Dissecting the extended "-10" Escherichia coli rpsB promoter activity and regulation in vivo.

As we have shown previously, transcription of the rpsB-tsf operon encoding essential components of the translation machinery, a ribosomal protein S2 and an elongation factor Ts, is driven by a single promoter PrpsB, which is highly conserved among γ-proteobacteria. PrpsB belongs to the extended "-10" promoter class; it comprises a TGTG-extension upstream of the "-10" hexamer TATAAA, a suboptimal "-35" region TTGGTG, and a GC-rich discriminator GCGCGC that separates the "-10" element from the transcription start site. In this work, we examined an impact of site-directed mutations in the rpsB promoter region on expression of the reporter gene PrpsB-lacZ within the E. coli chromosome as well as promoter regulation by transcription factors ppGpp and DksA upon amino acid starvation. The results show that the transcription level largely depends on both the TGTG-extension and the TTG-element in the "-35" region, as mutations in these sequences dramatically decrease the activity of the promoter. Upon induction of amino acid starvation, the rpsB promoter is negatively regulated by ppGpp due to the presence of the GC-rich discriminator, whose substitution for the AT-rich element abolished stringent control. These and other data obtained demonstrate the necessity of a natural combination of all the conserved promoter elements for efficient and regulated transcription of the essential rpsB-tsf operon.

[Extraribosomal functions of bacterial ribosomal proteins].

Though their primary role in a cell is to serve as integral components of protein synthesis machinery, the ribosome, many of them have functions beyond the ribosome (the phenomenon known as moonlighting), acting either as individual regulatory proteins or in complexes with other cellular components. Extraribosomal activities of some ribosomal proteins have been observed as early as in the 1970-1980s. During the last years both a list of r-proteins-moonlighters and the repertoire of their additional functions beyond the ribosome have been greatly expanded, mainly due to newly developed techniques for dissecting RNA/DNA-protein or protein-protein interactions within functional complexes involved in various cellular processes. In this review, we surveyed information on the experimentally proven as well as on presumptive extraribosomal functions which may be performed by bacterial r-proteins in a cell.

[Conservation of the regulatory elements implicated in the control of the rpsB-tsf operon expression in gamma-proteobacteria].

In eubacteria, the rpsB-tsf operon encodes two essential components of translational apparatus, ribosomal protein (r-protein) S2 and elongation factor Ts. Recently, we located the promoter region of the Escherichia coli rpsB-tsf operon and demonstrated that both rpsB and tsf genes are negatively regulated by r-protein S2 at the translational level. In this paper, we present data of phylogenetic analysis showing high conservation of both the promoter signature and the structure of the 5'-untranslated region (5'-UTR) of the rpsB mRNA in gamma-proteobacteria. Despite the difference in length and overall primary structure of the rpsB 5'-UTRs for various representatives of this bacterial phylum, several short regions within the 5'-UTRs appeared to be universally conserved, implying their participation in the expression regulation. Phylogenetic predictions have been experimentally confirmed. We show here that the presumable rpsB promoter regions from Yersinia pestis, Haemophilus influenzae and Pseudomonas aeruginosa are able to drive transcription of the lacZ -reporter in E. coli and that the corresponding rpsB 5'-UTRs are subjected to autogenous repression by r-protein S2 in vivo.

[Diverse molecular mechanisms for translation initiation in prokaryotes].

Classical model of prokaryotic translation initiation based on the central role of interactions between mRNA and 16S rRNA was proposed more than 30 years ago by Shine and Dalgarno. Since then, due to the rapid progress in genome sequencing and to novel technical approaches, basic researches have substantially enriched our knowledge on the problem. The present review focuses on the bioinformatic data as well as on experimental results obtained in vivo and in vitro, which show the diversity of molecular mechanisms for ribosome recruitment in prokaryotes.

[An Escherichia coli strain producing a leaderless mRNA from the chromosomal lac promoter].

A special Escherichia coli strain capable of producing a leaderless lacZ mRNA from the chromosomal lac promoter was constructed to study the mechanism of leaderless mRNA translation. The translation efficiency of this noncanonical mRNA is very low in comparison with the canonical cellular templates, but it increases by one order of magnitude in the presence of chromosomal mutations in the genes encoding the ribosomal S1 and S2 proteins. The new strain possesses obvious advantages over the commonly used plasmid constructs (first of all, due to the constant dosage of lacZ gene in the cell) and opens possibilities for investigation of the specific conditions for leaderless mRNA translation in vivo using molecular genetic approaches.

