromol/J. Nearly 2/3 of the strand breaks are derived from precursors other than radicals trapped on the deoxyribose moiety. To account for these nonradical precursors, we hypothesize that strand breaks are produced by two one-electron oxidations at a single deoxyribose residue within an ionization cluster.

The role of hydration in the distribution of free radical trapping in directly ionized DNA.

The purpose of this study was to elucidate the role of hydration (Gamma) in the distribution of free radical trapping in directly ionized DNA. Solid-state films of pUC18 (2686 bp) plasmids were hydrated to Gamma in the range 2.5 < or = Gamma < or = 22.5 mol water/mol nucleotide. Free radical yields, G(Sigmafr), measured by EPR at 4 K are seen to increase from 0.28 +/- 0.01 micromol/J at Gamma = 2.5 to 0.63 +/- 0.01 micromol/J at Gamma= 22.5, respectively. Based on a semi-empirical model of the free radical trapping events that follow the initial ionizations of the DNA components, we conclude that two-thirds of the holes formed on the inner solvation shell (Gamma < 10) transfer to the sugar-phosphate backbone. Likewise, of the holes produced by direct ionization of the sugar-phosphate, about one-third are trapped by deprotonation as neutral sugar-phosphate radical species, while the remaining two-thirds are found to transfer to the bases. This analysis provides the best measure to date for the probability of hole transfer (approximately 67%) into the base stack. It can thus be predicted that the distribution of holes formed in fully hydrated DNA at 4 K will be 78% on the bases and 22% on the sugar-phosphate. Adding the radicals due to electron attachment (confined to the pyrimidine bases), the distribution of all trapped radicals will be 89% on the bases and 11% on the sugar-phosphate backbone. This prediction is supported by partitioning results obtained from the high dose-response curves fitted to the two-component model. These results not only add to our understanding of how the holes redistribute after ionization but are also central to predicting the yield and location of strand breaks in DNA exposed to the direct effects of ionizing radiation.