First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Pathogenicity Traits Correlate With the Susceptible Vitis vinifera Leaf Physiology Transition in the Biotroph Fungus Erysiphe necator: An Adaptation to Plant Ontogenic Resistance.

How and when the pathogen cycle is disrupted during plant development is crucial for harnessing ontogenic resistance in sustainable agriculture. Ontogenic resistance against powdery mildew (Erysiphe necator) was quantified on Vitis vinifera. Shoots were sampled in the vineyard at several dates during seasonal growth and processed in the laboratory under controlled conditions. Experiments were conducted on two susceptible Vitis vinifera Cabernet Sauvignon and Merlot. The process of leaf ontogenic resistance was investigated by measuring three quantitative traits of pathogenicity: the infection efficiency, sporulation and mycelium growth. Morphological and physiological plant indicators were used to identify leaf changes that resulted in ontogenic resistance and to predict pathogen variations that were linked to pathogenicity traits. The process of ontogenic resistance was established early in correspondence with the physiological transition of the leaf from sink to source status and was characterized by its increase in sugar content. The three traits of pathogenicity that we measured were affected, and their variation was strongly correlated with leaf age. Using leaf age, we were able to accurately predict the susceptibility of the leaf: a leaf aged, on average, 13.3 days had a very high probability (0.8) of being susceptible, while this probability decreased to 0.5 one week later. Sporulation was more closely correlated with variations in sugar and the infection efficiency in leaf water. The results for both cultivars were consistent. Ontogenic resistance on grapevine leaves is thus interpreted to be a strong, immutable physiological process that E. necator is able to circumvent by restricting its development to sink tissue. Future research should explore how this native plant resistance can be incorporated into grape management strategies to better control powdery mildew (PM) epidemics with reduced amounts of fungicides.

Evaluation of a decision support strategy for the control of powdery mildew, Erysiphe necator (Schw.) Burr., in grapevine in the central region of Chile.

BACKGROUND: The primary strategy to control powdery mildew in Chilean vineyards involves periodic fungicide spraying, which may lead to many environmental and human health risks. This study aimed to implement and evaluate the effectiveness and economic feasibility of a novel decision support strategy (DSS) to limit the number of treatments against this pathogen. An experiment was conducted between the 2010 and 2013 seasons in two irrigated vine fields, one containing a cultivar of Cabernet Sauvignon (CS) and the other a cultivar of Chardonnay (CH). RESULTS: The results showed that the DSS effectively controlled powdery mildew in CS and CH vine fields, as evidenced by a disease severity lower than 3%, which was lower than that observed in untreated vines (approximately 10 and 40% for CS and CH respectively). The DS strategy required the application of only 2-3 fungicide treatments per season in key vine phenological stages, and the cost fluctuated between $US 322 and 415 ha-1 , which was 40-60% cheaper than the traditional strategy employed by vine growers. CONCLUSION: The decision support strategy evaluated in this trial allows a good control of powdery mildew for various types of epidemic with an early and late initiation. © 2017 Society of Chemical Industry.

Switching from a mechanistic model to a continuous model to study at different scales the effect of vine growth on the dynamic of a powdery mildew epidemic.

BACKGROUND AND AIMS: Epidemiological simulation models coupling plant growth with the dispersal and disease dynamics of an airborne plant pathogen were devised for a better understanding of host-pathogen dynamic interactions and of the capacity of grapevine development to modify the progress of powdery mildew epidemics. METHODS: The first model is a complex discrete mechanistic model (M-model) that explicitly incorporates the dynamics of host growth and the development and dispersion of the pathogen at the vine stock scale. The second model is a simpler ordinary differential equations (ODEs) compartmental SEIRT model (C-model) handling host growth (foliar surface) and the ontogenic resistance of the leaves. With the M-model various levels of vine development are simulated under three contrasting climatic scenarios and the relationship between host and disease variables are examined at key periods in the epidemic process. The ability of the C-model to retrieve the main dynamics of the disease for a range of vine growth given by the M-model is investigated. KEY RESULTS: The M-model strengthens experimental results observed regarding the effect of the rate of leaf emergence and of the number of leaves at flowering on the severity of the disease. However, it also underlines strong variations of the dynamics of disease depending on the vigour and indirectly on the climatic scenarios. The C-model could be calibrated by using the M-model provided that different parameters before and after shoot topping and for various vigour levels and inoculation time are used. Biologically relevant estimations of the parameters that could be used for its extension to the vineyard scale are obtained. CONCLUSIONS: The M-model is able to generate a wide range of growth scenarios with a strong impact on disease evolution. The C-model is a promising tool to be used at a larger scale.