[Extensive complementarity of the Shine-Dalgarno region and 3'-terminal sequence of 16S ribosomal RNA is inefficient for translation in vivo]. / Izbytochnaia komplementarnost' oblasti Shaina-Dal'garno i 3'-kontsevogo uchastka 16S ribosomnoi RNK neéffektivna pri transliatsii in vivo.

Translation initiation in Escherichia coli involves as a rule complementary interactions between a Shine-Dalgarno (SD) sequence upstream of the initiation codon and a highly conserved 3'-end sequence of 16S rRNA (anti-SD). The translation efficiency is believed to be directly affected by the affinity of the ribosome to the mRNA initiation region. Earlier, high-affinity RNA ligands to E. coli ribosomes were selected by the SELEX approach, with the ligands containing an extended SD-sequence well represented. In this work, we examined the ability of artificial ribosome binding sites (RBSs) containing such an extended (10-nt) SD-sequence (superSD) to drive translation in vivo, as well as its ability to form the translation initiation complex in vitro. Toe print experiments showed the formation of a ternary initiation complex on mRNA comprising superSD. Moreover, they proved the formation of an extended SD-duplex in the binary 30S-mRNA complex. Nevertheless, the superSD appeared to be inefficient in translation in vivo. We believe that the initiation complex involving a superSD-element is too stable to be functional; it may impede the transition from initiation to elongation, thus disrupting the transcription-translation coupling and inhibiting the formation of polysomes.

Non-canonical mechanism for translational control in bacteria: synthesis of ribosomal protein S1.

Translation initiation region (TIR) of the rpsA mRNA encoding ribosomal protein S1 is one of the most efficient in Escherichia coli despite the absence of a canonical Shine-Dalgarno-element. Its high efficiency is under strong negative autogenous control, a puzzling phenomenon as S1 has no strict sequence specificity. To define sequence and structural elements responsible for translational efficiency and autoregulation of the rpsA mRNA, a series of rpsA'-'lacZ chromosomal fusions bearing various mutations in the rpsA TIR was created and tested for beta-galactosidase activity in the absence and presence of excess S1. These in vivo results, as well as data obtained by in vitro techniques and phylogenetic comparison, allow us to propose a model for the structural and functional organization of the rpsA TIR specific for proteobacteria related to E.coli. According to the model, the high efficiency of translation initiation is provided by a specific fold of the rpsA leader forming a non-contiguous ribosome entry site, which is destroyed upon binding of free S1 when it acts as an autogenous repressor.

The last RNA-binding repeat of the Escherichia coli ribosomal protein S1 is specifically involved in autogenous control.

The ssyF29 mutation, originally selected as an extragenic suppressor of a protein export defect, has been mapped within the rpsA gene encoding ribosomal protein S1. Here, we examine the nature of this mutation and its effect on translation. Sequencing of the rpsA gene from the ssyF mutant has revealed that, due to an IS10R insertion, its product lacks the last 92 residues of the wild-type S1 protein corresponding to one of the four homologous repeats of the RNA-binding domain. To investigate how this truncation affects translation, we have created two series of Escherichia coli strains (rpsA(+) and ssyF) bearing various translation initiation regions (TIRs) fused to the chromosomal lacZ gene. Using a beta-galactosidase assay, we show that none of these TIRs differ in activity between ssyF and rpsA(+) cells, except for the rpsA TIR: the latter is stimulated threefold in ssyF cells, provided it retains at least ca. 90 nucleotides upstream of the start codon. Similarly, the activity of this TIR can be severely repressed in trans by excess S1, again provided it retains the same minimal upstream sequence. Thus, the ssyF stimulation requires the presence of the rpsA translational autogenous operator. As an interpretation, we propose that the ssyF mutation relieves the residual repression caused by normal supply of S1 (i.e., that it impairs autogenous control). Thus, the C-terminal repeat of the S1 RNA-binding domain appears to be required for autoregulation, but not for overall mRNA recognition.

[Regulation of synthesis of ribosomal protein L7-L12: role of intercistronic rplJL region as an enhancer of translation]. / Reguliatsiia sinteza ribosomnogo belka L7/12: rol' mezhtsistronnoi oblasti rplJL kak usilitelia transliatsii.

The ability of the Escherichia coli intercistronic rplJL region to initiate effectively the synthesis of the ribosomal protein L7/12, the only ribosomal component present in the ribosome in four copies rather than in one was studied in vivo and in vitro. It was shown that the structural determinants located upstream from the Shine-Dalgarno sequence and sharing structural motifs with the known E. coli translational enhancers are necessary for high activity of this region in translation initiation. These data indicate that mRNA-protein interactions through the ribosomal S1 protein play an important role in the formation of the initiation complex, and an enhancer region within the leader of the L7/12 mRNA serves as a target for this protein.

