First Report of Bacterial Leaf Streak of Barley (Hordeum vulgare) Caused by Xanthomonas translucens pv. translucens in British Columbia, Canada.

Bacterial leaf streak (BLS) of barley is caused by the Gram-negative bacterial pathogen Xanthomonas translucens (Sapkota et al. 2020). In 2021, we observed multiple hill plots with BLS symptomatic plants in a barley stripe rust nursery in Vancouver, BC, Canada. We collected 29 leaf samples showing typical BLS symptoms (e.g. necrotic lesions; Fig. S1) and stored at 4 oC until bacterial isolation. Samples were surface-sterilized in 10% NaOCl for 20 sec and rinsed twice. About 1 cm2 of leaf tissue containing BLS characteristic lesions was macerated in 200 µL sterile H2O on a petri dish, incubated for 15 min, and 10 µl of the homogenates was streaked onto Wilbrink's - Boric Acid - Cephalexin (WBC) agar medium. Plates were incubated at 28-30 oC for 48 hrs. Four single colonies were obtained: BC10-1-2a (USask BC10-2a), BC10-1-2b (USask BC10-2b), UBC026 and UBC028. Colonies were grown in WBC broth and gDNA was extracted using E.Z.N.A. Bacterial DNA Kit (Omega Bio-Tek) or DNeasy Plant Pro Kit® (Qiagen) following manufacturer protocols. Genus-level identification was achieved using 16S rRNA sequencing with 27F/1492R primers (Lane 1991) of UBC026 (1,399 bp; NCBI # OP327375) and UBC028 (1,415 bp; NCBI #OP327376). Complete 16S rRNA sequences (1,533bp) of BC10-2a and BC10-2b (1,533 bp) were extracted from the draft whole-genome sequences (WGS) generated in this study. The 16S rRNA sequence homology values of 99.0-100% were recorded between the 4 strains. BLAST analyses of the 16S rRNA sequences to GenBank entries exhibited 99.5-100% similarity values (100% coverage) with the pathotype strains of Xtt DSM 18974T (LT604072) and X. translucens pv. undulosa (Xtu) CFBP 2055 (CP074361). Whole genomes of BC10-2a (JANUQY01) and BC10-2b (JANUQZ01) were sequenced (150-bp; reads 33.1 million; mean coverage 2125x) using NovaSeq Illumina, assembled (Unicycler v0.4.8; Wick et al. 2017) and analyzed to identify the strains to the species-level (Tambong et al. 2021). WGS of strains USask BC10-2a and USask BC10-2b exhibited genome-based DNA-DNA hybridization (dDDH; Meier-Kolthoff et al. 2013) and BLAST-based average nucleotide identity (ANIb; Richter et al. 2015) of 100%. The two strains also showed dDDH and ANIb of 90.4% (species-leel cut-off of 70%) and 98.780% and 98.80% (cut-off of 96%), respectively, with Xtt DSM 18974T (LT604072). In contrast, the WGS of BC10-2a and BC10-2b exhibited only 78.2% dDDH homology values with Xtu CFBP 2055T, suggesting that the strains are genetically more similar to Xtt. The assignment of these strains to Xtt is corroborated by phylogenomic analysis (Fig. S2; Meier-Kolthoff and Göker 2019) that showed the two strains clustering together (100% bootstrap) with the type strain DSM 18974T. These data suggest that these strains are taxonomically members of Xtt. Identification was also confirmed to the genus-level by LAMP assay using published X. translucens primers (Langlois et al. 2017). Pathovar-level identification was confirmed using a cbsA and S8.pep multiplex PCR diagnostic assay (Roman-Reyna et al. 2022). Koch's postulates were verified by greenhouse inoculation via leaf infiltration of UBC026 and UBC028 on 21-day old barley plants (line HB522) using an inoculum of 108 CFU ml-1 followed by re-isolation of the bacteria on WBC. The inoculated plants showed typical BLS symptoms similar to those observed in the field (Fig. S1). Water-inoculated plants had no symptoms. To our knowledge, this is the first published report of BLS of barley in British Columbia.

First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

Development of Genome-Driven, Lifestyle-Informed Markers for Identification of the Cereal-Infecting Pathogens Xanthomonas translucens Pathovars undulosa and translucens.

Bacterial leaf streak, bacterial blight, and black chaff caused by Xanthomonas translucens pathovars are major diseases affecting small grains. Xanthomonas translucens pv. translucens and X. translucens pv. undulosa are seedborne pathogens that cause similar symptoms on barley, but only X. translucens pv. undulosa causes bacterial leaf streak of wheat. Recent outbreaks of X. translucens have been a concern for wheat and barley growers in the Northern Great Plains; however, there are limited diagnostic tools for pathovar differentiation. We developed a multiplex PCR based on whole-genome differences to distinguish X. translucens pv. translucens and X. translucens pv. undulosa. We validated the primers across different Xanthomonas and non-Xanthomonas strains. To our knowledge, this is the first multiplex PCR to distinguish X. translucens pv. translucens and X. translucens pv. undulosa. These molecular tools will support disease management strategies enabling detection and pathovar incidence analysis of X. translucens. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

First report of Uromyces rumicis on Rumex crispus in Canada.