Efficacy of fungicides with various modes of action in controlling the early stages of an Erysiphe necator-induced epidemic.

BACKGROUND: Limiting the use of fungicides is due to become an important issue in managing Erysiphe necator (Schwein) Burrill infections in vineyards. The authors determined how three fungicides currently used by vine growers could be managed to control the early stages of an E. necator-induced epidemic. RESULTS: Leaf-disc bioassays and field experiments suggested that the protectant quinoxyfen induced minor disruption in E. necator development, but compounds with protectant and curative properties (tebuconazole and trifloxystrobin) caused significant, although different, disruption during E. necator-induced epidemics. Bioassays showed that each of the antifungals were most effective at different stages of fungal development, tebuconazole before sporulation and trifloxystrobin after sporulation of the colonies. Results from the bioassay also highlighted likely occurrences in the field, where several stages of fungal development are encountered simultaneously. CONCLUSION: The present findings were complementary: leaf-disc tests showed when the fungicides were most effective at inhibiting E. necator infection cycles; the field trial provided results in terms of incidence and severity of disease on bunches without reference to the pathogenic cycle development. A protection strategy combining the different types of fungicide under study is suggested.

Investigating Disease Spread between Two Assessment Dates with Permutation Tests on a Lattice.

ABSTRACT Mapping and analyzing the disease status of individual plants within a study area at successive dates can give insight into the processes involved in the spread of a disease. We propose a permutation method to analyze such spatiotemporal maps of binary data (healthy or diseased plants) in regularly spaced plantings. It requires little prior information on the causes of disease spread and handles missing plants and censored data. A Monte Carlo test is used to assess whether the location of newly diseased plants is independent of the location of previously diseased plants. The test takes account of the significant spatial structures at each date in order to separate nonrandomness caused by the structure at one date from nonrandomness caused by the dependence between newly diseased plants and previously diseased plants. If there is a nonrandom structure at both dates, independent patterns are simulated by randomly shifting the entire pattern observed at the second date. Otherwise, independent patterns are simulated by randomly reallocating the positions of one group of diseased plants. Simulated and observed patterns of disease are then compared through distance-based statistics. The performance of the method and its robustness are evaluated by its ability to accurately identify simulated independent and dependent bivariate point patterns. Additionally, two realworld spatiotemporal maps with contrasting disease progress illustrate how the tests can provide valuable clues about the processes of disease spread. This method can supplement biological investigations and be used as an exploratory step before developing a specific mechanistic model.

Impact odorants contributing to the fungus type aroma from grape berries contaminated by powdery mildew (Uncinula necator); incidence of enzymatic activities of the yeast Saccharomyces cerevisiae.

Powdery mildew due to the fungus Uncinula necator is an important disease for the vineyard. The development of the fungus at the surface of the berries leads to the occurrence of a very characteristic and sometimes intense mushroom-type odor cited as an important default for grapes quality. Gas chromatography/olfactometry, gas chromatography, and multidimensional gas chromatogaphy/mass spectrometry techniques were used to investigate the most important odorants of grapes diseased by powdery mildew. Among 22 odorants detected, strongly odorant compounds were identified or tentatively identified in purified extracts obtained from grapes diseased by powdery mildew. Aroma extraction dilution analysis (AEDA) analysis revealed that 1-octen-3-one (mushroom odor), (Z)-1,5-octadien-3-one (geranium-leaf odor), and an unidentified odorous zone (fishy-mushroom like odor) were the most potent volatiles of the diseased grapes. In the presence of nonproliferating Saccharomyces cerevisiae yeast cells, and consequently during alcoholic fermentation, the enzymatic reduction of 1-octen-3-one and (Z)-1,5-octadien-3-one to much less odorant compounds, namely 3-octanone and (Z)-5-octen-3-one, was shown. Those results explain to some extent the disappearance of the fungal aroma specific to powdery mildew grapes during alcoholic fermentation.