RNA folding kinetics regulates translation of phage MS2 maturation gene.

The gene for the maturation protein of the single-stranded RNA coliphage MS2 is preceded by an untranslated leader of 130 nt, which folds into a cloverleaf, i.e., three stem-loop structures enclosed by a long distance interaction (LDI). This LDI prevents translation because its 3' moiety contains the Shine-Dalgarno sequence of the maturation gene. Previously, several observations suggested that folding of the cloverleaf is kinetically delayed, providing a time window for ribosomes to access the RNA. Here we present direct evidence for this model. In vitro experiments show that ribosome binding to the maturation gene is faster than refolding of the denatured cloverleaf. This folding delay appears related to special properties of the leader sequence. We have replaced the three stem-loop structures by a single five nt loop. This change does not affect the equilibrium structure of the LDI. Nevertheless, in this construct, the folding delay has virtually disappeared, suggesting that now the RNA folds faster than ribosomes can bind. Perturbation of the cloverleaf by an insertion makes the maturation start permanently accessible. A pseudorevertant that evolved from an infectious clone carrying the insertion had overcome this defect. It showed a wild-type folding delay before closing down the maturation gene. This experiment reveals the biological significance of retarded cloverleaf formation.

[Mutation ssF29 in the gene for E. coli ribosomal protein S1, suppressing a defect in transmembrane protein transport results from insertion of the IS10R element]. / Mutatsiia ssyF29 v gene ribosomnogo belka S1 E. coli, supressiruiushchaia defekt transporta belkov cherez membranu, obuslovlena vstraivaniem IS10R-élementa.

The nature of the ssyF29 mutation causing the synthesis of a truncated form of the ribosomal protein S1 and its location in the rpsA gene were determined. The ssyF mutation was found to result from insertion of the IS10(R) element which causes the termination of translation of the corresponding mRNA at the first insertion nucleotide and the production of the S1 protein which is truncated at the C-terminus and composed of 464 amino acid residues (instead of 557 residues in the wild-type protein). The mutant rpsA gene (ssyF) encodes no additional amino acid residues as compared with the wild-type rpsA gene.

A high-level prokaryotic expression system: synthesis of human interleukin 1 alpha and its receptor antagonist.

Synthetic intronless genes, coding for human interleukin 1 alpha (IL 1 alpha) and interleukin 1 receptor antagonist (IL1ra), have been expressed efficiently in a specially designed prokaryotic vector, pGMCE (a pGEM1 derivative), where the target gene forms the second part of a two-cistron system. The first part of the system is a translation enhancer-containing mini-cistron, whose termination codon overlaps the start codon of the target gene. In the case of the IL1 alpha gene, the high expression level is largely due to the direct efficient translation initiation at the second cistron, whereas with the IL1ra gene in the same system, the proximal translation initiation region (TIR) provides a high level of coupled expression of the target gene. Thus, pGMCE is a potentially versatile vector for direct prokaryotic expression.

Ribosome-messenger recognition in the absence of the Shine-Dalgarno interactions.

In an attempt to understand how Escherichia coli ribosomes recognize the initiator codon on mRNAs lacking the Shine-Dalgarno (SD) sequence, we have studied 30S initiation complex formation in extension inhibition (toeprinting) experiments using (-SD)mRNAs which are known to be reliably translated in E. coli: the plant viral messenger A1MV RNA 4 and two chimaeric mRNAs coding for beta-glucuronidase (GUS) and bearing the 5'-untranslated sequence of TMV RNA (omega) or the omega-derived sequence (CAA)n as 5'-leaders. Ribosomal protein S1 and IF3 have been found to be indispensable for translational initiation. Protein S1 appears to be a key recognition element. S1 binds to sequences within the leaders of (-SD)mRNAs thus providing their affinity to E. coli ribosomes.

[Analysis of the secondary structure of the regulatory region of mRNA of the Escherichia coli rpsA gene]. / Analiz vtorichnoi struktury reguliatornoi oblasti mRNK gena rpsA Escherichia coli.

The rpsA gene of E. coli coding for the ribosomal protein S1 was inserted into the plasmid pGEM-3Z under the control of a T7 promoter. The resulted plasmid was used for mRNA preparation in vitro. The toeprint analysis of the rpsA mRNA revealed a strong S1 dependence: 30S ribosomal subunits lacking S1 were inactive in the 30S initiation complex formation; addition of the free S1 restored subunits' ability to bind mRNA; a molar excess of the free S1 over ribosomes was inhibitory. The secondary structure of the rpsA mRNA in the vicinity of the initiation codon was probed with the use of specific ribonucleases. Basing on the experimental data obtained we suggest a model for the structural organisation of the rpsA mRNA translation initiation region.