Rumex crispus L. (curled dock) is a noxious weed in both grasslands (mainly pastures) and arable lands, but is also an early colonizer of many disturbed areas in lowland and upland regions. Rumex crispus is of agricultural significance because it competes with sown or native pasture and crops species and occupies areas that could be utilized by more palatable crop species. Rumex crispus can grow on almost all soil types but less often on peat and acidic soils. The range of altitude to which the species has become adapted varies from sea level to 3,500 m (Zaller 2004). This plant species has Eurasian origin and is widely distributed through temperate regions of North America as an introduced species. There is no previous rust report on R. crispus in Canada. On other Rumex species two Puccinia species viz. Puccinia acetosae (Schumach.) Körn., and P. ornata Arthur & Holw., have been previously reported from Canada (Farr & Rossman 2022). During the recent field survey from southern British Columbia, Langley, heavily rust infected leaves of R. crispus were observed. Uredinia and telia were present on both sides of the leaf mainly on the lower side. Uredinia early exposed, brown, and pulverulent. Urediniospores were obovoid, ellipsoid or oblong, measuring 20-28 × 17-23 µm. Urediniospore walls are yellowish brown to brown, 1.5-2 µm thick; covered in evenly distributed echinulae, spaced 2 to 3 µm apart, with smooth (non-echinulate) patches at the equator of the urediniospores. Urediniospores with 2- (mostly 3 and less often 2) germ pores, usually supraequatorial (at the upper part of the spore), or distributed irregularly (scattered), or 2 germ pores supraequatorial, one equatorial or all germ pores equatorial, germ pores covered with flat papilla. Telia similar to the uredinia, dark brown. Teliospores more or less globoid, ellipsoid, broadly ellipsoid, obovoid or oblong, 25--36 × 15-23 µm, brownish yellow to brown, smooth, 2-3 um thick, with apical or sup-apical germ pore, covered with a hemispherical, yellowish papilla, pedicels colorless, short. The above-mentioned characters fit Majewski's (1977) description for Uromyces rumicis (Schumach.) G. Winter. To confirm identity, the first 903 bp of the 5' end of the 28S rDNA of the above specimen was amplified following protocols of Aime (2006) and Aime et al. (2018) (GenBank accession no. ON166844). BLAST queries of the sequence shared 99.56% identity (900/903) with U. rumicis (GenBank accession no. KY764197). To our knowledge this is the first report of U. rumicis from Canada (Farr and Rossma 2022). There is only one previous published report of this rust species in North America made by French (1989) who reported U. rumicis on R. crispus from California. Uromyces rumicis is quite common on Rumex species including R. crispus in Eurasia and has also been reported on this host from Africa (Farr and Rossman 2022). It appears that the above rust fungus species may have been introduced to the North America by accompanying its host plant. A voucher specimen of infected R. crispus with U. rumicis was deposited at Arthur Fungarium (PUR) under the accession number PUR N24014. Uromyces rumicis is a heteromacrocyclic rust with aecial state on Ranunculaceae members especially Ranunculus ficaria L. This species is another introduced plant in North America. However, there is no report of the aecial state of this rust in North America to date. Existence of only two reports of U. rumicis in California and British Columbia, making it likely that U. rumicis became established in the West Coast of North America probably no earlier than the second half of the 20th century.

Genetic factors affecting Fusarium head blight resistance improvement from introgression of exotic Sumai 3 alleles (including Fhb1, Fhb2, and Fhb5) in hard red spring wheat.

BACKGROUND: Fusarium head blight resistance genes, Fhb1 (for Type-II resistance), Fhb2 (Type-II), and Fhb5 (Type-I plus some Type-II), which originate from Sumai 3, are among the most important that confer resistance in hexaploid wheat. Near-isogenic lines (NILs), in the CDC Alsask (susceptible; n = 32) and CDC Go (moderately susceptible; n = 38) backgrounds, carrying these genes in all possible combinations were developed using flanking microsatellite markers and evaluated for their response to FHB and deoxynivalenol (DON) accumulation in eight environments. NILs were haplotyped with wheat 90 K iSelect assay to elucidate the genomic composition and confirm alleles' presence. Other than evaluating the effects of three major genes in common genetic background, the study elucidated the epistatic gene interactions as they influence FHB measurements; identified loci other than Fhb1, Fhb2, and Fhb5, in both recurrent and donor parents and examined annotated proteins in gene intervals. RESULTS: Genotyping using 81,857 single nucleotide polymorphism (SNP) markers revealed polymorphism on all chromosomes and that the NILs carried < 3% of alleles from the resistant donor. Significant improvement in field resistance (Type-I + Type-II) resulted only among the CDC Alsask NILs, not the CDC Go NILs. The phenotypic response of NILs carrying combinations of Sumai 3 derived genes suggested non-additive responses and Fhb5 was as good as Fhb1 in conferring field resistance in both populations. In addition to Fhb1, Fhb2, and Fhb5, four to five resistance improving alleles in both populations were identified and three of five in CDC Go were contributed by the susceptible parent. The introgressed chromosome regions carried genes encoding disease resistance proteins, protein kinases, nucleotide-binding and leucine rich repeats' domains. Complex epistatic gene-gene interactions among marker loci (including Fhb1, Fhb2, Fhb5) explained > 20% of the phenotypic variation in FHB measurements. CONCLUSIONS: Immediate Sumai 3 derivatives carry a number of resistance improving minor effect alleles, other than Fhb1, Fhb2, Fhb5. Results verified that marker-assisted selection is possible for the introgression of exotic FHB resistance genes, however, the genetic background of the recipient line and epistatic interactions can have a strong influence on expression and penetrance of any given gene.