Ribosome-messenger recognition: mRNA target sites for ribosomal protein S1.

Ribosomal protein S1 is known to play an important role in translational initiation, being directly involved in recognition and binding of mRNAs by 30S ribosomal particles. Using a specially developed procedure based on efficient crosslinking of S1 to mRNA induced by UV irradiation, we have identified S1 binding sites on several phage RNAs in preinitiation complexes. Targets for S1 on Q beta and fr RNAs are localized upstream from the coat protein gene and contain oligo(U)-sequences. In the case of Q beta RNA, this S1 binding site overlaps the S-site for Q beta replicase and the site for S1 binding within a binary complex. It is reasonable that similar U-rich sequences represent S1 binding sites on bacterial mRNAs. To test this idea we have used E. coli ssb mRNA prepared in vitro with the T7 promoter/RNA polymerase system. By the methods of toeprinting, enzymatic footprinting, and UV crosslinking we have shown that binding of the ssb mRNA to 30S ribosomes is S1-dependent. The oligo(U)-sequence preceding the SD domain was found to be the target for S1. We propose that S1 binding sites, represented by pyrimidine-rich sequences upstream from the SD region, serve as determinants involved in recognition of mRNA by the ribosome.

[Rare initiation codons are regulators of expression of the rpoC gene]. / Redkie initsiiruiushchie kodony-reguliatory ékspressii gena rpoC.

Translation of the rpoC genes in Escherichia coli and Salmonella typhimurium is known to start from the GUG codon. Now, using toeprint analysis we have shown UUG to be the initiation codon of the Pseudomonas putida rpoC gene. IF3 does not seem to proofread initiation at the UUG codon. The rpoC genes of P. putida, E. coli, and S. typhimurium, which use rare start codons, have strong SD-domains AGGAGG (P. p.) and GGGAG (E. c., S. t.), optimal seven-nucleotide spacing between SD and start codons, and good second codon AAA. We suggest that rpoC presents an infrequent case of the regulation of translation initiation by selecting the start codon.

[Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene]. / Ribosomnyi belok S1 v sostave kompleksa 30S ribosomnoi subchastitsy E. coli s RNK faga MS2 vzaimodeistvuet s vnutrennim raionom gena replikazy.

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.

Ribosomal protein S1 associates with Escherichia coli ribosomal 30-S subunit by means of protein-protein interactions.

Ribosomal proteins S1 when associated with the 30-S subunit does not interact with 16-S RNA but its binding is determined mostly by protein-protein interactions. These conclusions are based on the following data. 1. Ultraviolet irradiation (lambda = 254 nm) of the 30-S subunit does not result in the covalent cross-linking of S1 with 16-S RNA at irradiation doses up to 150 quanta/nucleotide, whereas the irradiation under the same conditions of S1 . polynucleotide complexes [S1 . poly(U), S1 . poly(A) and S1 . Q beta phage RNA] induces effective formation of polynucleotide-protein cross-links. 2. Mild treatment of 30-S subunits lacking S-1 with RNase A or with cobra venom endonuclease results in removal of 10--20% of the total nucleotide material but does not affect their sedimentation characteristics of their S1 binding capacity. 3. The association of S1 with S1-depleted 30-S subunits is insensitive to aurintricarboxylic acid, which is known as a strong inhibitor of complex formation between S1 and polynucleotides. 4. Mild trypsin treatment of S1-depleted 30-S subunits greatly reduces their S1 binding capacity.

Induced formation of covalent bonds between nucleoprotein components. V. UV or bisulfite induced polynucleotide-protein crosslinkage in bacteriophage MS2.

UV (lambda = 254 nm) irradiation of bacteriophage MS2 or its treatment with bisulfite induce covalent crosslinkage of the RNA to the coat protein. epilsonN-(2-oxopyrimidyl-4)-lysine was found in the phage hydrolysates after either type of treatment. An equimolar mixture of 0-methylhydroxylamine and bisulfite causes complete disappearance of the cross-links. This led to the conclusion that one of the factors responsible for the UV-induced polynucleotide-protein crosslinkage and the main factor in treatment with bisulfite is substitution of the exocyclic amino group of the activated cytosine nucleus by the lysine residue epilson-amino group of the protein.